Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

NOTE: This study was conducted in accordance with the recommendation of the Guide for the Care and Use of Laboratory Animals of the National Institute of Health. The animal protocol was approved by the University of Wisconsin-Madison, Institutional Animal Care and Use Committee. Primary Astrocyte Culture protocol that is presented here is adopted from the protocols presented by Zhang Y19 et al. and Cengiz P20 et al. with some modifications.
1. Hippocampal Dissection and Astrocyte Culture
<ol>
	<li>Prepare all necessary reagents and materials including surgical scissors, smooth fine forceps, flat tip forceps, paper towels, waste bag, 70% ethanol and 2 dissecting dishes (3.5 cm diameter) on ice filled with 2 mL Hank&#39;s Balanced Salt Solution (HBSS) each. Make sure the surgical equipment&#39;s are sterile (autoclave) prior to procedure and use all other materials (Astrocyte plating medium: DMEM + 5% horse serum + 1% penicillin-streptomycin, horse serum, HBSS, 0.25% trypsin, glass coverslips, Petri dishes, 15/50 mL tubes, T25 flasks,&#160;etc.) as pre-sterile.</li>
	<li>Gently hold and spray the head and neck of mouse pup with 70% ethanol and decapitate using sharp sterile scissors [Figure 1 (1)].</li>
	<li>Perform a midline incision from posterior to anterior skull with small scissors along the scalp to expose the brain [Figure&#160;1 (2-3)].</li>
	<li>Cut the cranium carefully from the neck to the nose with small scissors. Then cut cranium anterior to the olfactory bulbs and inferior to the cerebellum to disconnect the cranium from the skull base.</li>
	<li>Make a small incision at the base of the skull and cut along the midline. Use sterile flat-tip forceps to peel away the skull. Remove the brain stem with the help of a curved forceps. Remove brain from the cranium and place into the first dissecting dish [Figure&#160;1 (4-9)]21.</li>
	<li>Using a curved forceps, flip the brain so that the ventral surface of the brain is facing up and then separate both hemispheres with a sharp sterile surgical blade [Figure&#160;1 (10,11)]</li>
	<li>Peel back the cerebral hemispheres and carefully remove the bulging midbrain and thalamic tissue with a sterile flat curved forceps to reveal the hippocampus, a small, seahorse-shaped structure in the medial temporal lobe [Figure&#160;1 (12-14)].</li>
	<li>Remove both the hippocampal lobes [Figure&#160;1 (15,16)] and carefully dissect the meninges from the lobes by pulling with the fine forceps. This step avoids contamination of the final astrocyte culture by meningeal cells and fibroblasts.</li>
	<li>Transfer the prepared hippocampal lobes into the second dish filled with HBSS and return it onto ice [Figure&#160;1 (17,18)]. Pool both hippocampal lobes from a single mouse (P0 - P2) for preparation of hippocampal astrocyte cultures. This gives the astrocyte proper density. Mince hippocampal lobes using a sharp sterile surgical blade (approximately 4 times).</li>
	<li>Aspirate HBSS from dish using a sterile tip attached to a 1 mL pipette&#160;and add 3&#160;mL of 0.25% trypsin, mix, transfer to a 15 mL sterile conical tube and incubate the tissue at 37 &#176;C for 20 min with gentle shaking.</li>
	<li>Centrifuge tube at 300 x g for 5 min. Aspirate supernatant carefully using a sterile glass pipette attached to a vacuum line. Add 10 mL astrocyte plating medium and triturate (20 - 30 times) using a fire polished glass pipette until tissue pieces homogenize.</li>
