S. Zhang is funded by China Scholarship Council. The authors are very grateful to former people working on polyketomycin project in this lab and Prof. Dr. Hans-Peter Fiedler, University of T&#252;bingen, for providing the polyketomycin producer. The research was supported by the DFG (RTG 1976).

1. Identification of a Natural Product with Antibiotic Property
<ol>
	<li>Cultivate a microorganism under different conditions (e.g. time, temperature, pH, media) following the &#34;OSMAC (one strain-many compounds) approach&#34;13. Select one medium in which the production of a compound is observed.</li>
	<li>Cultivate Streptomyces diastatochromogenes T&#252;6028 under the following conditions
	<ol>
		<li>Grow Streptomyces diastatochromogenes T&#252;6026 strain on MS plates (soy flour 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1.5%, tap water 1 L). Inoculate a small loop of the spores of this strain into 20 mL&#160;liquid TSB medium (tryptic soy broth 30 g, tap water 1 L, pH 7.2; preculture medium) in an Erlenmeyer flask with a spiral. Shake the flask on a rotary shaker (28 &#176;C, 180 rpm, 2 days).</li>
		<li>Inoculate main culture in 100 mL&#160;HA medium (glucose 4 g, yeast extract 4 g, malt extract 10 g, tap water 1 L, pH 7.2) with 2 mL&#160;of the preculture. Culture the strain at 28 &#176;C for 6 days on a rotary shaker at 180 rpm.</li>
	</ol>
	</li>
	<li>Preparation of the crude extract
	<ol>
		<li>Harvest cells by centrifugation (10 min, 3,000 x g).</li>
		<li>For next steps handle organic solvents under a fume hood.</li>
		<li>For compound extraction from the mycelium, resuspend cells in a twofold volume of acetone and shake in a tube for 30 min, 180 rpm. Filter the liquid through commercial filter paper and evaporate acetone by rotary evaporator at 40 &#176;C and 550 bar. Dissolve the extract in 20 mL water:ethyl acetate (1:1) and shake it in a separating funnel for 30 min at 180 rpm.</li>
		<li>For compound extraction from the culture medium, adjust the culture broth to pH 4.0 by the addition of 1 M HCl. Add 100 mL&#160;ethyl acetate and shake it in a separating funnel for 30 min, 180 rpm.</li>
		<li>Collect ethyl acetate phase and evaporate by rotary evaporation at 40 &#176;C and 240 bar.</li>
	</ol>
	</li>
	<li>Analysis of the crude extract by HPLC
	<ol>
		<li>Dissolve the extracts in 1 mL&#160;MeOH, filter them through a 0.45 &#181;m pore size filter and run high-performance liquid chromatography (HPLC)14.</li>
		<li>In the case of polyketomycin, equip the HPLC system with a C18 precolumn (4.6 x 20 mm2) and a C18 column (4.6 x 100 mm2). Use a linear gradient of acetonitrile + 0.5% acetic acid ranging from 20% to 95% in H2O + 0.5% acetic acid (flow rate: 0.5 mL&#160;min-1). 
		NOTE: Polyketomycin has a retention time of 25.9 min (see Figure 1A). The UV/vis spectrum has maxima at 242 nm, 282 nm, 446 nm and minima at 262 nm and 359 nm (see Figure 1B). In the negative modus a mass of 863.2 [M-H]- is detectable (see Figure 1C).</li>
	</ol>
	</li>
</ol>
<img alt="Figure 1" src="/files/ftp_upload/54952/54952fig1.jpg" /> 
Figure 1: LC/MS Analysis of Polyketomycin. (A) HPLC chromatogram (&#955; = 430 nm) of the crude extract after cultivation of Streptomyces diastatochromogenes T&#252;6028 for 6 days. Polyketomycin has a retention time of 25.9 min (B) UV/vis spectra of Polyketomycin. (C) Mass spectra of Polyketomycin in the negative modus. Main peak with m/z 863.2 [M-H]-.<a href="http://cloudfront.jove.com/files/ftp_upload/54952/54952fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<ol start="5">
	<li>Identification of the antibiotic activity using disc diffusion assay
	<ol>
		<li>Inoculate test strains like Gram-positive bacteria Bacillus subtilis (in LB medium; LB 20 g, tap water 1 L, pH 7.4) and other Streptomyces strains (in TSB medium; tryptic soy broth 30 g, tap water 1 L, pH 7.2), Gram-negative bacteria Escherichia coli (in LB medium) and fungal strains (in media such as YPD medium; yeast extract 10 g, peptone 20 g, glucose 20 g, tap water 1 L, pH 7.4). Take 100 &#181;L&#160;of test strain preculture and spread them onto respective agar plates.</li>
		<li>Dissolve the crude extract or purified compound in 500 &#181;L&#160;of methanol (alternatively water or DMSO) and pipette 20-50 &#181;L&#160;onto sterile paper discs. Dry paper discs for 30 min under the work bench and put them onto the plates with test cultures. Prepare a negative control (solvent) and a positive control (antibiotic, e.g. apramycin [1 mg]).</li>
		<li>Incubate the plates under adequate conditions until the test strains are visibly grown and determine inhibition zone, if apparent. Incubate E. coli and Bacillus sp. at 37 &#176;C for 16 h, Streptomyces sp. at 28 &#176;C for 2-4 days, fungal strain (mainly dependent on exact test strain) at 30 &#176;C for 2 days).</li>
	</ol>
	</li>
</ol>
2. Large Scale Extraction, Purification and Structure Elucidation of the Compound
<ol>
	<li>Cultivate S. diastatochromogenes in 5 L HA medium (glucose 4 g, yeast extract 4 g, malt extract 10 g, tap water 1 L, pH 7.2). Inoculate 2 mL&#160;of the preculture in 30 x 500 mL Erlenmeyer flasks containing 150 mL&#160;HA medium. Incubate the strain at 28 &#176;C for 6 days on a rotary shaker at 180 rpm.</li>
	<li>Harvest cells by centrifugation (10 min, 15,000 x g, RT) and extract compounds using ethyl acetate (see section 1.3).</li>
</ol>
<img alt="Figure 2" src="/files/ftp_upload/54952/54952fig2.jpg" /> 
Figure 2: Workflow for Structure Elucidation. The process comprises (1) cultivation of the strain, (2) extraction, (3) purification by solid phase extraction (SPE), thin layer chromatography (TLC), preparative high-performance liquid chromatography (HPLC), size exclusion chromatography (SEC) and (4) structure elucidation by mass analysis (MS), nuclear magnetic resonance (NMR) and X-ray measurements. <a href="http://cloudfront.jove.com/files/ftp_upload/54952/54952fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<ol start="3">
	<li>Purification of Polyketomycin 
	NOTE: The process of purification and structure elucidation is shown in Figure 2.
	<ol>
		<li>Fractionate crude extract by a C18 solid phase extraction (SPE) column using a 10%-stepwise MeOH gradient ranging from 30% to 100% MeOH in H2O, 100 mL&#160;for each condition.</li>
		<li>Purify the compound-containing fraction further by preparative thin-layer chromatography (TLC)15 using CH2Cl2/MeOH (7:1) as elution system.</li>
		<li>Purify the compound by preparative HPLC16. Equip the HPLC system with a C18 precolumn (5&#160;&#181;m; 9.4 x 20 mm) and a main column (5 &#181;m; 9.4 x 150 mm). Use a gradient of acetonitrile + 0.5% acetic acid ranging from 20% to 95% in H2O + 0.5% acetic acid (flow rate: 2.0&#160;mL/min).</li>
		<li>To remove solvents and other small impurities, perform a last purification step by size exclusion chromatography using a column in MeOH17. Collect the final pure compound and evaporate MeOH by rotary evaporation at 40 &#176;C and 240 bar.</li>
	</ol>
	</li>
	<li>Structure elucidation
	<ol>
		<li>Dissolve the pure compound (more than 2 mg) in 600-700 &#181;L&#160;(dependent on the machine) of DMSO-d6, record 1D NMR (1H, 13C) and 2D NMR (HSQC, HMBC,1H-1H COSY) spectra on a NMR spectrometer18. Express chemical shifts in &#948; values (ppm) by using DMSO-d6.</li>
		<li>Record a high-resolution mass spectrum (HRESI-MS)19 of polyketomycin using a high-resolution mass spectrometer.</li>
		<li>Elucidate the structure by interpretation of the results of NMR and MS data analysis10.</li>
	</ol>
	</li>
</ol>
3. Propose Biosynthetic Model of the New Isolated Compound
<ol>
	<li>Analyze the structure of the isolated compound and predict enzymes, which might be involved in its biosynthesis. Assign them to polyketide (type I, II or III), non-ribosomal peptide synthesis, lantipeptide, terpenoid, or sugar metabolism pathway8.</li>
	<li>Example polyketomycin
	<ol>
		<li>Subdivide the structure into obvious single moieties: tetracyclic moiety, two monosaccharides and the dimethyl salicylic acid.</li>
		<li>Find out, where the moieties might be derived from: The tetracyclic moiety might be derived from a polyketide synthase type II and the dimethyl salicylic acid moiety might be derived by an iterative polyketide synthase type I. The two sugar moieties, which are 6-deoxysugars, might be synthesized from glucose involving a TDP-glucose-4,6-dehydratase during biosynthesis and attached probably by two glycosyltransferases (see Figure 3)8.</li>
		<li>Predict putative genes in the cluster. Think of enzymes which are involved in the synthesis of the single moieties, in connecting the units, as well as in modifying and tailoring the molecule. The biosynthetic gene cluster of Polyketomycin most probably contains genes encoding a polyketide synthase type II (therefore minimum an ACP, KS&#945; und KS&#946; for connecting extender units), an iterative polyketide synthase type I (at least ACP, AT, KS), a TDP-glucose-4,6-dehydratase (necessary for step: glucose &#8594; deoxyglucose) and two glycosyltransferases (attaching two sugar monomers to the aglycone)8.</li>
	</ol>
	</li>
</ol>
<img alt="Figure 3" src="/files/ftp_upload/54952/54952fig3.jpg" /> 
