We thank Christopher Hindley for the critical reading of the manuscript. A.M. is supported by Wntsapp (Marie Curie ITN), A.A-R. is supported by the Medical Research Council (MRC), and B-K.K. and R.M. are supported by a Sir Henry Dale Fellowship from the Wellcome Trust and the Royal Society [101241/Z/13/Z] and receive support through a core grant from the Wellcome Trust and MRC to the Wellcome Trust - MRC Cambridge Stem Cell Institute.

1. gRNA Design for the CRISPR-concatemer Vector
Note: The aim of this section is to explain how to opt for the best targeting strategy and how to design gRNAs containing specific overhangs for the CRISPR-concatemer vector.
<ol>
	<li>Design gRNAs against the genes of interest using a CRISPR gRNA design tool of choice. See the Table of Materials for an example. 
	NOTE: When targeting a pair of paralogous genes, although it is possible to design one gRNA per gene, it is advisable to design two gRNAs per gene to increase the chances of achieving a double knockout (Figure 1).</li>
	<li>Make sure the gRNAs do not contain the BbsI recognition site by using a restriction mapping tool (see the Table of Materials for an example).</li>
	<li>Add specific CRISPR-concatemer vector overhangs to each oligo, as shown in Table 1.</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Cassette 1</td>
			<td>Cassette 2</td>
			<td>Cassette 3</td>
			<td>Cassette 4</td>
		</tr>
		<tr>
			<td>Sequence (5&#8242;-3&#8242;)</td>
			<td>CACCGG[gRNA1]GT</td>
			<td>ACCGG[gRNA2]G</td>
			<td>CCGG[gRNA3]</td>
			<td>ACACCGG[gRNA4]GTT</td>
		</tr>
		<tr>
			<td>Sequence (5&#8242;-3&#8242;)</td>
			<td>TAAAAC[RC-gRNA1]CC</td>
			<td>AAAAC[RC-gRNA2]C</td>
			<td>AAAC[RC-gRNA3]</td>
			<td>CTAAAAC[RC-gRNA4]CCG</td>
		</tr>
	</tbody>
</table>
Table 1: Overhangs for Each Cassette of the CRISPR-concatemer Vector.
2. Cloning of gRNAs into the CRISPR-concatemer Vector
<ol>
	<li>Phosphorylation and annealing of oligos 
	NOTE: This step illustrates how to anneal top and bottom strands for each gRNA oligo and how to phosphorylate their ends in a single reaction.
	<ol>
		<li>Prepare the reaction mixture for phosphorylating oligos and annealing top and bottom strands on ice, per the instructions below. 
		NOTE: All oligos can be pooled into one reaction; for example, in the case of a 4 gRNA-concatemer vector, pool together 8 oligos.</li>
		<li>For 3 concatemers, use 3.0 &#181;L gRNA top strand (1.0 &#181;L from each gRNA; 10 &#181;M, 1 &#181;L/gRNA), 3.0 &#181;L gRNA bottom strand (1.0 &#181;L from each gRNA; 10 &#181;M, 1 &#181;L/gRNA), 2.0 &#181;L T4 DNA ligase buffer (10x), 1.0 &#181;L T4 PNK, and add H2O up to total volume of 20.0 &#181;L.</li>
		<li>Mix well by pipetting and run this in a thermocycler using the following settings: 37 &#176;C for 30 min, 95 &#176;C for 5 min, ramp down to 25 &#176;C at 0.3 &#176;C/min, hold at 4 &#176;C.</li>
	</ol>
	</li>
	<li>BbsI shuffling reaction 
	NOTE: In this section, the pre-annealed gRNA oligos are incorporated into the appropriate position of the concatemer vector in one step by alternating cycles of digestion and ligation.
	<ol>
		<li>Dilute the reaction mixture 1:100 in DNase/RNase-free water to generate 3 and 4 gRNA-concatemer vectors. 
		NOTE: When cloning 2 gRNA-concatemers this step is not needed.</li>
		<li>Assemble the BbsI shuffling reaction on ice, per the instructions below. Include a negative control that only contains the vector.</li>
		<li>Use 100 ng CRISPR-concatemer vector, 10.0 &#181;L oligo mixture, 1.0 &#181;L BSA-containing restriction enzyme buffer (10x), 1.0 &#181;L DTT (10 mM), 1.0 &#181;L ATP (10 mM), 1.0 &#181;L BbsI, 1.0 &#181;L T7 ligase, and H2O up to total volume of 20.0 &#181;L.</li>
		<li>Mix well by pipetting and run this in a thermocycler using the following settings: Run 50 cycles for cloning 3 and 4 gRNA-concatemers and 25 cycles for 2 gRNA-concatemers, both at 37 &#176;C for 5 min, 21 &#176;C for 5 min, hold at 37 &#176;C for 15 min , then 4 &#176;C forever.</li>
	</ol>
	</li>
	<li>Exonuclease treatment 
	NOTE: This step is highly recommended as it increases the efficiency of the cloning by removing any traces of linearized DNA.
	<ol>
		<li>Treat the BbsI shuffling reaction with a DNA exonuclease (see Table of Materials) as follows.</li>
		<li>Take 11.0 &#181;L ligation mix from the previous step (2.2.3), add 1.5 &#181;L exonuclease buffer (10x), 1.5 &#181;L ATP (10 mM), 1.0 &#181;L DNA exonuclease, and bring up total volume to 15.0 &#181;L with water. Incubate at 37 &#176;C for 30 min followed by 70 &#176;C for 30 min. 
		NOTE: This step removes any residual linearized DNA in the mixture and so increases the cloning efficiency.</li>
		<li>Use 2 &#181;L of the reaction mixture for transformation into chemically competent E. coli bacteria by heat shock12. 
		NOTE: Alternatively, the reaction can be stored for up to one week at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Restriction digestion 
	NOTE: The aim of this step is to assess by restriction digestion the success of the cloning procedure.
	<ol>
		<li>To confirm the presence of gRNA inserts in the CRISPR-concatemer vector, pick 4 - 8 bacterial colonies with an inoculating loop, grow each clone in 4 mL of LB medium overnight at 37 &#176;C in an orbital shaker. Extract DNA using a plasmid miniprep kit according to the manufacturer&#39;s instructions (see the Table of Materials).</li>
		<li>Digest ~200 ng of DNA with 10 U EcoRI + 5 U BglII in a 10 &#956;L reaction by incubating it at 37 &#176;C for 3 h in a bacteria incubator. Include a separate reaction mixture with the corresponding original vector as a positive control for size comparison. 
		NOTE: This will confirm whether all concatemers are present, since these two restriction enzymes will excise whole concatemers. These are the expected sizes for each concatemer: 2 gRNA-concatemer (800 bp), 3 gRNA-concatemer (1.2 kbp), and 4 gRNA-concatemer (1.6 kbp).</li>
		<li>Run digestion reactions on a 1% agarose gel at 90 V for approximately 20 min.</li>
		<li>Visualize the gel using a UV transilluminator. Identify the clones with correct insert size by ensuring their band pattern matches the one of the original vector and that each fragment has the expected size by using a DNA ladder.</li>
		<li>Digest the selected clones with 5 U BbsI at 37 &#176;C for 3 h in a bacteria incubator. Include a separate reaction mix with the corresponding original vector as a control. 
		NOTE: This additional digestion step is to confirm that gRNAs have been cloned into the right position and consequently all BbsI recognition sites have been lost.</li>
		<li>Run digestion reactions on a 1% agarose gel at 90 V for approximately 20 min. Consider as correct only the vectors that are not cut by BbsI as they only contain gRNAs.</li>
	</ol>
	</li>
	<li>Vector sequencing 
	NOTE: The aim of this step is to confirm the presence of gRNA sequences in those vectors identified as correct by restriction digestion analysis.
	<ol>
		<li>Confirm positive concatemer vectors by Sanger sequencing13 using the following primers: 
		Forward: TCAAGCCCTTTGTACACCCTAAG (for checking the first gRNA cassette) 