	<li>Centrifuge tube at 300 x g for 5 min. Aspirate supernatant and add 2 mL of fresh prewarmed astrocyte plating media. Pass cells through a 70 &#956;m mesh filter (cell strainer) into a new 50 mL&#160;conical tube.</li>
	<li>Plate entire cell suspension on a Poly-D-Lysine/Laminin coated sterile T25 culture flask containing 3 mL of astrocyte plating media, then incubate the flask at 37 &#176;C in a 5% CO2 incubator.</li>
	<li>Aspirate entire media at day-in-vitro (DIV) 1, DIV 3 and DIV 7, and replace with 2 mL of fresh astrocyte plating media. Observe the progression and astrocytic confluence under light microscope each time while replacing the astrocyte plating media. 
	NOTE: At DIV 1, all the viable astrocytes are attached to the surface of the culture flask and the dead or dying cells that include neurons are floating in the supernatant. At DIV 3, the attached cells start to divide to form astrocytic cell layer. In the absence of the supportive conditions, culture is almost devoid of any neuronal growth. At DIV 7, astrocyte layer is about 80 - 90% confluent and a few microglia as well as oligodendrocyte precursor cells are present on top of the astrocytic layer.</li>
	<li>Aspirate the plating medium from the flask, add 2 mL of fresh prewarmed astrocyte plating medium, rinse and remove again at DIV 11, when astrocytes are confluent and ready for sub culturing.</li>
	<li>Add 2 mL of 0.25% trypsin, gently rotate the flask a few times and aspirate trypsin using a sterile glass pipet.</li>
	<li>Add 2 mL of 0.25% trypsin and let the flask sit in the tissue culture hood for 4 - 5 min at RT.</li>
	<li>Remove the trypsin and keep the flask at 37 &#176;C in a 5% CO2 incubator for 10 min. Add 5 mL prewarmed astrocyte plating medium and detach the astrocytic layer by tapping the flask against the palm of your hand (3 - 4 times) followed by gentle trituration to achieve complete detachment and collect the astrocytes in a 15 mL conical tube.</li>
	<li>Centrifuge tube at 300 x g for 5 min, aspirate the supernatant, and add 1 mL fresh astrocyte plating medium.</li>
	<li>Add 10 &#956;L of the cell suspension to a hemocytometer and count the cells in the large central gridded area (1 mm2) using an inverted phase contrast microscope (10X objective). Multiply by 104 to estimate the number of cells per mL. One T25 flask will yield ~1 x 106 total dissociated cells. Seed ~1 x 105 cells in 2 mL astrocyte plating medium on a 12 mm diameter Poly-D-Lysine precoated glass coverslip in the well of a 24-well culture dish.</li>
	<li>Incubate at 37 &#176;C in a 5% CO2 incubator. Perform OGD/REOX at DIV 12 - 14 (section 2).</li>
	<li>Treat the astrocyte cultures at DIV 3 with 5 mM L-leucine Methyl Ester (LME) hydrochloride until DIV 11 if hippocampal cultures devoid of microglia are desired. After LME incubation, subject cultures to shaking (300 rpm for 1 h) to remove contaminating microglia. 
	NOTE: LME is a microglial cytotoxic agent that has been used extensively as a method to eliminate proliferating microglia22.</li>
</ol>
2. OGD/REOX Treatment
<ol>
	<li>Aspirate media from coverslip containing adherent astrocyte culture (DIV 12 - 14) and rinse 3 times&#160;by gently rotating the 24-well culture dish holding the coverslip a couple times with 1 mL isotonic OGD solution (pH 7.4) containing (in mM): 0 glucose, 21 NaHCO3, 120 NaCl, 5.36 KCl, 0.33 Na2HPO4, 0.44 KH2PO4, 1.27 CaCl2, and 0.81 MgSO4.</li>
	<li>Add 0.2 mL OGD solution to well to cover the coverslip and incubate for 2 h in a hypoxic incubator containing 94% N2, 1% O2, and 5% CO2. Gently mix with an orbital shaker (50 rpm) for the first 30 min of hypoxia to facilitate gas exchange.</li>
