We thank Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar and all the members of the Valenzano lab at the Max Planck Institute for Biology of Ageing for contributing to different aspects of the current killifish husbandry protocol over the years.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

All the authors declare no competing financial and non-financial interests.

We describe a protocol for laboratory culturing of turquoise killifish, including embryo collection, incubation, as well as adult fish housing, breeding, and feeding. Our protocol is specifically targeted to laboratories that conduct research focused on adult fish, in particular for experimental studies on aging and life span. Turquoise killifish can be raised on a standard zebrafish facility; however, important aspects of killifish husbandry differ from standard zebrafish care16. These adjustments include early transition from a brine-shrimp only diet to a diet supplemented with protein-rich blood worm, as well as specific steps in embryo incubation, consisting of a liquid and dry incubation stage.
Critical steps within the protocol include shipping embryos within 8 - 30 &#176;C temperature range. In case of breeding, fecundity depends on feeding frequency and food quality; therefore, we recommend at least two feedings a day per breeding tank to raise embryos yield (see section 5.6.). During embryo bleaching, do not extend embryo incubation in the bleaching solution. This may cause damage to the egg chorion and increased embryo mortality. When incubating embryos with methylene blue, do not prolong incubation of ready-to-hatch embryos for longer than 2 weeks as their viability will be dramatically reduced. For hatching turquoise killifish, low temperature of humic acid solution improves hatching and complete immersion of the embryos in the solution allows synchronized hatching. Not sufficient aeration during the incubation results in high rates of fry not able to fill the gas bladder (&#34;belly-slider&#34; phenotype, see Notes in section 5.1).
Limitation of the protocol for breeding includes the use of the sand substrate which poses challenges to centralized filtration systems and should be replaced by alternative methods in the future. Possible alternatives could be the use of zebrafish breeding tanks. Embryo bleaching could cause major physical-chemical changes in the egg chorion that could result in altered chorion physiology and hatching success. Constant exposure of embryos to methylene blue may induce long-term changes in adult fish physiology. Raising adult fish in individual tanks for survival cohort studies may negatively affect fish behavior and health. However, group housing for survival cohort studies adds significant confounding factors due to the establishment of social dominance and male territories, leading to strict social hierarchies. Therefore, we judge that isolation of male fish for survival studies is a reasonable compromise. Feeding laboratory killifish colonies with live food from un-controlled sources add a risk for external contaminations from parasites and potentially pathogenic microbial communities. In the future, an ad hoc sterile fish feed should be developed.
Future improvements to this protocol will focus on a controlled, non-live diet, which still leads to completing sexual maturation within 3 - 4 weeks. In summary, our protocol offers accessibility to turquoise killifish laboratory culturing to a wide scientific community.

Given their short life span and rapid life cycle, turquoise killifish are rapidly growing as a promising new model organism in biology1,2,3. This species is characterized by a unique life cycle for a teleost, consisting of embryonic diapause, rapid sexual maturation, and an extended post-reproductive life stage4,5. Recent work has contributed to elucidating&#160;the biology of this species both in captivity and in the wild6,7. Turquoise killifish live in seasonal fresh water bodies that form during the rainy season in the African savannah in Zimbabwe and Mozambique. During the dry season, embryos survive in the dry mud in the absence of water by&#160;virtue of a stress-resistant life stage called diapause.
Genetic maps for this species have been generated8,9, and recently their genome has been sequenced and assembled10,11. Several inbred laboratory fish strains have been developed, and transgenesis and genome editing via CRISPR/Cas9 have become available in this species, de facto promoting turquoise killifish as a competitive laboratory vertebrate model organism12,13,14.
Although a laboratory protocol has already been published for this species15, in the present protocol we develop a comprehensive list of experimental laboratory guidelines that are specifically aimed at studies that investigate aging and survival. The present protocol enables researchers already familiar with zebrafish and medaka husbandry to become versed in turquoise killifish husbandry by adopting a minimum number of key adjustments. At the same time, this protocol provides researchers without prior experience in fish husbandry&#160;with the essential tools to raise a thriving turquoise killifish colony.