Figure 3: Structure of Polyketomycin Divided into Single Building Blocks. Polyketomycin is composed of a tetracyclic decaketid (PKS type II) and a dimethyl salicylic acid (iterative PKS type I), linked by the two deoxysugar moieties &#946;-D-amicetose and &#945;-L-axenose (NDP-glucose-4,6-dehydratase and two glycosyltransferase required). <a href="http://cloudfront.jove.com/files/ftp_upload/54952/54952fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>&#160;&#160;
4. Genome Sequencing/Mining
<ol>
	<li>Next generation sequencing
	<ol>
		<li>Sequence the genomic DNA by next generation sequencing technologies like Illumina, 454 pyrosequencing or SOLiD20. Align single reads to a reference sequence or assemble de novo. 
		NOTE: The genome of S. diastatochromogenes T&#252;6028 was sequenced at the Center for Biotechnology (CeBiTec) at the University of Bielefeld. All reads were assembled to a draft genome of 7.9 Mb.</li>
	</ol>
	</li>
	<li>Genome mining
	<ol>
		<li>Search for open reading frames (ORFs) by the usage of for example NCBI Prokaryotic Genome Annotation Pipeline21,22, RAST (rapid annotation using subsystem technology)23,24,25, Prokka (rapid prokaryotic genome annotation)26 or GenDB27. These programs also propose their functions. The analysis of the S. diastatochromogenes T&#252;6028 draft genome sequence led to the identification of more than 7,000 ORFs.</li>
		<li>Run specific BLAST (Basic Local Alignment Search Tool) analysis to get more information like alignments with other similar genes and catalytic domains28,29,30.</li>
		<li>For the identification of the secondary metabolite gene cluster run programs like antiSMASH31,32,33, NaPDoS34 and NRPSpredictor35,36. In the draft genome of Streptomyces diastatochromogenes antiSMASH31,32,33 identified 22 gene clusters.</li>
		<li>Analyze the putative gene clusters for their enzymatic pathway(s) (polyketide synthase (type I, II or III), non-ribosomal peptide synthetase, lanthipeptide, terpenoid, sugar metabolism &#8230;). Search for cluster(s) containing genes which might be involved in the synthesis of the compound (see section 3). In S. diastatochromogenes annotated cluster 2 contains polyketide synthase type II genes, three polyketide synthase type I genes, a TDP-glucose-4,6-dehydratase gene and two glycosyltransferase genes (see Figure 4).</li>
		<li>Focus on single genes within the cluster. For PKS type I and NRPS the specificity of acyltransferases and adenylation domains, and thus the incorporation of single extender units, may be predicted. Also compare the order of the incorporated extender unit with the molecule. antiSMASH31,32,33 also shows similar clusters of already known compounds, with a link to MIBiG database37.</li>
		<li>Compare the structure of the compound with these other compounds and check for similarities.</li>
	</ol>
	</li>
</ol>
<img alt="Figure 4" src="/files/ftp_upload/54952/54952fig4.jpg" /> 
Figure 4: antiSMASH Output of Polyketomycin Biosynthetic Gene Cluster and Overview of Other Clusters in S. diastatochromogenes T&#252;6028. (A) Overview of predicted biosynthetic gene clusters in the genome of S. diastatochromogenes T&#252;6028; (B) Cluster 2 Polyketomycin biosynthetic gene cluster with targeted genes. <a href="http://cloudfront.jove.com/files/ftp_upload/54952/54952fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
5. Verification of the Biosynthetic Gene Cluster
<ol>
	<li>Search for a gene with obvious and important (essential) functions for biosynthesis of the compound. For verification of the polyketomycin gene cluster the gene pokPI, coding for the ketosynthase &#945; from the PKS type II, was selected and inactivated by an out of frame-deletion (see Figure 5B). Alternatively, interrupt the gene by cloning an internal fragment (see&#160;Figure&#160;5C).</li>
</ol>
<img alt="Figure 5" src="/files/ftp_upload/54952/54952fig5.jpg" /> 
Figure 5: Verification of a Gene Cluster by Single Crossover. (A) Native gene leads to the translation of a functional protein; (B) Cloning of the gene with internal deletion into a suicide vector leads to a single crossover resulting in a frame shift in the targeted gene and subsequent translation of non-functional protein; (C) Cloning of an internal fragment of the gene into a suicide vector leads to a truncation of the gene and subsequent translation of a non-functional protein. oriT: origin of transfer; antibioticR: antibiotic resistance. <a href="http://cloudfront.jove.com/files/ftp_upload/54952/54952fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<ol start="2">
	<li>Cloning of the single-crossover construct
	<ol>
		<li>Amplify a fragment containing pokPI by PCR38 with primers pokPI_for and pokPI_rev.</li>
		<li>Clone PCR product into suicide vector pKC113239 (apramycinR [50 mg/mL]). The suicide vector is not able to replicate in the Streptomyces strain and thus has to integrate into the targeted gene by homologous recombination to provide apramycin-resistance. Transfer the vector into E. coli cloning host by heat shock transformation40.</li>
		<li>Isolate the vector by alkaline lysis41.</li>
		<li>Digest the vector DNA with a single cutter restriction enzyme that cuts within the fragment. The pokPI gene was digested with enzyme KpnI.</li>
		<li>Treat digested vector DNA with large DNA polymerase I (klenow) fragment, which has 5&#39;&#8594;3&#39; polymerase activity and 3&#39;&#8594;5&#39; exonuclease-activity. Blunting of the sticky ends and subsequent religation leads to loss of four bases. Check for loss of these bases by the steps transformation into E. coli XL1 Blue, picking single colonies, isolating their plasmid DNA,41 and analyzing further by restriction digestion and sequencing.</li>
	</ol>
	</li>
	<li>Conjugation of the single-crossover construct into Streptomyces
	<ol>
		<li>Transfer the suicide vector containing the pokPI gene (pKC1132_pokPIdel) with deletion into E. coli ET12567 pUZ800242 (kanamycinR) by heat shock transformation40. Incubate the cells in 100 mL&#160;LB media (kanamycin 50 &#181;g mL-1, apramycin 50 &#181;g mL-1) overnight at 37 &#176;C. Harvest cells by centrifugation (3,000 x g, 10 min, 4 &#176;C) and wash cells twice by resuspending in 50 mL&#160;LB media. Finally, resuspend cells in 2 x 500 &#181;L&#160;of LB media.</li>
		<li>Mix 500 &#181;L&#160;E. coli pUZ8002 pKC1132_pokPIdel with 500 &#181;L&#160;Streptomyces diastatochromogenes culture (alternatively use spores). Spread the mixture on MS plates (soy flour 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1.5%, tap water 1 L). Incubate the plates for 20 h at 28 &#176;C.</li>
		<li>Overlay each plate with apramycin (1.25 mg) and fosfomycin (5 mg) dissolved in 1 mL&#160;of water and let them dry. Incubate the plates for several days at 28 &#176;C until exconjugants are visible.</li>
	</ol>
	</li>
	<li>Check single-crossover mutants
	<ol>
		<li>Inoculate single exconjugants in 20 mL&#160;TSB medium (apramycin 50 mg mL-1) and incubate them at 28 &#176;C for three days and 180 rpm.</li>
		<li>Isolate genomic DNA43 and check interruption of the pokPI gene by PCR.</li>
		<li>Inoculate single clones with verified gene interruption and Streptomyces wildtype strain in 100 mL&#160;HA medium and incubate them for 6 days at 28 &#176;C and 180 rpm. Extract the crude extract (see section 1.3). Check compound production by HPLC-MS analysis (see section 1.4). The corresponding peak in the HPLC chromatogram and the mass of the compound should not be detectable any more (see Figure 6).</li>
	</ol>
	</li>
</ol>
<img alt="Figure 6" src="/files/ftp_upload/54952/54952fig6.jpg" /> 
Figure 6: HPLC Analysis of S. diastatochromogenes with Inactivated pokPI Gene. HPLC chromatogram (&#955; = 430 nm) of crude extract of S. diastatochromogenes WT (top) and mutant strain with interrupted pokPI-Gen (below). The mutant strain does not produce polyketomycin anymore. <a href="http://cloudfront.jove.com/files/ftp_upload/54952/54952fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<ol>
	<li>Fleming, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+antibacterial+action+of+cultures+of+a+penicillin,+with+special+reference+to+their+use+in+isolation+of+B.+influenzae.">On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae.</a> Br J Exp Pathol. 10 (3), 226-236 (1929).</li><li>Lemke, A., Kiderlen, A. F., Kayser, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amphotericin+B.">Amphotericin B.</a> Appl. Microbiol. Biotechnol. 68 (2), 151-162 (2005).</li><li>Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daptomycin.">Daptomycin.</a> Nat. Rev. Drug Discov. 2 (12), 943-944 (2003).</li><li>Zakeri, B., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology+of+tetracycline+antibiotics.">Chemical biology of tetracycline antibiotics.</a> Biochem. cell Biol. 86 (2), 124-136 (2008).</li><li>Schatz, A., Bugle, E., Waksman, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptomycin,+a+Substance+Exhibiting+Antibiotic+Activity+Against+Gram-Positive+and+Gram-Negative+Bacteria.">Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria.</a> Exp. Biol. Med. 55 (1), 66-69 (1944).</li><li>Burg, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+producing+organism+and+fermentation.">Avermectins, new family of potent anthelmintic agents: producing organism and fermentation.</a> Antimicrob. Agents Chemother. 15 (3), 361-367 (1979).</li><li>Egerton, J. R., Ostlind, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+efficacy+of+the+B1a+component.">Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component.