	<li>Incubate normoxic control cells for 2 h in 5% CO2 and atmospheric air in a buffer identical to the OGD solution except for the addition of 5.5 mM glucose.</li>
	<li>For REOX, aspirate OGD solution and add 2 mL&#160;of astrocyte plating medium. Incubate in 5% CO2 and atmospheric air at 37&#176;C for 5 h.</li>
</ol>
3. Immunocytochemical Staining
<ol>
	<li>Aspirate the culture media using a sterile glass pipette attached to a vacuum line and quickly rinse coverslip once by adding 1mL of 0.1 M Tris Buffered Saline (TBS) (154 mM NaCl, 16 mM Trizma Base, 84 mM Tris-HCl, pH 7.4) to the well. Aspirate and add 2 mL of 4% paraformaldehyde (PFA) in 1x Phosphate Buffered Saline (PBS). Incubate for 15 min at RT.</li>
	<li>Aspirate and add 1 mL of 0.1 M TBS, then place on a rocking shaker for 2 min. Repeat 3 times. Add 1 mL blocking solution (10% goat serum, 10 mg/mL BSA, 0.025% Triton X-100 in 0.1 M TBS) and incubate for 30 min at 37 &#176;C on a rocking shaker.</li>
	<li>Aspirate blocking solution and add primary mouse monoclonal anti-GFAP antibody (0.2 mL of a 1:500 dilution in blocking solution) and rabbit polyclonal anti-S100B (1:500) or rabbit polyclonal anti-HIF1&#945; (1:200) for 60 min at 37 &#176;C on a rocking shaker.</li>
	<li>Alternately, some astrocytes are incubated with rabbit polyclonal anti-IBA1 (1:200) and mouse monoclonal anti-MAP2 to access culture purity.</li>
	<li>Aspirate primary antibody and rinse coverslip by adding 1 mL of 0.1 M TBS and placing on a rocking shaker for 2 min and then aspirate. Repeat twice.</li>
	<li>Add 0.2 mL of a 1:200 dilution of the secondary goat anti-rabbit 488-conjugated and anti-mouse 568-conjugated antibodies in blocking solution for 60 min at 37 &#176;C on a rocking shaker.</li>
	<li>Aspirate secondary antibody and rinse coverslip by adding 1 mL of 0.1 M TBS and place on a rocking shaker for 2 min and then aspirate. Repeat twice.</li>
	<li>Remove coverslip from well and dry by placing on a slide positioned on a slide-drier. Mount coverslip on a new slide by inverting on a single drop of VECTASHIELD hardset mounting medium with DAPI (1.5 ng/&#956;L).</li>
	<li>Image coverslips on a confocal microscope using either 20X dry or 60X oil objective. Acquire images (512 x 512) for DAPI (405 nm ex / 450 nm em) and fluorochrome 488 tagged GFAP antibody (488 nm ex / 515 nm em). Keep acquisition parameters constant within the 20X and 60X groups.</li>
</ol>
4. Sex Determination Using PCR
<ol>
	<li>Heat pup toe or finger clippings at 95 &#176;C for 45 min in 50 mM NaOH and neutralize with equal volume of 1 M Tris, pH 6.8.</li>
	<li>Add 1 &#956;L of the extracted DNA solution to 19 &#956;L of the following mixture: 5 pmoles of primers for the Myog and Sry genes, 1x reaction buffer, 0.2 mM each deoxynucleotide and 8 U Taq polymerase.</li>
	<li>Use primers sequences; Sry 5&#39;TCATGAGACTGCCAACCACAG3&#39;, 5&#39;CATGACCACCACCACCACCAA3&#39; and Myog 5&#39;TTACGTCCATCGTGGACAGC3&#39;, 5&#39;TGGGCTGGGTGTTAGTCTTA3&#39;23.</li>
	<li>Perform the following PCR protocol: 95 &#176;C for 3 min then 30 cycles of denaturation at 95 &#176;C for 15 s, annealing at 58 &#176;C for 15 s, and elongation at 72 &#176;C for 1 min. Following this 30 cycles, the reaction concludes with a final 72 &#176;C elongation for 1 min.</li>
	<li>Separate PCR products electrophoretically on an ethidium bromide-containing 2% agarose gel and visualize under UV illumination. (Figure 2A.) CAUTION! Ethidium bromide is a potential carcinogen and must be handled carefully and disposed of properly as per institution&#39;s regulations.</li>
</ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