<table><tbody><tr><td>Probe calibration buffer solution pH=7.0</td><td>Roth</td><td>A518.1</td><td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td></tr><tr><td>Probe calibration buffer solution pH=4.0</td><td>Roth</td><td>P712.1</td><td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td></tr><tr><td>Conductivity standard</td><td>VWR</td><td>83607.260</td><td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td></tr><tr><td>Easy Strips Test 6in1</td><td>JBL</td><td>2533900</td><td>Test strips for determination chlorine values of system water</td></tr><tr><td>Ammonia Test</td><td>JBL</td><td>2536500</td><td>Test to determine ammonia content of system water</td></tr><tr><td>Red Sea Salt</td><td>Red Sea</td><td></td><td>22 kg bucket</td></tr><tr><td>Sodium hydrogen carbonate</td><td>VWR</td><td>27780.360</td><td></td></tr><tr><td>Humic acid</td><td>Sigma- Aldrich</td><td>53680-50G</td><td></td></tr><tr><td>New HUFA Artemia enrichment</td><td>ZM Systems UK</td><td></td><td>75g bottle</td></tr><tr><td>Methylene blue</td><td>Roth</td><td>AE64.1</td><td></td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma- Aldrich</td><td>31642-1L</td><td>30% (w/w)</td></tr><tr><td>Coconut fiber</td><td>Dragon</td><td>ZCS010</td><td></td></tr><tr><td>Whatman paper</td><td>GE healthcare</td><td>3030-690</td><td></td></tr><tr><td>Ethanol pure</td><td>VWR</td><td>20821.467</td><td>100%</td></tr><tr><td>Silica sand</td><td>local pet shop</td><td></td><td></td></tr><tr><td>Artemia Eggs Premium Grade</td><td>Sanders</td><td></td><td></td></tr><tr><td>Bloodworm</td><td>local distributor</td><td></td><td>Poseidon Aquakultur Germany</td></tr><tr><td>dNTPs solution mix</td><td>Biolabs</td><td>N04472</td><td>10mM</td></tr><tr><td>Taq DNA polymerase</td><td>Invitrogen</td><td>18038-042</td><td>5U/uL</td></tr><tr><td>PCR 10x Buffer</td><td>Invitrogen</td><td>18038-042</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Invitrogen</td><td>18038-042</td><td>50mM</td></tr><tr><td>NaOH</td><td>Sigma- Aldrich</td><td>S8045-500g</td><td>50mM</td></tr><tr><td>Tris-HCl, pH=8.0 solution</td><td>Sigma- Aldrich</td><td>T2694-1L</td><td>1M</td></tr><tr><td>HCl 37%</td><td>Sigma- Aldrich</td><td>H1758-500mL</td><td></td></tr><tr><td>Fish tanks</td><td>Aquaneering</td><td></td><td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td></tr><tr><td>Orbital shaker</td><td>VWR</td><td>89032-100</td><td>model 5000</td></tr><tr><td>Microbiological incubator</td><td>Thermo Scientific, Heratherm</td><td>50125882</td><td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Cooling Incubator</td><td>Binder</td><td>9020-0209</td><td>model KT115; for storage embryos in the solid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Hatching incubator</td><td>Thermo Scientific, Heratherm</td><td>51028114</td><td>model OGS180; for embryos hatching, set to t=27-28&amp;deg;C</td></tr><tr><td>Stereomicroscope</td><td>Leica</td><td></td><td>model M80</td></tr><tr><td>Breeding sand/hatching boxes</td><td>Roth</td><td>1598.1</td><td>1000mL</td></tr><tr><td>Petri dish</td><td>Sarstedt</td><td>82.1473</td><td>92x16mm</td></tr><tr><td>50 mL Conical tube</td><td>Sarstedt</td><td>62.547.254</td><td></td></tr><tr><td>15 mL Conical tube</td><td>Sarstedt</td><td>62.554.002</td><td></td></tr><tr><td>Disposable Plastic Pasteur pipette</td><td>Roth</td><td>EA71.1</td><td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td></tr><tr><td>Serological pipette</td><td>Sarstedt</td><td>86.1689.001</td><td>50mL</td></tr><tr><td>Syringe</td><td>Henke Sass Wolf</td><td>4100-000V0</td><td>10mL</td></tr><tr><td>Metal strainer</td><td></td><td></td><td>fineness &amp;lt;1mm; for embryos collection</td></tr><tr><td>Tweezers</td><td>Dumont</td><td>0508-5/45-PO</td><td>type5/45; for embryos transfer</td></tr><tr><td>25 L Brine shrimp hatcher</td><td>Aquaneering</td><td>ZHBS25</td><td>main hatcher</td></tr><tr><td>500 mL Brine shrimp hatcher</td><td>JBL</td><td>6106100</td><td>model Artemio 1; backup hatcher</td></tr><tr><td>Narrow-mesh fish nets</td><td>JBL</td><td></td><td></td></tr><tr><td>Sand beaker</td><td>VWR</td><td>BURK7102-5000</td><td>5000mL</td></tr><tr><td>Brine shrimp separation beaker</td><td>VWR</td><td>BURK7102-2000</td><td>2000mL</td></tr><tr><td>Plastic zipper bag</td><td>Roth</td><td>P279.2</td><td>for dead fish storage</td></tr><tr><td>Pipetboy</td><td>Integra</td><td>155000</td><td>model Pipetboy acu2</td></tr><tr><td>Parafilm</td><td>P-Lab</td><td>P701605</td><td></td></tr><tr><td>Air tubing</td><td>www.zajac.de</td><td>AQ380</td><td>4-6 mm diameter</td></tr><tr><td>1 L Glass bottle</td><td>VWR</td><td>215-1595</td><td></td></tr><tr><td>2 L Glass bottle</td><td>VWR</td><td>215-1596</td><td></td></tr><tr><td>500 mL Squeeze bottle</td><td>Roth</td><td>K665.1</td><td>for fish feeding with brine shrimp</td></tr><tr><td>120-&amp;#956;m brine shrimp strainer</td><td>Florida Aqua Farms</td><td>BB-PC2</td><td>for brine shrimp/bloodworm collection</td></tr><tr><td>Finish filter socks</td><td>Aquaneering</td><td>MFVB025C</td><td>25-&amp;#956;m</td></tr><tr><td>Central filtration fish housing system</td><td></td><td></td><td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td></tr></tbody></table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of reference fish model systems, such as zebrafish and medaka. In recent years, an emerging fish &#8211; the turquoise killifish (Nothobranchius furzeri) &#8211; has been adopted by a growing number of research groups in the fields of biology of aging and ecology. With a captive life span of 4 - 8 months, this species is the shortest-lived vertebrate raised in captivity and allows the scientific community to test &#8211; in a short time &#8211; experimental interventions that can lead to alterations of the aging rate and life expectancy. Given the unique biology of this species, characterized by embryonic diapause, explosive sexual maturation, marked morphological and behavioral sexual dimorphism - and their relatively short adult life span -&#160;ad hoc husbandry practices are in urgent demand. This protocol reports a set of key husbandry measures that allow optimal turquoise killifish laboratory care, enabling the scientific community to adopt this species as a powerful laboratory animal model.