</a> Antimicrob. Agents Chemother. 15 (3), 372-378 (1979).</li><li>Walsh, C. T., Fischbach, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+version+2.0:+connecting+genes+to+molecules.">Natural products version 2.0: connecting genes to molecules.</a> J. Am. Chem. Soc. 132 (8), 2469-2493 (2010).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces+sp.+MK277-AF1.+II.+Structure+determination.">Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination.</a> J. Antibiot. (Tokyo). 51 (1), 26-32 (1998).</li><li>Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biosynthesis+of+polyketomycin+produced+by+Streptomyces+diastatochromogenes.T&#252;6028.">Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.T&#252;6028.</a> J. Antibiot. (Tokyo). 52 (2), 96-101 (1999).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces.+sp.+MK277-AF1.+I.+Taxonomy,+production,+isolation,+physico-chemical+properties+and+biological+activities.">Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities.</a> J. Antibiot. (Tokyo). 51 (1), 21-25 (1998).</li><li>Daum, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organisation+of+the+biosynthetic+gene+cluster+and+tailoring+enzymes+in+the+biosynthesis+of+the+tetracyclic+quinone+glycoside+antibiotic+polyketomycin.">Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.</a> Chembiochem. 10 (6), 1073-1083 (2009).</li><li>Bode, H. B., Bethe, B., H&#246;fs, R., Zeeck, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Big+effects+from+small+changes:+possible+ways+to+explore+nature's+chemical+diversity.">Big effects from small changes: possible ways to explore nature's chemical diversity.</a> Chembiochem. 3 (7), 619-627 (2002).</li><li>Wolfender, J. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HPLC+in+Natural+Product+Analysis:+The+Detection+Issue.">HPLC in Natural Product Analysis: The Detection Issue.</a> Planta Med. 75 (07), 719-734 (2009).</li><li>Stahl, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Thin-layer chromatography. A laboratory handbook. , (1967).</li><li>Snyder, L. R., Kirkland, J. J., Glajch, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+HPLC+Separation.">Preparative HPLC Separation.</a> Pract. HPLC Method Dev. , 616-642 (2012).</li><li>Granath, K. A., Kvist, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+weight+distribution+analysis+by+gel+chromatography+on+sephadex.">Molecular weight distribution analysis by gel chromatography on sephadex.</a> J. Chromatogr. A. 28, 69-81 (1967).</li><li>Jackman, L. M., Sternhell, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+Nuclear+Magnetic+Resonance+Spectroscopy+in+Organic+Chemistry.">Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry.</a> Int. Ser. Org. Chem. , (1969).</li><li>Xian, F., Hendrickson, C. L., Marshall, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+mass+spectrometry.">High resolution mass spectrometry.</a> Anal. Chem. 84 (2), 708-719 (2012).</li><li>Metzker, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+technologies+-+the+next+generation.">Sequencing technologies - the next generation.</a> Nat. Rev. Genet. 11 (1), 31-46 (2010).</li><li>Tatusova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokaryotic+Genome+Annotation+Pipeline.">Prokaryotic Genome Annotation Pipeline.</a> NCBI Handb. 2nd Ed. , (2013).</li><li>Angiuoli, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+an+online+repository+of+Standard+Operating+Procedures+(SOPs)+for+(meta)genomic+annotation.">Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.</a> OMICS. 12 (2), 137-141 (2008).</li><li>Aziz, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RAST+Server:+rapid+annotations+using+subsystems+technology.">The RAST Server: rapid annotations using subsystems technology.</a> BMC Genomics. 9, 75 (2008).</li><li>Overbeek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SEED+and+the+Rapid+Annotation+of+microbial+genomes+using+Subsystems+Technology+(RAST).">The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST).</a> Nucleic Acids Res. 42, 206-214 (2014).</li><li>Brettin, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RASTtk:+a+modular+and+extensible+implementation+of+the+RAST+algorithm+for+building+custom+annotation+pipelines+and+annotating+batches+of+genomes.">RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes.</a> Sci. Rep. 5, 8365 (2015).</li><li>Seemann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokka:+rapid+prokaryotic+genome+annotation.">Prokka: rapid prokaryotic genome annotation.</a> Bioinformatics. 30 (14), 2068-2069 (2014).</li><li>Meyer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenDB--an+open+source+genome+annotation+system+for+prokaryote+genomes.">GenDB--an open source genome annotation system for prokaryote genomes.</a> Nucleic Acids Res. 31 (8), 2187-2195 (2003).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J. Mol. Biol. 215 (3), 403-410 (1990).</li><li>Madden, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BLAST+Sequence+Analysis+Tool.">The BLAST Sequence Analysis Tool.</a> NCBI Handb. 2nd Ed. , (2003).</li><li>Marchler-Bauer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDD:+NCBI's+conserved+domain+database.">CDD: NCBI's conserved domain database.</a> Nucleic Acids Res. 43, 222-226 (2014).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH:+rapid+identification,+annotation+and+analysis+of+secondary+metabolite+biosynthesis+gene+clusters+in+bacterial+and+fungal+genome+sequences.">antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.</a> Nucleic Acids Res. 39, 339-346 (2011).</li><li>Blin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+2.0--a+versatile+platform+for+genome+mining+of+secondary+metabolite+producers.">antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers.</a> Nucleic Acids Res. 41, 204-212 (2013).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+3.0+-+a+comprehensive+resource+for+the+genome+mining+of+biosynthetic+gene+clusters.">antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters.</a> Nucleic Acids Res. 43, 237-243 (2015).</li><li>Ziemert, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+natural+product+domain+seeker+NaPDoS:+a+phylogeny+based+bioinformatic+tool+to+classify+secondary+metabolite+gene+diversity.">The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity.</a> PLoS One. 7 (3), 34064 (2012).</li><li>Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+prediction+of+adenylation+domains+in+nonribosomal+peptide+synthetases+(NRPS)+using+transductive+support+vector+machines+(TSVMs).">Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs).</a> Nucleic Acids Res. 33 (18), 5799-5808 (2005).</li><li>R&#246;ttig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NRPSSpredictor2--a+web+server+for+predicting+NRPS+adenylation+domain+specificity.">NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity.</a> Nucleic Acids Res. 39, 362-367 (2011).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimum+Information+about+a+Biosynthetic+Gene+cluster.">Minimum Information about a Biosynthetic Gene cluster.</a> Nat. Chem. Biol. 11 (9), 625-631 (2015).</li><li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+enzymatic+amplification+of+DNA+in+vitro:+the+polymerase+chain+reaction.">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb. Symp. Quant. Biol. 51, 263-273 (1986).</li><li>Bierman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmid+cloning+vectors+for+the+conjugal+transfer+of+DNA+from+Escherichia+coli+to+Streptomyces+spp.">Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.</a> Gene. 116 (1), 43-49 (1992).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli.using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli.using the heat shock method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Bimboim, H. C., Doly, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+alkaline+extraction+procedure+for+screening+recombinant+plasmid+DNA.">A rapid alkaline extraction procedure for screening recombinant plasmid DNA.</a> Nucleic Acids Res. 7 (6), 1513-1523 (1979).</li><li>MacNeil, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Streptomyces+avermitilis.+genes+required+for+avermectin+biosynthesis+utilizing+a+novel+integration+vector.">Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector.</a> Gene. 111 (1), 61-68 (1992).</li><li>Pospiech, A., Neumann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+quick-prep+of+genomic+DNA+from+Gram-positive+bacteria.">A versatile quick-prep of genomic DNA from Gram-positive bacteria.</a> Trends Genet. 11 (6), 217-218 (1995).</li><li>Makitrynskyy, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pleiotropic+regulatory+genes+bldA,+adpA+and+absB+are+implicated+in+production+of+phosphoglycolipid+antibiotic+moenomycin.">Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.</a> Open Biol. 3 (10), 130121 (2013).</li><li>Kalan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cryptic+polyene+biosynthetic+gene+cluster+in+Streptomyces+calvus+is+expressed+upon+complementation+with+a+functional+bldA+gene.">A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene.</a> Chem. Biol. 20 (10), 1214-1224 (2013).</li><li>Gessner, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+Biosynthetic+Profiles+by+Expressing+bldA+in+Streptomyces+Strains.">Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains.</a> ChemBioChem. 16 (15), 2244-2252 (2015).</li></ol>