None of the authors have competing&#160;or conflicting interests.

In order to study the sex differences in the properties and function of astrocytes under physiological and pathological conditions, preparation of sexed primary astrocytes in cell culture is an important tool to utilize. In the present study we report a highly efficient and a reproducible method to culture a highly enriched homogeneous population of sexed hippocampal astrocytes from newborn (P0-P2) C57Bl/6 (wild type) or K19F (GFAP null) mouse pups in-vitro. Establishing this methodology helps the investigators ...

Astrocytes are one of the most important key players in the central nervous system (CNS). Growing body of evidence indicates that the roles of astrocytes are more than providing&#160;neuronal support. In fact, the roles of astrocytes under physiological conditions can be very complex, such as guiding the migration of the developing axons1, regulating CNS blood flow2, maintaining the pH homeostasis of the synaptic interstitial fluid3, and participating in the blood brain barrier4 and synaptic transmission5. Under pathological conditions, astrocytes respond to injury with a process called reactive astrogliosis in which the morphology, number, location, topography (with respect to distance from insult) and function of the astrocytes may change in a heterogeneous way6,7. Astrogliosis seen following neonatal hypoxic ischemic encephalopathy maybe contributing to the morbidity and mortality of neonates8.
Recent clinical and experimental studies indicate that the severity of brain injury appears to be sex-dependent and that the male neonates are more susceptible to the effects of hypoxia/ischemia (HI)-related brain injury, resulting in more severe neurological outcomes as compared to females with comparable brain injuries9-11. Although the localization of the injury depends on the gestational age and the&#160;duration and the severity of the insult, hippocampus is one of the most commonly effected regions in the CNS after term neonatal HI,&#160;and increased hippocampal astrogliosis has been confirmed by up-regulation of the Glial Fibrillary Acidic Protein (GFAP) 3 d&#160;after the neonatal HI7,10,12,13. Sex differences in astrocyte function were shown in both neonates and adult rodents after cerebral ischemia14,15. In addition, male astrocytic susceptibility to in-vitro ischemia was shown by increased cell death compared to female cortical astrocytes in culture16.
Sex differences start in-utero and continue until death17. Over the last decade, the importance of including the sexes in experimental conditions in cell culture and in-vivo&#160;studies have been the emphasis of the Institute of Medicine and NIH to seek fundamental knowledge in the sex differences seen in physiological and pathological conditions17,18. Development of reliable methods to isolate and maintain populations of sexed hippocampal astrocytes is essential to understand the cellular basis of sex differences in the pathological consequences of neonatal HI. The present study was designed to provide the techniques to prepare enriched sex-specific hippocampal astrocyte cultures from newborn mice in order to assess the roles of GFAP-immunoreactive astrocytes following Oxygen/Glucose Deprivation (OGD) and reoxygenation (REOX),&#160;inducing&#160;HI in cell culture environment. This technique can be used to test any hypothesis pertaining to hippocampal astrocytes in neonatal males and females under normoxic and ischemic conditions.