Turquoise killifish proper husbandry results in median survival ranging between 12 - 18 weeks in the GRZ strain (e.g. Figure 4A). Variations of median survival depend on diet, feeding frequency, and housing temperature conditions. Poor husbandry results in survival curves presenting increased early mortality and repetitive, sudden drops of survival throughout time, characterized by several inflection points (Figure 4B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg" /> 
Figure 1: Representative embryonic developmental stages with respective incubation substrate. (A) Freshly collected embryos, incubated in methylene blue solution in the incubator at 28 &#176;C. (B) Embryos ready to be transferred to solid medium, either filter paper or coconut fiber. (C) Embryos ready to be hatched, displaying typical golden irises. The scale bar is equal to 1 mm. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg" /> 
Figure 2: Stages of turquoise killifish post-hatching development. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg" /> 
Figure 3: Representative fish ID tag for fish from stage 3 onwards. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg" /> 
Figure 4: Representative survival curve for 70 male turquoise killifish. (A) Typical survival curve for laboratory-raised turquoise killifish. (B) Comparison of survival curves obtained from fish raised under optimal husbandry conditions (black) and poor husbandry (red and blue). The dashed red horizontal line indicates 50% survival, intersecting survival curve at median life span (indicated on the x-axis). <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>ID</td>
			<td colspan="2">Forward primer</td>
			<td colspan="2">Reverse primer</td>
			<td>Size range (bp)</td>
		</tr>
		<tr>
			<td>*NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
		<tr>
			<td>*NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
		<tr>
			<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
		<tr>
			<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
		<tr>
			<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
		<tr>
			<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
		<tr>
			<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
		<tr>
			<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
		<tr>
			<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
		<tr>
			<td>*NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
		<tr>
			<td colspan="6">*- sex determination markers</td>
		</tr>
	</tbody>
</table>
Table 1: Genotyping primers for strain identification.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Laboratory housing of turquoise killifish can be scaled up&#160;to house and efficiently raise thousands of individual fish in a centralized water filtration system, employing the same infrastructure used for standard zebrafish facilities. Here we detail a list of standardized procedures that allow efficient killifish maintenance.