The authors have nothing to disclose.

In this lab a genomic cosmid library of Streptomyces diastatochromogenes was generated and screened many years ago, resulting in the identification of the polyketomycin gene cluster through an extremely time-consuming process. Characterization of single genes were possible using targeted gene deletions and analysis of the resulting mutants12. Recently, a draft genome sequence of S. diastatochromogenes was obtained allowing the fast identification of the polyketomycin biosynthetic gene cluster. We could easily detect the biosynthetic genes, although the draft genome sequence contains still many contigs. The described process can be achieved within months. However, the procedure comprises many steps. Single steps may fail several times, preventing progression to subsequent steps:
The genus Streptomyces is known for its capacity to produce bioactive compounds. While they carry often more than 20 biosynthetic gene clusters, usually only one or two compounds are produced under laboratory conditions. The application of the OSMAC approach (cultivation of one strain under different conditions) to wake up silent gene clusters may sometimes not be enough. Genetic manipulation of regulatory genes, such as the pleiotropic regulator genes adpA44 and bldA45,46, is also an effective method to activate the production of other secondary metabolites.
For the elucidation of the compound&#39;s structure, e.g. by NMR analysis, usually more than 2 mg of purified compound is necessary. Therefore, fermentation of more than 10 L culture is often required. Without a fermenter that is able to maintain oxygen, pH and temperature conditions, it might be challenging in a small lab to handle this amount of culture and subsequent extraction. During purification, the compound may be changed due to oxidation, radiation or temperature. Also, the more purification steps are used, the higher the chance of degradation.
When analyzing the structure of the natural product, and the clusters in the genome, sometimes it is not that easy to identify the appropriate cluster. Firstly, if there is only a draft genome sequence some part of the cluster may be missing. Secondly, not all genes which are required for the biosynthesis are in the cluster. Thirdly, sometimes a cluster is split into two parts separated from each other by many kilobases. Fourthly, it may be difficult to decide which one is the appropriate gene cluster. In case of large PKS type I or NRPS systems, where it is possible to calculate the number of extender units based on the number of modules, or even identify the single extender units by analysis of the selecting domains, it turns up easily. However, in the case of iteratively working enzymes the prediction of the synthesized compounds is often not possible, especially if the strain has more than 40 gene clusters. Fifthly, nature is highly complex and full of yet unknown compounds. Often the biosynthesis is a mixture of different pathways. If the new compound is not identified yet, or not related to another compound, it may be difficult to identify the cluster, to propose a biosynthesis model and to prove it.
Once the cluster is identified, the single crossover technique is a good and quick method to verify the hypothesis. PCR, cloning into a suicide vector, conjugation, selection of positive clones, and production assay are the only steps required. One disadvantage of this technique is that the integration of the vector into the chromosome is not stable due to further recombination events. Therefore, in order to further analyze single genes, precise gene deletions are required. Also it may be tricky to manipulate Streptomyces strains on the genetic level.
The described procedure can be assigned to any other compound produced by a Streptomyces strain or another microorganism. The knowledge about a biosynthetic gene cluster and its synthesized compound gives us further opportunities to modify already existing molecules with the aim of improving them for the fight against multidrug-resistant pathogens.