<table><tbody><tr><td>&lt;strong&gt;&lt;em&gt;Astrocyte culture media&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM, high glucose</td><td>cellgro</td><td>10-013-CV</td><td></td></tr><tr><td>Horse Serum</td><td>Gibco</td><td>26050-070</td><td>Final Concentration: 10%</td></tr><tr><td>Penicillin-Streptomycin</td><td>Cellgro&amp;nbsp;</td><td>30-002-CI</td><td>Final Concentration: 1%</td></tr><tr><td>L-Leucine methyl ester hydrochloride</td><td>Aldrich</td><td>L1002-25G</td><td>Final Concentration: 5 mM</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Solution for brain tissue digestion&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HBSS</td><td>Life Technologies</td><td>14170-088</td><td></td></tr><tr><td>Trypsin</td><td>cellgro</td><td>25-050-CI</td><td>Final Concentration: 0.25%</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Other&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>70% (vol/vol) ethanol</td><td>Roth</td><td>9065.2</td><td></td></tr><tr><td>Poly-D-Lysine (PDL) 12 mm round coverslips&amp;nbsp;</td><td>Corning</td><td>354087</td><td></td></tr><tr><td>Water</td><td>Sigma</td><td>W3500</td><td>Cell-culture grade</td></tr><tr><td>PBS</td><td>cellgro</td><td>21-040-CV</td><td>Cell-culture grade</td></tr><tr><td>0.05% Trypsin-EDTA&amp;nbsp;</td><td>Life Technologies</td><td>25300-062</td><td></td></tr><tr><td>70 &amp;mu;m Sterile cell strainer&amp;nbsp;</td><td>Fisher scientific</td><td>22363548</td><td></td></tr><tr><td>3.5 cm Petri dish</td><td>BD Falcon</td><td>353001</td><td></td></tr><tr><td>15 mL Falcon tube</td><td>BD Falcon</td><td>352096</td><td></td></tr><tr><td>50 mL Falcon tube</td><td>BD Falcon</td><td>352070</td><td></td></tr><tr><td>Forceps, fine&amp;nbsp;</td><td>Dumont</td><td>2-1032; 2-1033</td><td># 3c; # 5</td></tr><tr><td>Forceps, flat tip</td><td>KLS Martin</td><td>12-120-11</td><td></td></tr><tr><td>13 cm surgical scissors</td><td>Aesculap</td><td>BC-140-R</td><td></td></tr><tr><td>Confocal Microscope</td><td>Nikon</td><td>A1RSi&amp;nbsp;</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5805000.017</td><td>5804R</td></tr><tr><td>Orbital Shaker</td><td>Thermo Scientific</td><td>SHKE 4450-1CE</td><td>MaxQ 4450&amp;nbsp;</td></tr><tr><td>Anti-IBA1</td><td>Wako</td><td>019-19741</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-MAP2</td><td>Sigma</td><td>M2320</td><td>Mouse monoclonal</td></tr><tr><td>Anti-HIF1alpha</td><td>abcam</td><td>ab179483</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-S100B</td><td>Sigma</td><td>HPA015768</td><td>Rabbit polyclonal</td></tr><tr><td>Anti-GFAP (cocktail)</td><td>Biolegend</td><td>837602</td><td></td></tr><tr><td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td><td>Vector Labs</td><td>PK-6101</td><td>Contains 4 Reagents&amp;nbsp;</td></tr><tr><td>Goat Anti Rabbit Alexa-Fluor 488</td><td>Invitrogen</td><td>A11070</td><td></td></tr><tr><td>Goat Anti Mouse Alexa-Fluor 568</td><td>Invitrogen</td><td>A11004</td><td></td></tr></tbody></table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies indicate that the severity of brain injury appear to be sex dependent, and that the male neonates are more susceptible to the effects of HI-related brain injury, resulting in more severe neurological outcomes as compared to females with comparable brain injuries. The development of reliable methods to isolate and maintain highly enriched populations of sexed hippocampal astrocytes is essential to understand the cellular basis of sex differences in the pathological consequences of neonatal HI. In this study, we describe a method for creating sex specific hippocampal astrocyte cultures that are subjected to a model of in-vitro ischemia, oxygen-glucose deprivation, followed by reoxygenation. Subsequent reactive astrogliosis was examined by immunostaining for the Glial Fibrillary Acidic Protein (GFAP) and S100B. This method provides a useful tool to study the role of male and female hippocampal astrocytes following neonatal HI, separately.

Understanding the roles of sexed astrocyte functions under physiologic or pathophysiological conditions have been immensely elucidated by culturing these cells under in vitro conditions. The important aspect of performing sexed culturing is to determine the sex of the mouse pup prior to its use. We determined the sex of the mouse genetically by PCR and by visual assessment (Figure 2)16. The methodology of sex determination using PCR was adopted with mo...

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Astrocytes are one of the most important key players in the central nervous system (CNS). Here, we are reporting a practical method of sexed hippocampal astrocyte culture protocol in order to study the mechanisms underlying the astrocyte function in male and female neonate pups after in-vitro ischemia.

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Research

JoVE Journal

Neuroscience

13.3K Views.  University of Wisconsin. Astrocytes are one of the most important key players in the central nervous system (CNS). Here, we are reporting a practical method of sexed hippocampal astrocyte culture protocol in order to study the mechanisms underlying the astrocyte function in male and female neonate pups after in-vitro ischemia.