		Linker1_Forward: GACTACAAGGACGACGATGACAA (for checking the second gRNA cassette) 
		Linker2_Reverse: GGCGTAGTCGGGCACGTCGTAGGGGT (for checking the second gRNA cassette) 
		Linker2_Forward: ACCCCTACGACGTGCCCGACTACGCC (for checking the third gRNA cassette) 
		Linker3_Reverse: TCCTCCTCTGAGATCAGCTTCTGCAT (for checking the third gRNA cassette) 
		Reverse: AGGTGGCGCGAAGGGGCCACCAAAG (for checking the last gRNA cassette)</li>
		<li>Check the presence of all gRNA by searching their sequences in the sequencing reads.</li>
	</ol>
	</li>
</ol>
3. Transfection of Intestinal Organoids by Electroporation
NOTE: Please note that this procedure is based on the protocol published by Fujii et al. in 2015, with adaptation for mouse small intestinal organoid cultures14.
<ol>
	<li>Pre-electroporation 
	NOTE: This section describes how to prepare the mouse intestinal organoids prior to electroporation by removing all antibiotics and conditioned media from their culture medium. This will prevent possible toxic effects during electroporation.
	<ol>
		<li>On day 0 of the transfection procedure, split organoids in a 1:2 ratio. 
		NOTE: Intestinal organoid cultures can be obtained by performing crypt isolation according to previously established protocols15. Please refer to Table 2 for all media compositions.
		<ol>
			<li>When splitting organoids for electroporation, seed a minimum of 6 wells of a 48-well plate per transfection.</li>
			<li>Seed the organoids in 20 &#956;L-basement matrix drops and grow them in WENR + Nic medium (Wnt + EGF + Noggin + R-spondin + Nicotinamide) at 37 &#176;C, 5% CO2 in a humidified incubator (as previously described15).</li>
		</ol>
		</li>
		<li>On day 2, change medium by replacing WENR+Nic with 250 &#181;L of EN (EGF + Noggin) + CHIR99021 (Glycogen Synthase Kinase-3 inhibitor) + Y-27632 (ROCK inhibitor), without antibiotics (see Table 2). 
		NOTE: In all the steps, the quantity of medium added to each well of a 48-well plate is 250 &#181;L.</li>
		<li>On day 3, change the organoid medium to EN + CHIR99021 + Y-27632 + 1.25% v/v Dimethyl sulfoxide (DMSO), without antibiotics.</li>
	</ol>
	</li>
	<li>Preparation of the cells 
	NOTE: Here we describe how to fragment organoids into small cell clusters by mechanical and chemical dissociation. These steps are critical to the success of the procedure.
	<ol>
		<li>On day 4, disrupt the basement matrix domes using a 1 mL pipette tip and transfer organoids to a 1.5 mL tube. Pool contents of four wells of a 48-well plate into a tube.</li>
		<li>Mechanically break organoids into small fragments by pipetting up and down with a P200 pipette approximately 200 times. Centrifuge at room temperature, 5 min at 600 x g.</li>
		<li>Remove the medium and resuspend the pellet in 1 mL of a cell culture grade recombinant protease (see table of materials). Incubate at 37 &#176;C for a maximum of 5 min and then check a 50-&#181;L drop of sample under an inverted light microscope with a 4x objective. 
		NOTE: Clusters of 10 - 15 cells are desirable, as this increases cell survival after electroporation.</li>
		<li>Transfer the cell suspension to a low-binding 15 mL tube and halt the dissociation by adding 9 mL of basal medium without antibiotics (see Table 2). Centrifuge at room temperature, 5 min at 600 x g, then discard the supernatant and resuspend the pellet in 1 mL of reduced serum medium (see Table of Materials).</li>
		<li>Count the number of cells with a B&#252;rker&#39;s chamber and use a minimum of 1 x 105 cells per electroporation reaction. Add 9 mL reduced serum medium to the 15 mL tube and centrifuge at room temperature, 3 min at 400 x g.</li>
	</ol>
	</li>
	<li>Electroporation 
	NOTE: The following sections provide instructions on how to perform electroporation and to make organoids recover afterwards.
	<ol>
		<li>Remove all of the supernatant and resuspend the pellet in an electroporation solution (see Table of Materials). Add a total amount of 10 &#181;g DNA to the cell suspension and add electroporation solution to a final volume of 100 &#181;L and keep the cell-DNA mixture on ice. Use CRISPR-concatamer vectors in combination with a Cas9 expression plasmid (e.g. Addgene #41815) in a 1:1 ratio. 
		NOTE: The total volume of the DNA added should be less than or equal to 10% of the total reaction volume.</li>
		<li>Include a separate transfection mix containing a GFP plasmid to evaluate transfection efficiency (e.g. pCMV-GFP, Addgene #11153, or any generic GFP-expressing plasmid).</li>
		<li>Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 k&#937;. Perform electroporation according to the settings shown in Table 3. 
		NOTE: If the impedance value falls outside of the allowed range, adjust the solution volume in the cuvette.</li>
		<li>Add 400 &#181;L of electroporation buffer + Y-27632 to the cuvette and then transfer all to a 1.5 mL tube. Incubate at room temperature for 30 min to allow cells to recover and subsequently spin them at room temperature for 3 min at 400 x g.</li>
		<li>Remove the supernatant and resuspend the pellet in 20 &#956;L/well of basement matrix. Seed approximately 1 x 104 to 1 x 105 cells per well in a 48-well plate and add EN + CHIR99021 + Y-27632 + 1.25% v/v DMSO medium. Incubate at 37 &#176;C.</li>
		<li>On day 5, change the medium to EN + CHIR99021 + Y-27632, and check transfection efficiency by observing GFP expression (Figure 2). Keep organoids at 37 &#176;C and refresh EN + CHIR99021 + Y-27632 medium after 2 days.</li>
		<li>On day 9, change the medium to WENR + Nic + Y-27632 and incubate at 37 &#176;C. 
		NOTE: Y-27632 can be removed after 7-10 days (on day 16-19).</li>
	</ol>
	</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Poring pulse</td>
			<td>Transfer pulse</td>
		</tr>
		<tr>
			<td>Voltage</td>
			<td>175V</td>
			<td>20V</td>
		</tr>
		<tr>
			<td>Pulse length</td>
			<td>5 msec</td>
			<td>50msec</td>
		</tr>
		<tr>
			<td>Pulse interval</td>
			<td>50msec</td>
			<td>50msec</td>
		</tr>
		<tr>
			<td>Number of pulses</td>
			<td>2</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Decay rate</td>
			<td>10%</td>
			<td>40%</td>
		</tr>
		<tr>
			<td>Polarity</td>
			<td>+</td>
			<td>+/-</td>
		</tr>
	</tbody>
</table>
Table 3: Electroporation Settings.
4. Growth Factor Withdrawal
Note: Here it is exemplified how to conduct a growth factor withdrawal experiment when knocking out negative regulators of the Wnt pathway in intestinal organoids.
<ol>
	<li>10-14 days after electroporation, split the organoids in a 1:3 ratio in a 48-well plate following the above-mentioned steps (3.2.1 - 3.2.2).</li>
	<li>Resuspend the organoid pellet in 20 &#181;L of basement membrane matrix and let it solidify at 37 &#176;C for 10 min. Then, overlay 250 &#181;L of growth factor-deprived medium (e.g. EN) to test whether knockout of the target genes has been achieved5.</li>
	<li>Split the organoids under growth factor-deprived conditions for a minimum of 2 - 3 passages to see a difference in survival between wild type wildtype (WT) control organoids and mutant organoids5,15. 
	NOTE: Wildtype organoids should not be able to survive in growth factor-deprived medium over two passages, while mutant lines should be able to grow.</li>
</ol>

<ol>
	<li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Human+Genome+Engineering+via+Cas9.">RNA-Guided Human Genome Engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Koike-Yusa, H., Li, Y., Tan, E. -. P., Velasco-Herrera, M. D. C., Yusa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+recessive+genetic+screening+in+mammalian+cells+with+a+lentiviral+CRISPR-guide+RNA+library.">Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library.</a> Nat Biotech. 32 (3), 267-273 (2014).</li><li>Bassett, A. R., Kong, L., Liu, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Genome-Wide+CRISPR+Library+for+High-Throughput+Genetic+Screening+in+Drosophila+Cells.">A Genome-Wide CRISPR Library for High-Throughput Genetic Screening in Drosophila Cells.</a> J Genet Genomics. 42 (6), 301-309 (2015).</li><li>Diss, G., Ascencio, D., DeLuna, A., Landry, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+paralogous+compensation+and+the+robustness+of+cellular+networks.">Molecular mechanisms of paralogous compensation and the robustness of cellular networks.</a> J Exp Zool B Mol Dev Evol. 322 (7), 488-499 (2014).</li><li>Andersson-Rolf, A., Merenda, A., Mustata, R. C., Li, T., Dietmann, S., Koo, B. -. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+paralogue+knockout+using+a+CRISPR-concatemer+in+mouse+small+intestinal+organoids.">Simultaneous paralogue knockout using a CRISPR-concatemer in mouse small intestinal organoids.</a> Dev Biol. 420 (2), 1-7 (2016).</li><li>Ran, F. A., Hsu, P. P. D., Wright, J., Agarwala, V., Scott, D., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nat Protoc. 8 (11), 2281-2308 (2013).</li><li>Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Golden+gate+shuffling:+A+one-pot+DNA+shuffling+method+based+on+type+IIs+restriction+enzymes.">Golden gate shuffling: A one-pot DNA shuffling method based on type IIs restriction enzymes.</a> PLoS ONE. 4 (5), (2009).</li><li>Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., Yamamoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+in+human+cells+using+all-in-one+CRISPR/Cas9+vector+system.">Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system.</a> Sci Rep. 4 (5), 5400 (2014).</li><li>Kabadi, A. M., Ousterout, D. G., Hilton, I. B., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+CRISPR/Cas9-based+genome+engineering+from+a+single+lentiviral+vector.">Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector.</a> Nucleic Acids Res. 42 (19), 1-11 (2014).</li><li>Yin, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+Conditional+Mutagenesis+Using+Transgenic+Expression+of+Cas9+and+sgRNAs.">Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs.</a> Genetics. 200 (2), 431-441 (2015).</li><li>Cress, B. F., Toparlak, O. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPathBrick:+Modular+Combinatorial+Assembly+of+Type+II-A+CRISPR+Arrays+for+dCas9-Mediated+Multiplex+Transcriptional+Repression+in+E.+coli.">CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli.</a> ACS Synth Biol. 4 (9), 987-1000 (2015).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli+using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli using the heat shock method.</a> J Vis Exp. (6), e253 (2007).</li><li>Zimmermann, J., Voss, H., Schwager, C., Stegemann, J., Ansorge, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+Sanger+dideoxy+sequencing+reaction+protocol.">Automated Sanger dideoxy sequencing reaction protocol.</a> FEBS Letters. 233 (2), 432-436 (1988).</li><li>Fujii, M., Matano, M., Nanki, K., Sato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genetic+engineering+of+human+intestinal+organoids+using+electroporation.">Efficient genetic engineering of human intestinal organoids using electroporation.</a> Nat. Protoc. 10 (10), 1474-1485 (2015).</li><li>Andersson-Rolf, A., Fink, J., Mustata, R. C., Koo, B. -. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+video+protocol+of+retroviral+infection+in+primary+intestinal+organoid+culture.">A video protocol of retroviral infection in primary intestinal organoid culture.</a> J Vis Exp. (90), e51765 (2014).</li></ol>

The authors have nothing to disclose. The authors have no conflict of interest declared.

In this protocol, we detail all the steps necessary to generate CRISPR-concatemers and to apply CRISPR-concatemers in mouse intestinal organoids in order to simultaneously knock out multiple genes. As previously noted, this strategy has several advantages, such as its speed, high efficiency and cost-effectiveness.
In order to successfully perform the whole procedure, there are a few critical aspects to consider. First, it is essential that all gRNA oligos are properly annealed and phosphorylated, as they represent the starting material for the BbsI cloning reaction that in itself is very efficient. Secondly, when electroporating organoids, the more cells used per condition, the higher the maximum possible transfection efficiency. In addition, it is also important that after cell dissociation, small cell clusters predominate over single cells.
Nevertheless, it is possible to encounter technical problems when attempting either the cloning or the transfection for the first time; in the case of problems during gRNA cloning, it is recommended to double check the gRNA oligo sequence and, if correct, select additional bacterial colonies for restriction digestion screening. If transfection efficiency and cell viability are low post-electroporation, then it is advisable to repeat the protocol using more cells per condition and reducing the time of cell dissociation to 3 min.
Although the generation of CRISPR-concatemers is relatively cheap and easy, performing larger scale genetic screens in organoids is not, as the scale is limited by the costs associated with organoid culture and by its labor-intensive nature. It is worth mentioning in this case that the CRISPR-concatemer method is also compatible with cell lines, such as HEK293 and mouse embryonic stem cells.
Regardless of the cellular system, another potential drawback of this strategy can be encountered when aiming at the simultaneous knockout of three or four different genes. For instance, each gRNA will have a different targeting efficiency and the changes of hitting all the genes at the same time can be relatively low; for this reason, it is advisable to employ the concatemer system to direct more than one gRNA against the same gene.
Alternative strategies similarly based on Golden Gate shuffling have been proposed over the years to generate multiplex gRNA vectors7,8. However, in our method it is possible to directly assemble multiple gRNAs into a single retroviral vector in a single round of cloning, which makes it suitable for generating gRNA libraries to target paralogues.
Our CRISPR-concatemer is built in the MSCV retroviral vector backbone. Thus, gRNA concatemer-containing retrovirus can be used to generate stable cell lines that overexpress gRNAs. When combined with a Cas9-inducible system, one can perform inducible paralogue knockouts using our system.
In summary, here we describe how to clone up to four different gRNAs into the same vector in one step and how to apply this strategy to organoid culture with a high transfection efficiency. Furthermore, we provide useful suggestions to maximize the chances of success throughout the entire procedure.

An erratum was issued for: <a href="https://www.jove.com/video/55916/a-protocol-for-multiple-gene-knockout-mouse-small-intestinal">A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer</a>. There was a typo in step 3.3 of the Protocol.

Erratum: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer

The reverse genetics approach is a widely used method for investigating the function of a gene. In particular, loss-of-function studies, in which disruption of a gene causes phenotypic alterations, play a key role in building our understanding of biological processes. The CRISPR/Cas9 method represents the most recent advancement in genome engineering technology and has revolutionized the current practice of genetics in cells and organisms. Cas9 is an RNA-guided endonuclease which binds to a specific DNA sequence complementary to the gRNA and generates a double-strand break (DSB). This DSB recruits DNA repair machinery that, in the absence of a DNA template for homologous recombination, will re-ligate the cut DNA strand via error-prone non-homologous end joining, which can thus result in insertions or deletions of nucleotide(s) causing frameshift mutations1.
The great ease and versatility of the CRISPR/Cas9 approach has made it a highly attractive tool for genome-scale knockout screens aimed at unraveling unknown gene functions2,3. Nevertheless, single gene knockout approaches are of limited use if multiple paralogues with redundant functions exist. Thus, ablating a single gene might not be enough to determine the function of that gene given possible compensation by paralogues resulting in little or no phenotypic alteration4. It is therefore important to knock out paralogues in parallel by delivering multiple gRNA vectors targeting the different paralogous genes in order to overcome the influence of genetic compensation.
To extend the use of CRISPR/Cas9 to paralogous gene knockout, we have recently developed a rapid, one-step cloning method to clone up to four pre-annealed gRNAs into a single retroviral vector5. The backbone, named CRISPR-concatemer, is based on an MSCV retroviral plasmid containing repetitive gRNA expression cassettes. Each cassette contains two inverted recognition sites of the Type IIS restriction enzyme BbsI, which can be irreversibly replaced by an annealed gRNA oligo with matching overhangs using a Golden Gate shuffling reaction in a single tube6. This cloning method consists of repetitive cycles of digestion and ligation that allow simultaneous assembly of multiple DNA fragments by exploiting the different overhang sequences generated by BbsI. The uniqueness of this enzyme is, for instance, the ability to perform asymmetric cuts outside of its recognition sequence; therefore, each cassette can have a different sequence with customized overhangs flanking BbsI core site and in this way, each gRNA can be cloned in a specific position and orientation of the concatemer vector.
As a proof of principle, we demonstrated the use of this strategy in mouse intestinal organoids by disrupting simultaneously two pairs of paralogous negative regulators of the Wnt pathway by one round of electroporation5.
During the past few years, many other groups have developed similar strategies based on multiple gRNA expression vectors constructed using Golden Gate shuffling7 to achieve multi-gene knockout in various model systems, such as human cell lines8,9, zebrafish10 and Escherichia coli11. In their protocols, gRNAs are first cloned into individual intermediate vectors and then assembled together into one final product. By contrast, the main advantage of our CRISPR-concatemer strategy is the convenience of a single BbsI shuffling, cloning step. Like other gRNA concatemers, our method makes possible either the simultaneous knockout of up to four different genes or increased CRISPR knockout efficiency following the targeting of one or two genes with multiple gRNAs (Figure 1).
In this protocol, we describe in detail every step in the generation of CRISPR-concatemer vectors, from gRNA design to the Golden Gate reaction and to confirmation of successful cloning. We also provide a highly efficient protocol for the transfection of CRISPR-concatemers into mouse small intestinal organoids by electroporation and subsequent growth factor withdrawal experiments.

<table border="0" cellpadding="0" cellspacing="0" width="976">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Optimized CRISPR Design Tool</td>
			<td style="width:183px;">Feng Zhang group</td>
			<td style="width:119px;"></td>
			<td style="width:395px;">CRISPR gRNA design tool; http://crispr.mit.edu/</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Webcutter 2.0</td>
			<td style="width:183px;"></td>
			<td style="width:119px;"></td>
			<td>restriction mapping tool; http://rna.lundberg.gu.se/cutter2/</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">T4 PNK (Polynucleotide Kinase)</td>
			<td style="width:183px;">New England Biolabs</td>
			<td style="width:119px;">M0201L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">T4 DNA ligase buffer</td>
			<td style="width:183px;">New England Biolabs</td>
			<td style="width:119px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">T7 DNA Ligase</td>
			<td style="width:183px;">New England Biolabs</td>
			<td style="width:119px;">M0318L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">DTT (dithiothreitol)</td>
			<td style="width:183px;">Promega</td>
			<td style="width:119px;">P1171</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">ATP (adenosine triphosphate)</td>
			<td style="width:183px;">New England Biolabs</td>
			<td style="width:119px;">P0756S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">FastDigest BbsI (BpiI)</td>
			<td style="width:183px;">Thermo Fisher</td>
			<td style="width:119px;">FD1014</td>
			<td></td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:281px;">Tango buffer (BSA-containing restriction enzyme buffer)</td>
			<td style="width:183px;">Thermo Fisher</td>
			<td style="width:119px;">BY5</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">BglII</td>
			<td style="width:183px;">New England Biolabs</td>
			<td style="width:119px;">R0144</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">EcoRI</td>
			<td style="width:183px;">New England Biolabs</td>
			<td style="width:119px;">R0101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Plasmid-safe exonuclease</td>
			<td style="width:183px;">Cambio</td>
			<td style="width:119px;">E3101K</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Thermal cycler</td>
			<td style="width:183px;">Applied biosystems</td>
			<td style="width:119px;">4359659</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">10G competent E. coli bacteria</td>
			<td style="width:183px;">Cambridge Bioscience</td>
			<td style="width:119px;">60108-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Plasmid mini kit</td>
			<td style="width:183px;">Qiagen</td>
			<td style="width:119px;">12125</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Table top microcentrifuge</td>
			<td style="width:183px;">Eppendorf</td>
			<td style="width:119px;">UY-02580-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Inoculating loops</td>
			<td style="width:183px;">Microspec</td>
			<td style="width:119px;">PLS5</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Bacteria incubator</td>
			<td style="width:183px;">Sanyo</td>
			<td style="width:119px;">MIR-262</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Luria-Bertani broth (LB)</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:119px;">L3522</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Agarose</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:119px;">A4718</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Agarose gel electrophoresis apparatus</td>
			<td style="width:183px;">Bioneer</td>
			<td style="width:119px;">A-7020</td>
			<td></td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:281px;">Advanced DMEM/F12(cell culture medium)</td>
			<td style="width:183px;">Invitrogen</td>
			<td style="width:119px;">12634-034</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:281px;">Glutamax (L-Glutamine) 100x</td>
			<td style="width:183px;">Invitrogen</td>
			<td style="width:119px;">35050-068</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:281px;">HEPES 1 M (buffering agent)</td>
			<td style="width:183px;">Invitrogen</td>
			<td style="width:119px;">15630-056</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:281px;">Penicillin-streptomycin 100x</td>
			<td style="width:183px;">Invitrogen</td>
			<td style="width:119px;">15140-122</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:281px;">B27 supplement (Neuronal cell serum-free supplement) 50x</td>
			<td style="width:183px;">Invitrogen</td>
			<td style="width:119px;">17504-044</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:281px;">N2 supplement (Neuronal cell serum-free supplement) 100x</td>
			<td style="width:183px;">Invitrogen</td>
			<td style="width:119px;">17502-048</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:281px;">n-Acetylcysteine 500 mM</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:119px;">A9165-5G</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:281px;">Mouse EGF 500 &#181;g/mL</td>
			<td style="width:183px;">Invitrogen Biosource</td>
			<td style="width:119px;">PMG8043</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:281px;">Mouse Noggin 100 &#181;g/mL</td>
			<td style="width:183px;">Peprotech</td>
			<td style="width:119px;">250-38</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:21px;width:281px;">Nicotinamide 1 M</td>
			<td style="width:183px;">Sigma</td>
			<td style="width:119px;">N0636</td>
			<td></td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:281px;">R-Spondin conditioned medium</td>
			<td style="width:183px;">n.a.</td>
			<td style="width:119px;">n.a.</td>
			<td style="width:395px;">Produced in house from HEK293 cells, for details see Sato and Clevers 2013</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:70px;width:281px;">Wnt conditioned medium</td>
			<td style="width:183px;">n.a.</td>
			<td style="width:119px;">n.a.</td>
			<td style="width:395px;">Produced in house from HEK293 cells, for details see Sato and Clevers 2013</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:281px;">Y-27632 10 &#181;M</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:119px;">Y0503-1MG</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Standard BD Matrigel matrix</td>
			<td style="width:183px;">BD Biosciences</td>
			<td style="width:119px;">356231</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">48-well Plate</td>
			<td style="width:183px;">Greiner Bio One</td>
			<td style="width:119px;">677980</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:281px;">CHIR99021</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:119px;">A3734-1MG</td>
			<td style="width:395px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">IWP-2</td>
			<td style="width:183px;">Cell Guidance Systems</td>
			<td style="width:119px;">SM39-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">TrypLE (recombinant protease)</td>
			<td style="width:183px;">Invitrogen</td>
			<td style="width:119px;">12605-010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Opti-MEM (reduced serum medium )</td>
			<td style="width:183px;">Life technologies</td>
			<td style="width:119px;">51985-034</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Electroporation Cuvettes 2mm gap</td>
			<td style="width:183px;">NepaGene</td>
			<td style="width:119px;">EC-002S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Low binding 15 mL tubes</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:119px;">CLS430791</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">B&#252;rker&#8217;s chamber</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:119px;">BR719520-1EA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">NEPA21 Super Electroporator</td>
			<td style="width:183px;">NepaGene</td>
			<td style="width:119px;">contact supplier</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">Protein LoBind tubes low binding</td>
			<td style="width:183px;">Thermo Fisher</td>
			<td style="width:119px;">10708704</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">BTXpress electroporation buffer</td>
			<td style="width:183px;">Harvard Apparatus</td>
			<td style="width:119px;">45-0805</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:281px;">DMSO (Dimethyl sulfoxide)</td>
			<td style="width:183px;">AppliChem</td>
			<td style="width:119px;">A3672</td>
			<td></td>
		</tr>
	</tbody>
</table>

a protocol for multiple gene knockout in mouse small intestinal organoids using a crispr-concatemer

CRISPR/Cas9 technology has greatly improved the feasibility and speed of loss-of-function studies that are essential in understanding gene function. In higher eukaryotes, paralogous genes can mask a potential phenotype by compensating the loss of a gene, thus limiting the information that can be obtained from genetic studies relying on single gene knockouts. We have developed a novel, rapid cloning method for guide RNA (gRNA) concatemers in order to create multi-gene knockouts following a single round of transfection in mouse small intestinal organoids. Our strategy allows for the concatemerization of up to four individual gRNAs into a single vector by performing a single Golden Gate shuffling reaction with annealed gRNA oligos and a pre-designed retroviral vector. This allows either the simultaneous knockout of up to four different genes, or increased knockout efficiency following the targeting of one gene by multiple gRNAs. In this protocol, we show in detail how to efficiently clone multiple gRNAs into the retroviral CRISPR-concatemer vector and how to achieve highly efficient electroporation in intestinal organoids. As an example, we show that simultaneous knockout of two pairs of genes encoding negative regulators of the Wnt signaling pathway (Axin1/2 and Rnf43/Znrf3) renders intestinal organoids resistant to the withdrawal of key growth factors.

In order to confirm the presence of the correct number of gRNA inserts in the concatemer vector, restriction digestion is performed with enzymes (EcoRI + BglII) flanking all gRNA expressing cassettes (each cassette size is ~400 bp, Figure 1). For example, when generating a 4 gRNA- concatemer vector, the expected size of the lower band in the agarose gel is approximately 1.6 Kbp; any band lower than this indicates that not all of the 4 gRNA cassettes are inserted into the vector (Figure 2A). In addition, it is always recommended to check that all BbsI recognition sites are lost and the enzyme does not cut the vector (Figure 2B).
Once the constructs have been confirmed, they can be delivered to mouse intestinal organoids by electroporation to achieve optimal levels of transfection efficiency (up to 70%), as shown by the GFP control (Figure 3).
Finally, to functionally test the efficiency of this strategy, intestinal organoids transfected with Cas9 and concatemer vectors against Axin1/2 and Rnf43/Znrf3 were cultured in EN (R-spondin withdrawal) and EN + IWP2 (R-spondin and Wnt withdrawal, IWP2: Porcupine inhibitor, 2.5 &#956;M) media for a minimum of 3 passages (Figure 4). While untransfected WT organoids died under both conditions, Axin1/2 knockout organoids survived in both due to downstream activation of the Wnt pathway; in addition, Rnf43/Znrf3 mutant organoids survive in the absence of R-spondin but cannot survive in the presence of IWP2, which causes depletion of the Wnt that activates the pathway. Taken together, these observations demonstrate that knockout of these pairs of paralogues is possible by generating the expected organoid phenotype. Details of these results have been published in Developmental Biology5.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/55916/55916fig1.jpg" /> 
Figure 1: Schematic Representation of the CRISPR-concatemer with 4 Cassettes. Scheme of the 4 gRNA-concatemer vector with each 400 bp cassette containing a U6 promoter, two inverted repeated BbsI sites (also indicated as BB) and gRNA scaffold in this order. During the shuffling reaction, BbsI sites are replaced by gRNA fragments with matching overhangs and consequently lost. Binding sites of the sequencing primers for checking the correct insertion of gRNA oligos are shown by the blue arrows. Fwd = forward primer, Rev = reverse primer, Link 1/2/3 = linker regions 1/2/3. <a href="http://cloudflare.jove.com/files/ftp_upload/55916/55916fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/55916/55916fig2.jpg" /> 
Figure 2: Representative Digestion Patterns of Concatemer Vectors. (A) Double digestion of 3 and 4 gRNA-concatemer vectors with EcoRI and BglII. The correct digestion pattern is marked by a green tick, whereas vectors with only 1 or 2 gRNA insertions are marked by a red cross. Lane 1 shows digestion of a 4 gRNA-concatemer parental vector used as positive control (marked by &#34;+&#34;); similarly, lane 5 shows digestion of a 3 gRNA-concatemer parental vector, marked by &#34;+&#34;. (B) Digestion with BbsI, showing the correct size of undigested concatemer vectors (indicated by the green ticks). Digestion of a gRNA-containing concatemer vector that has lost BbsI sites is used as a positive control and is marked by &#34;+&#34;. <a href="http://cloudflare.jove.com/files/ftp_upload/55916/55916fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/55916/55916fig3.jpg" /> 
Figure 3: Representative Image of Successfully Electroporated Intestinal Organoids. Transfection of a GFP plasmid is instrumental to evaluate transfection efficiency. Approximately 24 h after electroporation, organoids containing a small number of cells are already visible and, if the electroporation procedure was successful, up to 70% of them displays green fluorescence. BF = bright field, GFP = green fluorescent protein. Scale bar = 2,000 &#181;m. <a href="http://cloudflare.jove.com/files/ftp_upload/55916/55916fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/55916/55916fig4.jpg" /> 
Figure 4: Representative Images of Mutant Intestinal Organoids. Knockout of the negative regulators of the Wnt pathway Axin1 and Rnf43, together with their paralogues, renders the intestinal organoids resistant to growth factor deprivation. In particular, Axin1/2 knockout organoids (Axin1/2 KO) can grow in the absence of both R-spondin (EN: EGF + Noggin) and Wnt (EN + IWP2: EN + Porcupine inhibitor), whereas Rnf43/Znrf3 mutant organoids (R&#38;Z KO) can only survive in the absence of R-spondin (EN). In contrast, WT organoids can only survive in the control culture condition, WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nicotinamide). Scale bars = 1,000 &#181;m. <a href="http://cloudflare.jove.com/files/ftp_upload/55916/55916fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Basal medium</td>
			<td></td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Store at 4 &#176;C for 4 weeks</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture medium</td>
			<td>500 mL</td>
			<td>See table of materials</td>
		</tr>
		<tr>
			<td>L-Glutamine 100x</td>
			<td>5 mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Buffering agent 1 M</td>
			<td>5 mL</td>
			<td>See table of materials</td>
		</tr>
		<tr>
			<td>Penicillin Streptomycin 100x</td>
			<td>5 mL</td>
			<td></td>
		</tr>
		<tr>
			<td>WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nicotinamide)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Store at 4 &#176;C for 2 weeks</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Basal medium</td>
			<td>up to 50 mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuronal cell serum-free supplement (50x)</td>
			<td>1 mL</td>
			<td>See table of materials</td>
		</tr>
		<tr>
			<td>Neuronal cell serum-free supplement (100x)</td>
			<td>500 &#956;L</td>
			<td>See table of materials</td>
		</tr>
		<tr>
			<td>n-Acetylcysteine (500 mM)</td>
			<td>125 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>mouse EGF (100 &#956;g/mL)</td>
			<td>25 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>mouse Noggin (100 &#956;g/mL)</td>
			<td>50 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>R-Spondin conditioned medium</td>
			<td>5 mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Wnt3a conditioned medium</td>
			<td>25 mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Nicotinamide (1 M)</td>
			<td>250 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>EN + CHIR + Y-27632 (EGF + Noggin + CHIR + Y-27632)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Store at 4 &#176;C for 2 weeks</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Basal medium w/o Penicillin Streptomycin</td>
			<td>up to 20 mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuronal cell serum-free supplement (50x)</td>
			<td>400 &#956;L</td>
			<td>See table of materials</td>
		</tr>
		<tr>
			<td>Neuronal cell serum-free supplement (100x)</td>
			<td>200 &#956;L</td>
			<td>See table of materials</td>
		</tr>
		<tr>
			<td>n-Acetylcysteine (500 mM)</td>
			<td>50 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>mouse EGF (100 &#956;g/mL)</td>
			<td>10 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>mouse Noggin (100 &#956;g/mL)</td>
			<td>20 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632 (10 &#956;M)</td>
			<td>20 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>CHIR99021 (8 &#956;M)</td>
			<td>10 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>EN (EGF + Noggin)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Store at 4 &#176;C for 4 weeks</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Basal medium</td>
			<td>up to 50 mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuronal cell serum-free supplement (50x)</td>
			<td>1 mL</td>
			<td>See Table of materials</td>
		</tr>
		<tr>
			<td>Neuronal cell serum-free supplement (100x)</td>
			<td>500 &#956;L</td>
			<td>See Table of materials</td>
		</tr>
		<tr>
			<td>n-Acetylcysteine (500 mM)</td>
			<td>125 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>mouse EGF (100 &#956;g/mL)</td>
			<td>25 &#956;L</td>
			<td></td>
		</tr>
		<tr>
			<td>mouse Noggin (100 &#956;g/mL)</td>
			<td>50 &#956;L</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 2: Organoid Media Composition.

Watch this Scientific Journal Video about A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer at JoVE.com

A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer

This protocol describes the steps for cloning multiple single guide RNAs into one guide RNA concatemer vector, which is of particular use in creating multi-gene knockouts using CRISPR/Cas9 technology. The generation of double knockouts in intestinal organoids is shown as a possible application of this method.

CRISPR/Cas9 technology has greatly improved the feasibility and speed of loss-of-function studies that are essential in understanding gene function. In ...

a-protocol-for-multiple-gene-knockout-mouse-small-intestinal

Research

JoVE Journal

Bioengineering

17.9K Views.  University of Cambridge. This protocol describes the steps for cloning multiple single guide RNAs into one guide RNA concatemer vector, which is of particular use in creating multi-gene knockouts using CRISPR/Cas9 technology. The generation of double knockouts in intestinal organoids is shown as a possible application of this method.

Video: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Creating Two-Dimensional Patterned Substrates for Protein and Cell Confinement

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1 While microcontact printing can be employed to directly print a large number of molecules, including proteins,2 DNA,3 and silanes,4 the formation of self-assembled monolayers (SAMs) from long chain alkane thiols on gold provides a simple way to confine proteins and cells to specific patterns containing adhesive and resistant regions. This confinement can be used to control cell morphology and is useful for examining a variety of questions in protein and cell biology. Here, we describe a general method for the creation of well-defined protein patterns for cellular studies.5 This process involves three steps: the production of a patterned master using photolithography, the creation of a PDMS stamp, and microcontact printing of a gold-coated substrate. Once patterned, these cell culture substrates are capable of confining proteins and/or cells (primary cells or cell lines) to the pattern.
The use of self-assembled monolayer chemistry allows for precise control over the patterned protein/cell adhesive regions and non-adhesive regions; this cannot be achieved using direct protein stamping. Hexadecanethiol, the long chain alkane thiol used in the microcontact printing step, produces a hydrophobic surface that readily adsorbs protein from solution. The glycol-terminated thiol, used for backfilling the non-printed regions of the substrate, creates a monolayer that is resistant to protein adsorption and therefore cell growth.6 These thiol monomers produce highly structured monolayers that precisely define regions of the substrate that can support protein adsorption and cell growth. As a result, these substrates are useful for a wide variety of applications from the study of intercellular behavior7 to the creation of microelectronics.8
While other types of monolayer chemistry have been used for cell culture studies, including work from our group using trichlorosilanes to create patterns directly on glass substrates,9 patterned monolayers formed from alkane thiols on gold are straight-forward to prepare. Moreover, the monomers used for monolayer preparation are commercially available, stable, and do not require storage or handling under inert atmosphere. Patterned substrates prepared from alkane thiols can also be recycled and reused several times, maintaining cell confinement.10

Self-assembled monolayers (SAMs) formed from long chain alkane thiols on gold provide well-defined substrates for the formation of protein patterns and cell confinement. Microcontact printing of hexadecanethiol using a polydimethylsiloxane (PDMS) stamp followed by backfilling with a glycol-terminated alkane thiol monomer produces a pattern where protein and cells adsorb only to the stamped hexadecanethiol region.

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1  While microcontact printing ...

Cellular Lipid Extraction for Targeted Stable Isotope Dilution Liquid Chromatography-Mass Spectrometry Analysis

The metabolism of fatty acids, such as arachidonic acid (AA) and linoleic acid (LA), results in the formation of oxidized bioactive lipids, including numerous stereoisomers1,2. These metabolites can be formed from free or esterified fatty acids. Many of these oxidized metabolites have biological activity and have been implicated in various diseases including cardiovascular and neurodegenerative diseases, asthma, and cancer3-7. Oxidized bioactive lipids can be formed enzymatically or by reactive oxygen species (ROS). Enzymes that metabolize fatty acids include cyclooxygenase (COX), lipoxygenase (LO), and cytochromes P450 (CYPs)1,8. Enzymatic metabolism results in enantioselective formation whereas ROS oxidation results in the racemic formation of products.
While this protocol focuses primarily on the analysis of AA- and some LA-derived bioactive metabolites; it could be easily applied to metabolites of other fatty acids. Bioactive lipids are extracted from cell lysate or media using liquid-liquid (l-l) extraction. At the beginning of the l-l extraction process, stable isotope internal standards are added to account for errors during sample preparation. Stable isotope dilution (SID) also accounts for any differences, such as ion suppression, that metabolites may experience during the mass spectrometry (MS) analysis9. After the extraction, derivatization with an electron capture (EC) reagent, pentafluorylbenzyl bromide (PFB) is employed to increase detection sensitivity10,11. Multiple reaction monitoring (MRM) is used to increase the selectivity of the MS analysis. Before MS analysis, lipids are separated using chiral normal phase high performance liquid chromatography (HPLC). The HPLC conditions are optimized to separate the enantiomers and various stereoisomers of the monitored lipids12. This specific LC-MS method monitors prostaglandins (PGs), isoprostanes (isoPs), hydroxyeicosatetraenoic acids (HETEs), hydroxyoctadecadienoic acids (HODEs), oxoeicosatetraenoic acids (oxoETEs) and oxooctadecadienoic acids (oxoODEs); however, the HPLC and MS parameters can be optimized to include any fatty acid metabolites13.
Most of the currently available bioanalytical methods do not take into account the separate quantification of enantiomers. This is extremely important when trying to deduce whether or not the metabolites were formed enzymatically or by ROS. Additionally, the ratios of the enantiomers may provide evidence for a specific enzymatic pathway of formation. The use of SID allows for accurate quantification of metabolites and accounts for any sample loss during preparation as well as the differences experienced during ionization. Using the PFB electron capture reagent increases the sensitivity of detection by two orders of magnitude over conventional APCI methods. Overall, this method, SID-LC-EC-atmospheric pressure chemical ionization APCI-MRM/MS, is one of the most sensitive, selective, and accurate methods of quantification for bioactive lipids.

This protocol will demonstrate the extraction and analysis of free and esterified bioactive fatty acids from cells. Fatty acids are accurately quantified using stable isotope dilution, chiral liquid chromatography, electron capture atmospheric chemical ionization multiple reaction monitoring mass spectrometry (SID-LC-ECAPCI-MRM/MS).

The metabolism of fatty acids, such as arachidonic acid (AA) and linoleic acid (LA), results in the formation of oxidized bioactive lipids, including ...

A Microfluidic Device for Studying Multiple Distinct Strains

The study of cell responses to environmental changes poses many experimental challenges: cells need to be imaged under changing conditions, often in a comparative manner. Multiwell plates are routinely used to compare many different strains or cell lines, but allow limited control over the environment dynamics. Microfluidic devices, on the other hand, allow exquisite dynamic control over the surrounding conditions, but it is challenging to image and distinguish more than a few strains in them. Here we describe a method to easily and rapidly manufacture a microfluidic device capable of applying dynamically changing conditions to multiple distinct yeast strains in one channel. The device is designed and manufactured by simple means without the need for soft lithography. It is composed of a Y-shaped flow channel attached to a second layer harboring microwells. The strains are placed in separate microwells, and imaged under the exact same dynamic conditions. We demonstrate the use of the device for measuring protein localization responses to pulses of nutrient changes in different yeast strains.

We present a simple method to produce microfluidic devices capable of applying similar dynamic conditions to multiple distinct strains, without the need for a clean room or soft lithography.

The study of cell responses to environmental changes poses many experimental challenges: cells need to be imaged under changing conditions, often in a ...

Using Tomoauto: A Protocol for High-throughput Automated Cryo-electron Tomography

Cryo-electron tomography (Cryo-ET) is a powerful three-dimensional (3-D) imaging technique for visualizing macromolecular complexes in their native context at a molecular level. The technique involves initially preserving the sample in its native state by rapidly freezing the specimen in vitreous ice, then collecting a series of micrographs from different angles at high magnification, and finally computationally reconstructing a 3-D density map. The frozen-hydrated specimen is extremely sensitive to the electron beam and so micrographs are collected at very low electron doses to limit the radiation damage. As a result, the raw cryo-tomogram has a very low signal to noise ratio characterized by an intrinsically noisy image. To better visualize subjects of interest, conventional imaging analysis and sub-tomogram averaging in which sub-tomograms of the subject are extracted from the initial tomogram and aligned and averaged are utilized to improve both contrast and resolution. Large datasets of tilt-series are essential to understanding and resolving the complexes at different states, conditions, or mutations as well as obtaining a large enough collection of sub-tomograms for averaging and classification. Collecting and processing this data can be a major obstacle preventing further analysis. Here we describe a high-throughput cryo-ET protocol based on a computer-controlled 300kV cryo-electron microscope, a direct detection device (DDD) camera and a highly effective, semi-automated image-processing pipeline software wrapper library tomoauto developed in-house. This protocol has been effectively utilized to visualize the intact type III secretion system (T3SS) in Shigella flexneri minicells. It can be applicable to any project suitable for cryo-ET.

We present a protocol on how to utilize high-throughput cryo-electron tomography to determine high resolution in situ structures of molecular machines. The protocol permits large amounts of data to be processed, avoids common bottlenecks and reduces resource downtime, allowing the user to focus on important biological questions.

Cryo-electron tomography (Cryo-ET) is a powerful three-dimensional (3-D) imaging technique for visualizing macromolecular complexes in their native ...

Real Time Monitoring of Intracellular Bile Acid Dynamics Using a Genetically Encoded FRET-based Bile Acid Sensor

F&#246;rster Resonance Energy Transfer (FRET) has become a powerful tool for monitoring protein folding, interaction and localization in single cells. Biosensors relying on the principle of FRET have enabled real-time visualization of subcellular signaling events in live cells with high temporal and spatial resolution. Here, we describe the application of a genetically encoded Bile Acid Sensor (BAS) that consists of two fluorophores fused to the farnesoid X receptor ligand binding domain (FXR-LBD), thereby forming a bile acid sensor that can be activated by a large number of bile acids species and other (synthetic) FXR ligands. This sensor can be targeted to different cellular compartments including the nucleus (NucleoBAS) and cytosol (CytoBAS) to measure bile acid concentrations locally. It allows rapid and simple quantitation of cellular bile acid influx, efflux and subcellular distribution of endogenous bile acids without the need for labeling with fluorescent tags or radionuclei. Furthermore, the BAS FRET sensors can be useful for monitoring FXR ligand binding. Finally, we show that this FRET biosensor can be combined with imaging of other spectrally distinct fluorophores. This allows for combined analysis of intracellular bile acid dynamics and i) localization and/or abundance of proteins of interest, or ii) intracellular signaling in a single cell.

We provide a detailed protocol to study bile acid dynamics in living cells using a genetically encoded BAS FRET sensor. This Bile Acid Sensor represents a unique tool to study (regulation of) bile acid transport and FXR activation in a wide range of cell types.

F&#246;rster Resonance Energy Transfer (FRET) has become a powerful tool for monitoring protein folding, interaction and localization in single cells. ...

A Protocol for Decellularizing Mouse Cochleae for Inner Ear Tissue Engineering

In mammals, mechanosensory hair cells that facilitate hearing lack the ability to regenerate, which has limited treatments for hearing loss. Current regenerative medicine strategies have focused on transplanting stem cells or genetic manipulation of surrounding support cells in the inner ear to encourage replacement of damaged stem cells to correct hearing loss. Yet, the extracellular matrix (ECM) may play a vital role in inducing and maintaining function of hair cells, and has not been well investigated. Using the cochlear ECM as a scaffold to grow adult stem cells may provide unique insights into how the composition and architecture of the extracellular environment aids cells in sustaining hearing function. Here we present a method for isolating and decellularizing cochleae from mice to use as scaffolds accepting perfused adult stem cells. In the current protocol, cochleae are isolated from euthanized mice, decellularized, and decalcified. Afterward, human Wharton&#39;s jelly cells (hWJCs) that were isolated from the umbilical cord were carefully perfused into each cochlea. The cochleae were used as bioreactors, and cells were cultured for 30 days before undergoing processing for analysis. Decellularized cochleae retained identifiable extracellular structures, but did not reveal the presence of cells or noticeable fragments of DNA. Cells perfused into the cochlea invaded most of the interior and exterior of the cochlea and grew without incident over a duration of 30 days. Thus, the current method can be used to study how cochlear ECM affects cell development and behavior.

The goal of this protocol is to demonstrate an effective method to decellularize and decalcify mouse cochleae for utilization as scaffolds for tissue engineering applications.

In mammals, mechanosensory hair cells that facilitate hearing lack the ability to regenerate, which has limited treatments for hearing loss. Current ...

Visual Detection of Multiple Nucleic Acids in a Capillary Array

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently needed in disease diagnosis, microbial monitoring, genetically modified organism (GMO) detection, and forensic analysis. We have previously described the platform called CALM (Capillary Array-based Loop-mediated isothermal amplification for Multiplex visual detection of nucleic acids). Herein, we describe improved fabrication and performance processes for this platform. Here, we apply a small, ready-to-use cassette assembled by capillary array for multiplex visual detection of nucleic acids. The capillary array is pre-treated into a hydrophobic and hydrophilic pattern before fixing loop-mediated isothermal amplification (LAMP) primer sets in capillaries. After assembly of the loading adaptor, LAMP reaction mixture is loaded and isolated into each capillary, due to capillary force by a single pipetting step. The LAMP reactions are performed in parallel in the capillaries. The results are visually read out by illumination with a hand-held UV flashlight. Using this platform, we demonstrate monitoring of 8 frequently appearing elements and genes in GMO samples with high specificity and sensitivity. In summary, the platform described herein is intended to facilitate the detection of multiple nucleic acids. We believe it will be widely applicable in fields where high-throughput nucleic acid analysis is required.

This protocol describes the fabrication of a small, ready-to-use cassette that can be applied for visual detection of multiple nucleic acids in a single, test that is easy to operate. In this approach, a capillary array was used for multiplex and highly efficient detection of GMO targets.

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently ...

Repressing Gene Transcription by Redirecting Cellular Machinery with Chemical Epigenetic Modifiers

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene expression regulation are commonly disrupted in many diseases, a locus-specific, endogenous, and reversible method to study and control these mechanisms of action has been lacking. To address this issue, we have developed and characterized novel gene-regulating bifunctional molecules. One component of the bifunctional molecule binds to a DNA-protein anchor so that it will be recruited to an allele-specific locus. The other component engages endogenous cellular chromatin-modifying machinery, recruiting these proteins to a gene of interest. These small molecules, called chemical epigenetic modifiers (CEMs), are capable of controlling gene expression and the chromatin environment in a dose-dependent and reversible manner. Here, we detail a CEM approach and its application to decrease gene expression and histone tail acetylation at a Green Fluorescent Protein (GFP) reporter located at the Oct4 locus in mouse embryonic stem cells (mESCs). We characterize the lead CEM (CEM23) using fluorescent microscopy, flow cytometry, and chromatin immunoprecipitation (ChIP), followed by a quantitative polymerase chain reaction (qPCR). While the power of this system is demonstrated at the Oct4 locus, conceptually, the CEM technology is modular and can be applied in other cell types and at other genomic loci.

Regulation of the chromatin environment is an essential process required for proper gene expression. Here, we describe a method for controlling gene expression through the recruitment of chromatin-modifying machinery in a gene-specific and reversible manner.

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene ...

Conducting Multiple Imaging Modes with One Fluorescence Microscope

Fluorescence microscopy is a powerful tool to detect biological molecules in situ and monitor their dynamics and interactions in real-time. In addition to conventional epi-fluorescence microscopy, various imaging techniques have been developed to achieve specific experimental goals. Some of the widely used techniques include single-molecule fluorescence resonance energy transfer (smFRET), which can report conformational changes and molecular interactions with angstrom resolution, and single-molecule detection-based super-resolution (SR) imaging, which can enhance the spatial resolution approximately ten&#160;to twentyfold compared to diffraction-limited microscopy. Here we present a customer-designed integrated system, which merges multiple imaging methods in one microscope, including conventional epi-fluorescent imaging, single-molecule detection-based SR imaging, and multi-color single-molecule detection, including smFRET imaging. Different imaging methods can be achieved easily and reproducibly by switching optical elements. This set-up is easy to adopt by any research laboratory in biological sciences with a need for routine and diverse imaging experiments at a reduced cost and space relative to building separate microscopes for individual purposes.

Here we present a practical guide of building an integrated microscopy system, which merges conventional epi-fluorescent imaging, single-molecule detection-based super-resolution imaging, and multi-color single-molecule detection, including single-molecule fluorescence resonance energy transfer imaging, into one set-up in a cost-efficient way.

Fluorescence microscopy is a powerful tool to detect biological molecules in situ and monitor their dynamics and interactions in real-time. In addition to ...