Natural products from plants and microorganisms have always been an important source for clinical drug development and research. The first antibiotic Penicillin was discovered in 1928 from a fungus by Alexander Fleming1. Nowadays, many more natural products are used in clinical treatment.
One genus known for its capability of producing various kinds of secondary metabolites with different bioactivities is Streptomyces. Streptomyces are Gram-positive bacteria and belong to the class of Actinobacteria and the order Actinomycetales. Almost two-thirds of the clinically used antibiotics are derived from Actinomycetales, mainly from Streptomyces, like amphotericin2, daptomycin3 or tetracycline4. Two Nobel Prizes have been awarded in the field of Streptomyces antibiotic research. The first one went to Selman Waksman for the discovery of Streptomycin, the first antibiotic effective against tuberculosis.5 In 2015, as part of the Nobel Prize in Physiology and Medicine, the discovery of avermectin from S.&#160;avermitilis was awarded as well. Avermectin is used for the treatment of parasitic diseases6,7.
The traditional approach for the discovery of natural products in microorganisms such as Streptomyces generally involves cultivation of the strain under different growth conditions, as well as extraction and analysis of secondary metabolites. Bioactivity assays (e.g. assays for antibacterial and anticancer activity) are performed to detect the activity of the compound. Finally, the compound of interest is isolated and the chemical structure is elucidated.
The structures of natural products are often composed of single moieties which are forming complex molecules. There are a few, but limited, major biosynthetic pathways leading to building blocks, which are used for the biosynthesis of natural products. The major biosynthetic pathways are the polyketide pathways, pathways leading to terpenoids and alkaloids, pathways using amino acids, and pathways leading to sugar moieties. Each pathway is characterized by a set of specific enzymes8. Based on the structure of the compound, these biosynthetic enzymes can be predicted.
Nowadays, the detailed structural analysis of a compound in combination with next generation sequencing and bioinformatic analysis can help to identify the responsible biosynthetic gene cluster. The cluster information opens up new ways for further natural product research. This includes heterologous expression to increase the yield of the natural product, targeted compound modification by gene deletion or alteration and combinatorial biosynthesis with genes from other pathways.
Polyketomycin was isolated independently from the culture broth of two strains, Streptomyces sp. MK277-AF19 and Streptomyces diastatochromogenes T&#252;602810. The structure was elucidated by NMR and X-ray analysis. Polyketomycin is composed of a tetracyclic decaketid and a dimethyl salicylic acid, linked by the two deoxysugar moieties &#946;-D-amicetose and &#945;-L-axenose. It displays cytotoxic and antibiotic activity, even against Gram-positive multidrug-resistant strains such as MRSA11.
A genomic cosmid library of S. diastatochromogenes T&#252;6028 was generated and screened many years ago. Using specific gene probes the polyketomycin gene cluster with a size of 52.2 kb, containing 41 genes, was identified after several months of intense work12. Recently, a draft genome sequence of S. diastatochromogenes was obtained leading to the fast identification of the polyketomycin biosynthetic gene cluster. In this overview, a method helping to identify a natural product and elucidate its biosynthetic gene cluster will be described, using polyketomycin as an example.
Here we explain the single steps which lead from a natural product to its biosynthetic gene cluster shown for polyketomycin produced by Streptomyces diastatochromogenes T&#252;6028. The protocol comprises the identification and purification of a natural product with antibiotic properties. Further structural analysis and comparison with results from genome mining lead to the identification of the biosynthetic gene cluster. This procedure can be applied to any other compound derived from a Streptomyces strain or any other microorganism.