Video: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Assessment of Dendritic Arborization in the Dentate Gyrus of the Hippocampal Region in Mice

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity and extent of dendritic arborization correlates well with the synaptic plasticity in these cells. A reliable method for assessment of dendritic arborization is needed to characterize the deleterious effects of neurological disorders on these structures and to determine the effects of therapeutic interventions. However, quantification of these structures has proven to be a formidable task given their complex and dynamic nature. Fortunately, sophisticated imaging techniques can be paired with conventional staining methods to assess the state of dendritic arborization, providing a more reliable and expeditious means of assessment. Below is an example of how these imaging techniques were paired with staining methods to characterize the dendritic arborization in wild type mice. These complementary imaging methods can be used to qualitatively and quantitatively assess dendritic arborization that span a rather wide area within the hippocampal region.

We describe two methods for visualization and quantification of dendritic arborization in the hippocampus of mouse models: real-time and extended depth of field imaging. While the former method allows sophisticated topographical tracing and quantification of the extent of branching, the latter allows speedy visualization of the dendritic tree.

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity ...

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of oxygen and glucose, which causes energy failure and neuronal death. After an ischemic stroke insult, astrocytes become reactive and proliferate around the injury site as it develops. Under this scenario, it is difficult to study the specific contribution of astrocytes to the brain region exposed to ischemia. Therefore, this article introduces a methodology to study primary astrocyte reactivity and proliferation under an in vitro model of an ischemia-like environment, called oxygen glucose deprivation (OGD). Astrocytes were isolated from 1-4 day-old neonatal rats and the number of non-specific astrocytic cells was assessed using astrocyte selective marker Glial Fibrillary Acidic Protein (GFAP) and nuclear staining. The period in which astrocytes are subjected to the OGD condition can be customized, as well as the percentage of oxygen they are exposed to. This flexibility allows scientists to characterize the duration of the ischemic-like condition in different groups of cells in vitro. This article discusses the timeframes of OGD that induce astrocyte reactivity, hypertrophic morphology, and proliferation as measured by immunofluorescence using Proliferating Cell Nuclear Antigen (PCNA). Besides proliferation, astrocytes undergo energy and oxidative stress, and respond to OGD by releasing soluble factors into the cell medium. This medium can be collected and used to analyze the effects of molecules released by astrocytes in primary neuronal cultures without cell-to-cell interaction. In summary, this primary cell culture model can be efficiently used to understand the role of isolated astrocytes upon injury.

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex event in which the specific contribution of astrocytes to the affected brain region exposed to oxygen glucose deprivation (OGD) is difficult to study. This article introduces a methodology to obtain isolated astrocytes and study their reactivity and proliferation under OGD conditions.

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of ...

Neurobehavioral Assessments in a Mouse Model of Neonatal Hypoxic-ischemic Brain Injury

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI brain injury by studying neurobehavioral functions in these mice compared to non-operated (i.e., normal) mice. During the study, Rice-Vannucci&#39;s method was used to induce neonatal HI brain damage in postnatal day 7-10 (P7-10) mice. The HI operation was performed on the pups by unilateral carotid artery ligation and exposure to hypoxia (8% O2 and 92% N2 for 90 min). One week after the operation, the damaged brains were evaluated with the naked eye through the semi-transparent skull and were categorized into subgroups based on the absence (&#34;no cortical injury&#34; group) or presence (&#34;cortical injury&#34; group) of cortical injury, such as a lesion in the right hemisphere. On week 6, the following neurobehavioral tests were performed to evaluate the cognitive and motor functions: passive avoidance task (PAT), ladder walking test, and grip strength test. These behavioral tests are helpful in determining the effects of neonatal HI brain injury and are used in other mouse models of neurodegenerative diseases. In this study, neonatal HI brain injury mice showed motor deficits that corresponded to right hemisphere damage. The behavioral test results are relevant to the deficits observed in human neonatal HI patients, such as cerebral palsy or neonatal stroke patients. In this study, a mouse model of neonatal HI brain injury was established and showed different degrees of motor deficits and cognitive impairment compared to non-operated mice. This work provides basic information on the HI mouse model. MRI images demonstrate the different phenotypes, separated according to the severity of brain damage by motor and cognitive tests.

We performed unilateral carotid artery occlusion on postnatal day 7-10 CD-1 mouse pups to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of HI brain injury. We studied neurobehavioral functions in these mice compared to non-operated normal mice.