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

a-protocol-for-laboratory-housing-turquoise-killifish-nothobranchius

Research

JoVE Journal

Biology

16.7K Views.  Max Planck Institute for the Biology of Ageing. Laboratory housing of turquoise killifish can be scaled up to house and efficiently raise thousands of individual fish in a centralized water filtration system, employing the same infrastructure used for standard zebrafish facilities. Here we detail a list of standardized procedures that allow efficient killifish maintenance.

Video: A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

A Flow-through Exposure System for Evaluating Suspended Sediments Effects on Aquatic Life

This paper describes the Fish Larvae and Egg Exposure System (FLEES). The flow-through exposure system is used to investigate the effects of suspended sediment on various aquatic species and life stages in the laboratory by using pumps and automating delivery of sediment and water to simulate suspension of sediment. FLEES data are used to develop exposure-response curves between the effects on aquatic organisms and suspended sediment concentrations at the desired exposure duration. The effects data are used to evaluate management practices used to reduce the interactions between aquatic organisms and anthropogenic causes of suspended sediments. The FLEES is capable of generating total suspended solids (TSS) concentrations as low as 30 to as high as 800 mg/L, making this system an ideal choice for evaluating the effects of TSS resulting from many activities including simulating low ambient levels of TSS to evaluating sources of suspended sediments from dredging operations, vessel traffic, freshets, and storms.

A robust and flexible flow-through exposure system designed to maintain sediment in suspension is presented. The system is used to investigate the effects of suspended sediment on various aquatic species and life stages in the laboratory.

This paper describes the Fish Larvae and Egg Exposure System (FLEES). The flow-through exposure system is used to investigate the effects of suspended ...

Environment

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity testing has been demonstrated. Overall, the sensitivity of the species to toxic compounds is in the range with, or higher than, that of other model species.
This work describes protocols for acute, chronic, and multigenerational bioassays of single and combined stressor effects on N. furzeri. Due to its short maturation time and life-cycle, this vertebrate model allows the study of endpoints such as maturation time and fecundity within four months. Transgenerational full life-cycle exposure trials can be performed in as little as 8 months. Since this species produces eggs that are drought-resistant and remain viable for years, the on-site culture of the species is not needed but individuals can be recruited when required. The protocols are designed to measure life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

In this work, we describe an acute, chronic and multigenerational bioassay to study the effects of single and combined stressors on the Turquoise killifish Nothobranchius furzeri. This protocol is designed to study life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity ...

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult forms has revealed the genetic basis of some of these differences. Less is known about how the populations differ at post-larval stages (at the onset of feeding). Such studies may provide insight into how cavefish survive through adulthood in their natural environment. Methods for comparing post-larval development in the laboratory require standardized aquaculture and feeding regimes. Here we describe how to raise fish on a diet of nutrient-rich rotifers in non-recirculating water for up to two-weeks post fertilization. We demonstrate how to collect post-larval fish from this nursery system and perform whole-mount immunostaining. Immunostaining is an attractive alternative to transgene expression analysis for investigating development and gene function in A. mexicanus. The nursery method can also be used as a standard protocol for establishing density-matched populations for growth into adults.

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

In this protocol, we demonstrate how to breed Astyanax mexicanus adults, raise the larvae, and perform whole-mount immunohistochemistry on post-larval fish to compare the phenotypes of surface and cave morphotypes.

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult ...

Genetics

A Standardized Protocol for Preference Testing to Assess Fish Welfare

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the addition of physical objects or conspecifics in the housing environment) is often a way to give captive animals the opportunity to choose who or what they interact with and how they spend their time. A fundamental component of the aquatic environment that is often overlooked in captivity, however, is the ability for the animal to choose to engage in physical exercise. For many animals, including fish, exercise is an important aspect of their life history, and is known to have many health benefits, including positive changes in the brain and behavior. Here we present a method for assessing habitat preferences in captive animals. The protocol could easily be adapted to look at a variety of environmental factors (e.g., gravel versus sand as a substrate, plastic plants versus live plants, low flow versus high flow of water) in different aquatic species, or for use with terrestrial species. Statistical assessment of preference is carried out using Jacob&#39;s preference index, which ranks the habitats from -1 (avoidance) to +1 (most preferred). With this information, it can be determined what the animal wants from a welfare perspective, including their preferred location.