<table border="0" cellpadding="0" cellspacing="0" width="1334">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">agar</td>
			<td style="width:397px;">Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">5210.4</td>
			<td style="width:360px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">agarose</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6352.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D-mannitol&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4175.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">glucose&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6780.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">LB&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X964.3</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">malt extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X976.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MgCl2</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2189.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Peptone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">soy flour&#160;</td>
			<td style="width:397px;">W.Schoenemberger GmbH, Magstadt, Germany</td>
			<td style="width:231px;"></td>
			<td>Hensec-Vollsoja</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">tryptic soy broth</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X938.3</td>
			<td>Caso-Bouillon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">yeast extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2363.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Solvents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetic acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">3738.5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">9372.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetonitrile</td>
			<td style="width:397px;">Avantor Performance Materials B.V., Deventer, The Netherlands</td>
			<td>JT-9012-03</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Dichlorofrom&#160;</td>
			<td>Fisher Scientific GmbH, Schwerte, Germany</td>
			<td>1530754</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO (Dimethyl sulfoxide)</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4720.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO-d6 (Dimethyl sulfoxide-d6) 99.9atom%D</td>
			<td style="width:397px;">ARMAR Chemicals, D&#246;ttingen, Switzerland</td>
			<td style="width:231px;">15200.204</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Ethyl acetate</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td>6784.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Hydrochloric acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6331.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Methanol</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">7342.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">restriction enzymes</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">polymerase&#160;</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Polymerase I Large (Klenow) Fragment</td>
			<td>Promega GmbH, Mannheim, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Antibiotics</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">apramycin</td>
			<td>AppliChem GmbH, Darmstadt, Germany&#160;</td>
			<td style="width:231px;">A7682.0005</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">fosfomycin</td>
			<td>Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany</td>
			<td style="width:231px;">P5396-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">kanamycin</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">T832.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Plasmid/Vectors</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pKC1132</td>
			<td style="width:397px;">Bierman et al. 1992</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Primer&#160;</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_for</td>
			<td>TGATGGTGCCGCTGGCCATGG</td>
			<td rowspan="2" style="width:231px;">Primer to amplify fragment containing pokPI gene</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_rev</td>
			<td>AGCGTTCACTGTTCCGCCCGAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacterial strains</td>
			<td style="width:397px;"></td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacillus subtilis COHN ATCC6051</td>
			<td></td>
			<td>Gram-positive test strain&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Escherichia coli ET12567 pUZ8002&#160;</td>
			<td>MacNeil et al., 1992</td>
			<td>strain for conjugation&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Escherichia coli XL1 Blue</td>
			<td style="width:397px;">Agilient Technologies, Santa Clara, USA</td>
			<td colspan="2">Gram-negative test strain + cloning host&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Streptomyces diastatochromogenes T&#252;6028</td>
			<td style="width:397px;">Paululat et al., 1999</td>
			<td>Polyketomycin producer</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Online services</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">antismash (Antibiotics and Secondary Metabolite Analysis Shell)</td>
			<td style="width:397px;">http://antismash.secondarymetabolites.org/</td>
			<td colspan="2">Detection of secondary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">BLAST (Basic Local Alignment Search Tool)</td>
			<td style="width:397px;">http://blast.ncbi.nlm.nih.gov/Blast.cgi</td>
			<td colspan="2">finds regions of similarity between biological sequences</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">GenDB</td>
			<td style="width:397px;">https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">MiBIG (Minimum Information about a Biosynthetic Gene cluster)</td>
			<td style="width:397px;">http://mibig.secondarymetabolites.org/</td>
			<td colspan="2">Database of biosyntetic gene clusters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaPDoS</td>
			<td style="width:397px;">http://napdos.ucsd.edu/</td>
			<td colspan="2">Detection of seconary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">NCBI Prokaryotic Genome Annotation Pipeline</td>
			<td style="width:397px;">http://www.ncbi.nlm.nih.gov/genome/annotation_prok/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NRPSpredictor</td>
			<td style="width:397px;">http://nrps.informatik.uni-tuebingen.de/</td>
			<td>Detection of NRPS domains</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Prokka (rapid prokaryotic genome annotation)</td>
			<td style="width:397px;">http://www.vicbioinformatics.com/software.prokka.shtml</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">RAST (rapid annotation using subsystems technology)</td>
			<td style="width:397px;">http://rast.nmpdr.org/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">other programs&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Chem Station Rev. A.09.03</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td style="width:231px;">Handling program for HPLC&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Clone Manager Suite 7</td>
			<td style="width:397px;">Scientific and Educational Software, Cary, USA</td>
			<td style="width:231px;">Designing Cloning Experiment&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Newbler v2.8</td>
			<td style="width:397px;">Roche Diagnostics</td>
			<td>Alignment of sequencing reads</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Machines&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Centrifuge Avanti J-6000, Rotor JA-10</td>
			<td>Beckman Coulter GmbH, Krefeld, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC/MS</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Autosampler: G1313A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Column:Xbridge C18 (100 mm &#215; 4.6 mm; Particle size: 3.5 &#956;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Degasser: G1322A&#160;</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quarternary pump: G1311A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Diode array detector (DAD )G1315B (&#955; = 254 nm and 400 nm)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quadrupole mass detector (MSD) G1946D(2-3000 m/z)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">rotary evaporator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_heating bath Hei-VAP Value/G3</td>
			<td colspan="2">Heidolph Instruments GmbH &#38; Co.KG, Schwabach, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_vacuum pump system SC 920 G</td>
			<td>KNF&#160;Global Strategies&#160;AG, Sursee, Switzerland</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">other material&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Sephadex LH20</td>
			<td style="width:397px;">GE Healthcare,&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chromafil PVDF-45/15MS (pore size 0.45 &#181;m; filter &#216;15 mm)</td>
			<td>MACHEREY-NAGEL GmbH &#38; Co. KG, D&#252;ren, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SPE column Oasis HLB 20 35 cc (6g)</td>
			<td style="width:397px;">Waters GmbH, Eschborn, Germany&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">E. coli&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bacillus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptomyces sp.</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td>for agar plates add 2 % agar</td>
		</tr>
	</tbody>
</table>