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI ...

Ex Vivo Pressurized Hippocampal Capillary-Parenchymal Arteriole Preparation for Functional Study

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and cardiac arrest are remarkably sexually dimorphic diseases, and both induce cerebral ischemia. However, progress in understanding the vascular cognitive impairment, and then developing sex-specific treatments, has been partly limited by challenges in investigating the brain microcirculation from mouse models in functional studies. Here, we present an approach to examine the capillary-to-arteriole signaling in an ex vivo hippocampal capillary-parenchymal arteriole (HiCaPA) preparation from mouse brain. We describe how to isolate, cannulate, and pressurize the microcirculation to measure arteriolar diameter in response to capillary stimulation. We show which appropriate functional controls can be used to validate the HiCaPA preparation integrity and display typical results, including testing potassium as a neurovascular coupling agent and the effect of the recently characterized inhibitor of the Kir2 inward rectifying potassium channel family, ML133. Further, we compare the responses in preparations obtained from male and female mice. While these data reflect functional investigations, our approach can also be used in molecular biology, immunochemistry, and electrophysiology studies.

The present manuscript details how to isolate hippocampal arterioles and capillaries from the mouse brain and how to pressurize them for pressure myography, immunofluorescence, biochemistry, and molecular studies.

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and ...

A Cell Culture Model for Studying the Role of Neuron-Glia Interactions in Ischemia

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent neuronal loss. Numerous evidence suggests that the interaction between glial and neuronal cells exert beneficial effects after an ischemic event. Therefore, to explore potential protective mechanisms, it is important to develop models that allow studying neuron-glia interactions in an ischemic environment. Herein we present a simple approach to isolate astrocytes and neurons from the rat embryonic cortex, and that by using specific culture media, allows the establishment of neuron- or astrocyte-enriched cultures or neuron-glia cultures with high yield and reproducibility.
To study the crosstalk between astrocytes and neurons, we propose an approach based on a co-culture system in which neurons cultured in coverslips are maintained in contact with a monolayer of astrocytes plated in multiwell plates. The two cultures are maintained apart by small paraffin spheres. This approach allows the independent manipulation and the application of specific treatments to each cell type, which represents an advantage in many studies.
To simulate what occurs during an ischemic stroke, the cultures are subjected to an oxygen and glucose deprivation protocol. This protocol represents a useful tool to study the role of neuron-glia interactions in ischemic stroke.

Here, we present a simple approach using specific culture media that allows the establishment of neuron- and astrocyte-enriched cultures, or neuron-glia cultures from the embryonic cortex, with high yield and reproducibility.

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent ...

Analysis of Astrocyte Territory Volume and Tiling in Thick Free-Floating Tissue Sections

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the brain. Through these interactions, astrocytes actively regulate many critical brain functions, including synapse formation, neurotransmission, and ion homeostasis. In the rodent brain, astrocytes grow in size and complexity during the first three postnatal weeks and establish distinct, non-overlapping territories to tile the brain. This protocol provides an established method for analyzing astrocyte territory volume and astrocyte tiling using free-floating tissue sections from the mouse brain. First, this protocol describes the steps for tissue collection, cryosectioning, and immunostaining of free-floating tissue sections. Second, this protocol describes image acquisition and analysis of astrocyte territory volume and territory overlap volume, using commercially available image analysis software. Lastly, this manuscript discusses the advantages, important considerations, common pitfalls, and limitations of these methods. This protocol requires brain tissue with sparse or mosaic fluorescent labeling of astrocytes, and is designed to be used with common lab equipment, confocal microscopy, and commercially available image analysis software.

This protocol describes methods for sectioning, staining, and imaging free-floating tissue sections of the mouse brain, followed by a detailed description of the analysis of astrocyte territory volume and astrocyte territory overlap or tiling.

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the ...

Occlusion of Distal Middle Artery to Develop an Ischemic Stroke Mouse Model

Induction of Acute Ischemic Stroke in Mice Using the Distal Middle Artery Occlusion Technique

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic stroke patients are eligible to receive intravascular thrombolysis or mechanical thrombectomy therapy within the optimal time window. Among those stroke survivors, around two-thirds suffer neurological dysfunctions over an extended period. Establishing a stable and repeatable experimental ischemic stroke model is extremely significant for further investigating the pathophysiological mechanisms and developing effective therapeutic strategies for ischemic stroke. The middle cerebral artery (MCA) represents the predominant location of ischemic stroke in humans, with the MCA occlusion serving as the frequently employed model of focal cerebral ischemia. In this protocol, we describe the methodology of establishing the distal MCA occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6 mice. Since the occlusion site is located at the cortical branch of MCA, this model generates a moderate infarcted lesion restricted to the cortex. Neurological behavioral and histopathological characterization have demonstrated visible motor dysfunction, neuron degeneration, and pronounced activation of microglia and astrocytes in this model. Thus, this dMCAO mouse model provides a valuable tool for investigating the ischemiastroke and worth of popularization.

Author Spotlight: Establishing a Reliable Distal MCA Occlusion Model in Mice for Stroke Research

Here, we present a protocol to establish a distal middle cerebral artery occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6J mice and evaluate the subsequent neurological behavior and histopathological features.

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic ...

A Needle Model for Vascular Cognitive Impairment Studies in Mice

A Mouse Model for Vascular Cognitive Impairment and Dementia Based on Needle-guided Asymmetric Bilateral Common Carotid Artery Stenosis

Vascular cognitive impairment and dementia (VCID) results from vascular brain injury. Given VCID&#39;s high incidence, which is expected to continue rising as the population ages, it is critical to establish a robust animal model for the disease. This paper presents a novel method of creating a mouse model of VCID that is based on asymmetric bilateral common carotid artery stenosis, which mimics human chronic cerebral hypoperfusion caused by carotid atherosclerosis.
Briefly, common carotid arteries (CCAs) are ligated to different gauge needles (32 G for the right CCA and 34 G for the left CCA) using 7-0 silk sutures followed by immediate needle removal. The remaining suture rings cause persistent blood flow reduction and long-term cognitive impairment associated with white matter injury, microinfarcts, and reactive gliosis, thus closely mimicking the pathogenesis of VCID. Importantly, in this needle model, the clinical representations do not revert with time, providing reliable long-term cognitive impairment. Moreover, the survival rate 24 weeks post surgery was 81.6%, which is higher compared to the other established models of VCID with a similar level of blood flow reduction.
Additional advantages include low material cost and compatibility with MRI to monitor brain injury in live animals since no metal is implanted. The main challenge in employing the needle model of VCID is the requirement for developing advanced surgical skills since mouse CCAs are less than 0.6 mm in diameter and are very fragile. High-quality visual representation of the surgery will thus help researchers to master this technique and advance our understanding of VCID, potentially leading to the development of novel therapeutic modalities to decrease the devastating cognitive decline associated with VCID.

The needle method of asymmetric bilateral common carotid artery stenosis is proposed to create a mouse model for vascular cognitive impairment and dementia. It results in longer-term outcomes compared to previously established models and is compatible with live MRI. Visual representation demonstrating the procedure provides guidance for mastering the surgery.

Vascular cognitive impairment and dementia (VCID) results from vascular brain injury. Given VCID&#39;s high incidence, which is expected to continue ...

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Summary

Explore More Videos

Chapters in this video

Isolation and Culture of Mouse Cortical Astrocytes

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Assessment of Dendritic Arborization in the Dentate Gyrus of the Hippocampal Region in Mice

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Neurobehavioral Assessments in a Mouse Model of Neonatal Hypoxic-ischemic Brain Injury

Ex Vivo Pressurized Hippocampal Capillary-Parenchymal Arteriole Preparation for Functional Study

A Cell Culture Model for Studying the Role of Neuron-Glia Interactions in Ischemia

Analysis of Astrocyte Territory Volume and Tiling in Thick Free-Floating Tissue Sections

Induction of Acute Ischemic Stroke in Mice Using the Distal Middle Artery Occlusion Technique

A Mouse Model for Vascular Cognitive Impairment and Dementia Based on Needle-guided Asymmetric Bilateral Common Carotid Artery Stenosis