A fundamental aspect of assessing the welfare of animals in captivity is to ask whether the animals have what they want. Here, we present a protocol to determine housing preference in the zebrafish (Danio rerio) with respect to the presence/absence of environmental enrichment and access to flowing of water.

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the ...

Behavior

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host microbiome community diversity and alter the microbial community composition. Many diseases such as antibiotic-associated enterocolitis, inflammatory bowel disease, and metabolic disorders have been linked to a disrupted microbiota. The complex interplay between host, microbiome, and antibiotics needs a tractable model for studying host-microbiome interactions. Our freshwater vertebrate fish serves as a useful model for investigating the universal aspects of mucosal microbiome structure and function as well as analyzing consequential host effects from altering the microbial community. Methods include host challenges such as infection by a known fish pathogen, exposure to fecal or soil microbes, osmotic stress, nitrate toxicity, growth analysis, and measurement of gut motility. These techniques demonstrate a flexible and useful model system for rapid determination of host phenotypes.

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

This study involves methods to reveal effects on a model fish host following alteration of the skin and gut microbiome communities&#160;composition by an antibiotic.

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host ...

Immunology and Infection

Optimizing GF Zebrafish Models: Generation, Maintenance, and Microbial Studies

Generation, Maintenance, and Identification of Germ-Free Zebrafish Models from Larvae to Juvenile Stages

Zebrafish serve as valuable models for research on growth, immunity, and gut microbiota due to their genomic similarities with mammals, transparent embryos developed in a relatively clean chorion environment, and extremely rapid development of larvae compared to rodent models. Germ-free (GF) zebrafish (Danio rerio) are crucial for evaluating pollutant toxicity and establishing human-like disease models related to microbial functions. In comparison to conventionally raised (CR) models (fish in common husbandry), GF zebrafish allow for more accurate manipulation of the host microbiota, aiding in determining the causal relationship between microorganisms and hosts. Consequently, they play a critical role in advancing our understanding of these relationships. However, GF zebrafish models are typically generated and researched during the early life stages (from embryos to larvae) due to limitations in immune function and nutrient absorption. This study optimizes the generation, maintenance, and identification of early GF zebrafish models without feeding and with long-term feeding using GF food (such as Artemia sp., brine shrimp). Throughout the process, daily sampling and culture were performed and identified through multiple detections, including plates and 16S rRNA sequencing. The aseptic rate, survival, and developmental indexes of GF zebrafish were recorded to ensure the quality and quantity of the generated models. Importantly, this study provides details on bacterial isolation and infection techniques for GF fish, enabling the efficient creation of GF fish models from larvae to juvenile stages with GF food support. By applying these procedures in biomedical research, scientists can better understand the relationships between intestinal bacterial functions and host health.

Author Spotlight: Establishing Germ-Free Zebrafish for Microbiota-Host Relationship Studies

This protocol outlines the primary steps for obtaining germ-free (GF) fish embryos and maintaining them from larvae until the juvenile stage, including sampling and detecting their sterile status. The use of GF models with infection is important for understanding the role of microbes in host health.

Zebrafish serve as valuable models for research on growth, immunity, and gut microbiota due to their genomic similarities with mammals, transparent ...

Developmental Biology

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and behavioural research. As a vertebrate, zebrafish share considerable genetic sequence similarity with humans and are being used as an animal model for various human disease conditions. The advantages of zebrafish in comparison to other common vertebrate models include high fecundity, low maintenance cost, transparent embryos, and rapid development. Due to the spur of interest in zebrafish research, the need to establish and maintain a productive zebrafish housing facility is also increasing. Although literature is available for the maintenance of a zebrafish laboratory, a concise video protocol is lacking. This video illustrates the protocol for regular housing, feeding, breeding and raising of zebrafish larvae. This process will help researchers to understand the natural behaviour and optimal conditions of zebrafish husbandry and hence troubleshoot experimental issues that originate from the fish husbandry conditions. This protocol will be of immense help to researchers planning to establish a zebrafish laboratory, and also to graduate students who are intending to use zebrafish as an animal model.

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

This protocol outlines regular maintenance and care to maintain optimal conditions for zebrafish husbandry. The video illustrates the protocol for system maintenance, regular housing, feeding, breeding, and raising of zebrafish larvae.