from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different conditions often leads to the production of new compounds. Therefore, production cultures of the strains are extracted with ethyl acetate and the crude extracts are analyzed by HPLC. Furthermore, the extracts are tested for their bioactivity by different assays. For structure elucidation the compound of interest is purified by a combination of different chromatography methods.
Genome sequencing coupled with genome mining allows the identification of a natural product biosynthetic gene cluster using different computer programs. To confirm that the correct gene cluster has been identified, gene inactivation experiments have to be performed. The resulting mutants are analyzed for the production of the particular natural product. Once the correct gene cluster has been inactivated, the strain should fail to produce the compound.
The workflow is shown for the antibacterial compound polyketomycin produced by Streptomyces diastatochromogenes T&#252;6028. Around ten years ago, when genome sequencing was still very expensive, the cloning and identification of a gene cluster was a very time-consuming process. Fast genome sequencing combined with genome mining accelerates the trial of cluster identification and opens up new ways to explore biosynthesis and to generate novel natural products by genetic methods. The protocol described in this paper can be assigned to any other compound derived from a Streptomyces strain or another microorganism.

In this overview we describe the single steps from identification of an antibiotic leading to its biosynthetic gene cluster. Many years ago we cloned a cosmid library, packaged them into phages, transduced E. coli host cells, and had to screen thousands of colonies to identify the clones having overlapping regions of polyketomycin cluster. Sequencing of the cosmids was also a difficult and expensive process12.
In order to conduct further studies on the strain we sequenced the whole genome of Streptomyces diastatochromogenes T&#252;6028. With the draft genome sequence we easily identified the biosynthetic gene cluster of polyketomycin and other clusters encoding promising compounds. Figure 7 compares the &#34;old&#34; method of identifying the biosynthetic cluster by cloning of a cosmid library and elaborative screening, and the &#34;new&#34; method by whole genome sequencing with subsequent genome mining on a rough time scale. The new sequencing technologies and new genome mining programs speed up the whole process.
<img alt="Figure 7" src="/files/ftp_upload/54952/54952fig7.jpg" /> 
Figure 7: Comparison of the &#34;Old&#34; and &#34;New&#34; Method of Assigning a Biosynthetic Gene Cluster. The &#34;old&#34; method comprises cloning of a cosmid library with selection of positive clones and sequencing of the respective cosmid(s) (above); The &#34;new&#34; method includes whole genome sequencing and -mining to identify all secondary metabolite gene clusters located on the genome of the strain (below). Duration of single steps are shown on a rough time scale. <a href="http://cloudflare.jove.com/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Here we present a detailed protocol of (A) the identification of a natural product with antibiotic activity, (B) the purification of the compound, (C) the first model of its biosynthesis, (D) genome sequencing/-mining and the (E) verification of the biosynthetic gene cluster.

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

from-natural-product-to-its-biosynthetic-gene-cluster-demonstration

Research

JoVE Journal

Genetics

17.1K Views.  Albert-Ludwigs-Universität Freiburg, Germany. Here we present a detailed protocol of (A) the identification of a natural product with antibiotic activity, (B) the purification of the compound, (C) the first model of its biosynthesis, (D) genome sequencing/-mining and the (E) verification of the biosynthetic gene cluster.

Video: From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028

Using a GFP-tagged TMEM184A Construct for Confirmation of Heparin Receptor Identity

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies against specific peptides within the predicted sequence allow some localization experiments. However, other possible interactions with the antibodies often cannot be excluded. This situation provided an opportunity to develop a set of assays dependent on the protein sequence. Specifically, a construct containing the gene sequence coupled to the GFP coding sequence at the C-terminal end of the protein was obtained and employed for these purposes. Experiments to characterize localization, ligand affinity, and gain of function were originally designed and carried out to confirm the identification of TMEM184A as a heparin receptor1. In addition, the construct can be employed for studies addressing membrane topology questions and detailed protein-ligand interactions. The present report presents a range of experimental protocols based on the GFP-TMEM184A construct expressed in vascular cells that could easily be adapted for other novel proteins.

A construct encoding TMEM184A with a GFP tag at the carboxy-terminus designed for eukaryotic expression, was employed in assays designed to confirm the identification of TMEM184A as a heparin receptor in vascular cells.

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies ...

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an excellent model for rapid assessment of whole transcriptome from whole animal or individual cell populations due to the ease of isolation of RNA from large numbers of animals. Here a protocol for global gene expression analysis in zebrafish embryos using RNA sequencing (RNASeq) is presented. We describe preparation of RNA from whole embryos or from cell populations obtained using cell sorting in transgenic animals. We also describe an approach for analysis of RNASeq data to identify enriched pathways and Gene Ontology (GO) terms in global gene expression data sets. Finally, we provide a protocol for validation of gene expression changes using quantitative reverse transcriptase PCR (qRT-PCR). These protocols can be used for comparative analysis of control and experimental sets of zebrafish to identify novel gene expression changes, and provide molecular insight into phenotypes of interest.

This protocol presents an approach for whole transcriptome analysis from zebrafish embryos, larvae, or sorted cells. We include isolation of RNA, pathway analysis of RNASeq data, and qRT-PCR-based validation of gene expression changes.

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Informatic Analysis of Sequence Data from Batch Yeast 2-Hybrid Screens

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing high-throughput short-read DNA sequencing. The resulting sequence datasets can not only track what genes in a population that are enriched during selection for positive yeast 2-hybrid interactions, but also give detailed information about the relevant subdomains of proteins sufficient for interaction. Here, we describe a full suite of stand-alone software programs that allow non-experts to perform all the bioinformatics and statistical steps to process and analyze DNA sequence fastq files from a batch yeast 2-hybrid assay. The processing steps covered by these software include: 1) mapping and counting sequence reads corresponding to each candidate protein encoded within a yeast 2-hybrid prey library; 2) a statistical analysis program that evaluates the enrichment profiles; and 3) tools to examine the translational frame and position within the coding region of each enriched plasmid that encodes the interacting proteins of interest.

Deep sequencing of yeast populations selected for positive yeast 2-hybrid interactions potentially yields a wealth of information about interacting partner proteins. Here, we describe the operation of specific bioinformatics tools and customized updated software to analyze sequence data from such screens.

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and effect sizes of regulatory elements to a target gene. Some progress has been made with the bioinformatic prediction of the existence and function of proximal epigenetic modifications associated with activated gene expression using conserved transcription factor binding sites. Chromatin conformation capture studies have revolutionized our ability to discover physical chromatin contacts between sequences and even within an entire genome. Circular chromatin conformation capture coupled with next-generation sequencing (4C-seq), in particular, is designed to discover all possible physical chromatin interactions for a given sequence of interest (viewpoint), such as a target gene or a regulatory enhancer. Current 4C-seq strategies directly sequence from within the viewpoint but require numerous and diverse viewpoints to be simultaneously sequenced to avoid the technical challenges of uniform base calling (imaging) with next generation sequencing platforms. This volume of experiments may not be practical for many laboratories. Here, we report a modified approach to the 4C-seq protocol that incorporates both an additional restriction enzyme digest and qPCR-based amplification steps that are designed to facilitate a greater capture of diverse sequence reads and mitigate the potential for PCR bias, respectively. Our modified 4C method is amenable to the standard molecular biology lab for assessing chromatin architecture.

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

The identification of physical interactions between genes and regulatory elements is challenging but has been facilitated by chromosome conformation capture methods. This modification to the 4C-seq protocol mitigates PCR bias by minimizing over-amplification of PCR templates and maximizes the mappability of reads by incorporating an addition restriction enzyme digest step.

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

A Fluorescence-based Method to Study Bacterial Gene Regulation in Infected Tissues

Bacterial virulence genes are often regulated at the transcriptional level by multiple factors that respond to different environmental signals. Some factors act directly on virulence genes; others control pathogenesis by adjusting the expression of downstream regulators or the accumulation of signals that affect regulator activity. While regulation has been studied extensively during in vitro growth, relatively little is known about how gene expression is adjusted during infection. Such information is important when a particular gene product is a candidate for therapeutic intervention. Transcriptional approaches like quantitative, real-time RT-PCR and RNA-Seq are powerful ways to examine gene expression on a global level but suffer from many technical challenges including low abundance of bacterial RNA compared to host RNA, and sample degradation by RNases. Evaluating regulation using fluorescent reporters is relatively easy and can be multiplexed with fluorescent proteins with unique spectral properties. The method allows for single-cell, spatiotemporal analysis of gene expression in tissues that exhibit complex three-dimensional architecture and physiochemical gradients that affect bacterial regulatory networks. Such information is lost when data are averaged over the bulk population. Herein, we describe a method for quantifying gene expression in bacterial pathogens in situ. The method is based on simple tissue processing and direct observation of fluorescence from reporter proteins. We demonstrate the utility of this system by examining the expression of Staphylococcus aureus thermonuclease (nuc), whose gene product is required for immune evasion and full virulence ex vivo and in vivo. We show that nuc-gfp is strongly expressed in renal abscesses and reveal heterogeneous gene expression due in part to apparent spatial regulation of nuc promoter activity in abscesses fully engaged with the immune response. The method can be applied to any bacterium with a manipulatable genetic system and any infection model, providing valuable information for preclinical studies and drug development.

Described here is a method for analyzing bacterial gene expression in animal tissues at a cellular level. This method provides a resource for studying the phenotypic diversity occurring within a bacterial population in response to the tissue environment during an infection.

Bacterial virulence genes are often regulated at the transcriptional level by multiple factors that respond to different environmental signals. Some ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for reversible and tunable expression control of an endogenous gene of interest in living model systems. The REMOTE-control system employs enhanced lac repression and tet activation systems to achieve down- or upregulation of a target gene within a single biological system. Tight repression can be achieved from repressor binding sites flexibly located far downstream of a transcription start site by inhibiting transcription elongation. Robust upregulation can be attained by enhancing the transcription of an endogenous gene by targeting tet transcriptional activators to the cognate promoter. This reversible and tunable expression control can be applied and withdrawn repeatedly in organisms. The potency and versatility of the system, as demonstrated for endogenous Dnmt1 here, will allow more precise in vivo functional analyses by enabling investigation of gene function at various expression levels and by testing the reversibility of a phenotype.

This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Lentiviral Mediated Gene Silencing in Human Pseudoislet Prepared in Low Attachment Plates

Various genetic tools are available to modulate genes in pancreatic islets of rodents to dissect function of islet genes for diabetes research. However, the data obtained from rodent islets are often not fully reproduced in or applicable to human islets due to well-known differences in islet structure and function between the species. Currently, techniques that are available to manipulate gene expression of human islets are very limited. Introduction of transgene into intact islets by adenovirus, plasmid, and oligonucleotides often suffers from low efficiency and high toxicity. Low efficiency is especially problematic in gene downregulation studies in intact islets, which require high efficiency. It has been known that enzymatically-dispersed islet cells reaggregate in culture forming spheroids termed pseudoislets. Size-controlled reaggregation of human islet cells creates pseudoislets that maintain dynamic first phase insulin secretion after prolonged culture and provide a window to efficiently introduce lentiviral short hairpin RNA (shRNA) with low toxicity. Here, a detailed protocol for the creation of human pseudoislets after lentiviral transduction using two commercially available multiwell plates is described. The protocol can be easily performed and allows for efficient downregulation of genes and assessment of dynamism of insulin secretion using human islet cells. Thus, human pseudoislets with lentiviral mediated gene modulation provide a powerful and versatile model to assess gene function within human islet cells.

A protocol to create gene modified human pseudoislets from dispersed human islet cells that are transduced by lentivirus carrying short hairpin RNA (shRNA) is presented. This protocol utilizes readily available enzyme and culture vessels, can be performed easily, and produces genetically modified human pseudoislets suitable for functional and morphological studies.

Various genetic tools are available to modulate genes in pancreatic islets of rodents to dissect function of islet genes for diabetes research. However, ...