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

Construction of an Affordable and Easy-to-Build Zebrafish Facility

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it virtually impossible to build and maintain typical rodent facilities for research. Zebrafish research has been demonstrated to be a valuable alternative for in vivo research in pharmacology, physiology, development and genetic studies. This article demonstrates that a functional zebrafish facility can be built in an easy and affordable manner. We demonstrate that such a facility could be built in about one working day with minimal tools and expertise. The cost of the 27 1.8 L fish tank zebrafish facility constructed in this study was approximately $1,500. We estimate that the maintenance of an initial working 150 fish colony for 3 months is $1,000. This project involved students, who were introduced to aquaculturing of zebrafish for research proposes.

A Zebrafish facility suitable for breeding and in vivo research is built in an easy and affordable manner. Maintenance is minimal. This facility is ideal for student involvement and independent research.

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it ...

Gentle Isolation of Nuclei from the Brain Tissue of Adult African Turquoise Killifish, a Naturally Short-Lived Model for Aging Research

Studying brain aging at single-cell resolution in vertebrate systems remains challenging due to cost, time, and technical constraints. Here, we demonstrate a protocol to generate single-nucleus RNA sequencing (snRNA-seq) libraries from the brains of the naturally short-lived vertebrate African turquoise killifish Nothobranchius furzeri. The African turquoise killifish has a lifespan of 4-6 months and can be housed in a cost-effective manner, thus reducing cost and time barriers to study vertebrate brain aging. However, tailored protocols are needed to isolate nuclei of sufficient quality for downstream single-cell experiments from the brain of young and aged fish. Here, we demonstrate an empirically optimized protocol for the isolation of high-quality nuclei from the brain of adult African turquoise killifish, a critical step in the generation of high-quality single nuclei omic libraries. Furthermore, we show that the steps to reduce contaminating background RNA are important to clearly distinguish cell types. In summary, this protocol demonstrates the feasibility of studying brain aging in non-traditional vertebrate model organisms.

Here we present a protocol to isolate nuclei from the brains of the short-lived vertebrate model Nothobranchius furzeri for downstream applications such as single-nucleus RNA sequencing or single-nucleus assay for transposase-accessible chromatin with sequencing (ATAC-seq).

Studying brain aging at single-cell resolution in vertebrate systems remains challenging due to cost, time, and technical constraints. Here, we ...

Neuroscience

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems

Health monitoring systems are developed and used in zebrafish research facilities because pathogens of Danio rerio such as Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa have the potential to impair animal welfare and research. The fish are typically analyzed post mortem to detect microbes. The use of sentinels is a suggested way to improve the sensitivity of the surveillance and to reduce the number of animals to sample. The setting of a pre-filtration sentinel tank out of a recirculating system is described. The technique is developed to prevent water pollution and to represent the fish population by a careful selection of age, gender, and strains. In order to use the minimum number of animals, techniques to screen the environment are also detailed. Polymerase Chain Reaction (PCR) on surface sump swabs is used to significantly improve the detection of some prevalent and pathogenic mycobacterial species such as Mycobacterium fortuitum, Mycobacterium haemophilum, and Mycobacterium chelonae. Another environmental method consists of processing the sludge at the bottom of a holding tank or sump to look for P. tomentosa eggs. This is a cheap and fast technique that can be applied in quarantine where a breeding device is submerged into the holding tank of imported animals. Finally, PCR is applied to the sludge sample and A. hydrophila is detected at the sump&#39;s bottom and surface. Generally, these environmental screening techniques applied to these specific pathogens have led to an increased sensitivity compared to the testing of pre-filtration sentinels.

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems

This protocol describes the use of sump swabs and sludge analysis of zebrafish systems, which leads to increased detection compared to the sole use of sentinels to detect pathogens such as Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa. A system to monitor P. tomentosa eggs in quarantine is also proposed.

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

Summary

Explore More Videos

Chapters in this video

A Flow-through Exposure System for Evaluating Suspended Sediments Effects on Aquatic Life

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

A Standardized Protocol for Preference Testing to Assess Fish Welfare

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

Generation, Maintenance, and Identification of Germ-Free Zebrafish Models from Larvae to Juvenile Stages

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

Construction of an Affordable and Easy-to-Build Zebrafish Facility

Gentle Isolation of Nuclei from the Brain Tissue of Adult African Turquoise Killifish, a Naturally Short-Lived Model for Aging Research

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems