Name: a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)
Uploaded: 2018-04-11T14:00:00
Duration: 7 min 58 s
Description: Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

We thank Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar and all the members of the Valenzano lab at the Max Planck Institute for Biology of Ageing for contributing to different aspects of the current killifish husbandry protocol over the years.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

All the authors declare no competing financial and non-financial interests.

We describe a protocol for laboratory culturing of turquoise killifish, including embryo collection, incubation, as well as adult fish housing, breeding, and feeding. Our protocol is specifically targeted to laboratories that conduct research focused on adult fish, in particular for experimental studies on aging and life span. Turquoise killifish can be raised on a standard zebrafish facility; however, important aspects of killifish husbandry differ from standard zebrafish care16. These adjustments include early transition from a brine-shrimp only diet to a diet supplemented with protein-rich blood worm, as well as specific steps in embryo incubation, consisting of a liquid and dry incubation stage.
Critical steps within the protocol include shipping embryos within 8 - 30 &#176;C temperature range. In case of breeding, fecundity depends on feeding frequency and food quality; therefore, we recommend at least two feedings a day per breeding tank to raise embryos yield (see section 5.6.). During embryo bleaching, do not extend embryo incubation in the bleaching solution. This may cause damage to the egg chorion and increased embryo mortality. When incubating embryos with methylene blue, do not prolong incubation of ready-to-hatch embryos for longer than 2 weeks as their viability will be dramatically reduced. For hatching turquoise killifish, low temperature of humic acid solution improves hatching and complete immersion of the embryos in the solution allows synchronized hatching. Not sufficient aeration during the incubation results in high rates of fry not able to fill the gas bladder (&#34;belly-slider&#34; phenotype, see Notes in section 5.1).
Limitation of the protocol for breeding includes the use of the sand substrate which poses challenges to centralized filtration systems and should be replaced by alternative methods in the future. Possible alternatives could be the use of zebrafish breeding tanks. Embryo bleaching could cause major physical-chemical changes in the egg chorion that could result in altered chorion physiology and hatching success. Constant exposure of embryos to methylene blue may induce long-term changes in adult fish physiology. Raising adult fish in individual tanks for survival cohort studies may negatively affect fish behavior and health. However, group housing for survival cohort studies adds significant confounding factors due to the establishment of social dominance and male territories, leading to strict social hierarchies. Therefore, we judge that isolation of male fish for survival studies is a reasonable compromise. Feeding laboratory killifish colonies with live food from un-controlled sources add a risk for external contaminations from parasites and potentially pathogenic microbial communities. In the future, an ad hoc sterile fish feed should be developed.
Future improvements to this protocol will focus on a controlled, non-live diet, which still leads to completing sexual maturation within 3 - 4 weeks. In summary, our protocol offers accessibility to turquoise killifish laboratory culturing to a wide scientific community.

Given their short life span and rapid life cycle, turquoise killifish are rapidly growing as a promising new model organism in biology1,2,3. This species is characterized by a unique life cycle for a teleost, consisting of embryonic diapause, rapid sexual maturation, and an extended post-reproductive life stage4,5. Recent work has contributed to elucidating&#160;the biology of this species both in captivity and in the wild6,7. Turquoise killifish live in seasonal fresh water bodies that form during the rainy season in the African savannah in Zimbabwe and Mozambique. During the dry season, embryos survive in the dry mud in the absence of water by&#160;virtue of a stress-resistant life stage called diapause.
Genetic maps for this species have been generated8,9, and recently their genome has been sequenced and assembled10,11. Several inbred laboratory fish strains have been developed, and transgenesis and genome editing via CRISPR/Cas9 have become available in this species, de facto promoting turquoise killifish as a competitive laboratory vertebrate model organism12,13,14.
Although a laboratory protocol has already been published for this species15, in the present protocol we develop a comprehensive list of experimental laboratory guidelines that are specifically aimed at studies that investigate aging and survival. The present protocol enables researchers already familiar with zebrafish and medaka husbandry to become versed in turquoise killifish husbandry by adopting a minimum number of key adjustments. At the same time, this protocol provides researchers without prior experience in fish husbandry&#160;with the essential tools to raise a thriving turquoise killifish colony.

<table>
	<tbody>
		<tr>
			<td>Probe calibration buffer solution pH=7.0</td>
			<td>Roth</td>
			<td>A518.1</td>
			<td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Probe calibration buffer solution pH=4.0</td>
			<td>Roth</td>
			<td>P712.1</td>
			<td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Conductivity standard</td>
			<td>VWR</td>
			<td>83607.260</td>
			<td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td>
		</tr>
		<tr>
			<td>Easy Strips Test 6in1</td>
			<td>JBL</td>
			<td>2533900</td>
			<td>Test strips for determination chlorine values of system water</td>
		</tr>
		<tr>
			<td>Ammonia Test</td>
			<td>JBL</td>
			<td>2536500</td>
			<td>Test to determine ammonia content of system water</td>
		</tr>
		<tr>
			<td>Red Sea Salt</td>
			<td>Red Sea</td>
			<td></td>
			<td>22 kg bucket</td>
		</tr>
		<tr>
			<td>Sodium hydrogen carbonate</td>
			<td>VWR</td>
			<td>27780.360</td>
			<td></td>
		</tr>
		<tr>
			<td>Humic acid</td>
			<td>Sigma- Aldrich</td>
			<td>53680-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>New HUFA Artemia enrichment</td>
			<td>ZM Systems UK</td>
			<td></td>
			<td>75g bottle</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Roth</td>
			<td>AE64.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrogen peroxide solution</td>
			<td>Sigma- Aldrich</td>
			<td>31642-1L</td>
			<td>30% (w/w)</td>
		</tr>
		<tr>
			<td>Cononut fiber</td>
			<td>Dragon</td>
			<td>ZCS010</td>
			<td></td>
		</tr>
		<tr>
			<td>Whatman paper</td>
			<td>GE healthcare</td>
			<td>3030-690</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol pure</td>
			<td>VWR</td>
			<td>20821.467</td>
			<td>100%</td>
		</tr>
		<tr>
			<td>Silica sand</td>
			<td>local pet shop</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Artemia Eggs Premium Grade</td>
			<td>Sanders</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bloodworm</td>
			<td>local distributor</td>
			<td></td>
			<td>Poseidon Aquakultur Germany</td>
		</tr>
		<tr>
			<td>dNTPs solution mix</td>
			<td>Biolabs</td>
			<td>N04472</td>
			<td>10mM</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>5U/uL</td>
		</tr>
		<tr>
			<td>PCR 10x Buffer</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>NaOH</td>
			<td>Sigma- Aldrich</td>
			<td>S8045-500g</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>Tris-HCl, pH=8.0 solution</td>
			<td>Sigma- Aldrich</td>
			<td>T2694-1L</td>
			<td>1M</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Sigma- Aldrich</td>
			<td>H1758-500mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Aquatic housing system</td>
			<td>Aquaneering</td>
			<td></td>
			<td>Central filtration equipped aquatic system</td>
		</tr>
		<tr>
			<td>Fish tanks</td>
			<td>Aquaneering</td>
			<td></td>
			<td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td>
		</tr>
		<tr>
			<td>Orbital shaker</td>
			<td>VWR</td>
			<td>89032-100</td>
			<td>model 5000</td>
		</tr>
		<tr>
			<td>Microbiological incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>50125882</td>
			<td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Cooling Incubator</td>
			<td>Binder</td>
			<td>9020-0209</td>
			<td>model KT115; for storage embryos in the solid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Hatching incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>51028114</td>
			<td>model OGS180; for embryos hatching, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Leica</td>
			<td></td>
			<td>model M80</td>
		</tr>
		<tr>
			<td>Breeding sand/hatching boxes</td>
			<td>Roth</td>
			<td>1598.1</td>
			<td>1000mL</td>
		</tr>
		<tr>
			<td>Petri dish</td>
			<td>Sarstedt</td>
			<td>82.1473</td>
			<td>92x16mm</td>
		</tr>
		<tr>
			<td>50mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.547.254</td>
			<td></td>
		</tr>
		<tr>
			<td>15mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.554.002</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Plastic Pasteur pipette</td>
			<td>Roth</td>
			<td>EA71.1</td>
			<td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td>
		</tr>
		<tr>
			<td>Serological pipette</td>
			<td>Sarstedt</td>
			<td>86.1689.001</td>
			<td>50mL</td>
		</tr>
		<tr>
			<td>Syringe</td>
			<td>Henke Sass Wolf</td>
			<td>4100-000V0</td>
			<td>10mL</td>
		</tr>
		<tr>
			<td>Metal strainer</td>
			<td></td>
			<td></td>
			<td>fineness &#60;1mm; for embryos collection</td>
		</tr>
		<tr>
			<td>Tweezers</td>
			<td>Dumont</td>
			<td>0508-5/45-PO</td>
			<td>type5/45; for embryos transfer</td>
		</tr>
		<tr>
			<td>25L Brine shrimps hatcher</td>
			<td>Aquaneering</td>
			<td>ZHBS25</td>
			<td>main hatcher</td>
		</tr>
		<tr>
			<td>500mL Brine shrimps hatcher</td>
			<td>JBL</td>
			<td>6106100</td>
			<td>model Artemio 1; backuo hatcher</td>
		</tr>
		<tr>
			<td>Narrow-mesh fish nets</td>
			<td>JBL</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sand beaker</td>
			<td>VWR</td>
			<td>BURK7102-5000</td>
			<td>5000mL</td>
		</tr>
		<tr>
			<td>Brine shrimps separation beaker</td>
			<td>VWR</td>
			<td>BURK7102-2000</td>
			<td>2000mL</td>
		</tr>
		<tr>
			<td>Plastic zipper bag</td>
			<td>Roth</td>
			<td>P279.2</td>
			<td>for dead fish storage</td>
		</tr>
		<tr>
			<td>Pipetboy</td>
			<td>Integra</td>
			<td>155000</td>
			<td>model Pipetboy acu2</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>P-Lab</td>
			<td>P701605</td>
			<td></td>
		</tr>
		<tr>
			<td>Air tubing</td>
			<td>www.zajac.de</td>
			<td>AQ380</td>
			<td>4-6 mm diameter</td>
		</tr>
		<tr>
			<td>1L Glass bottle</td>
			<td>VWR</td>
			<td>215-1595</td>
			<td></td>
		</tr>
		<tr>
			<td>2L Glass bottle</td>
			<td>VWR</td>
			<td>215-1596</td>
			<td></td>
		</tr>
		<tr>
			<td>500mL Squeeze bottle</td>
			<td>Roth</td>
			<td>K665.1</td>
			<td>for fish feeding with brine shrimps</td>
		</tr>
		<tr>
			<td>120 micron brine shrimps strainer</td>
			<td>Florida Aqua Farms</td>
			<td>BB-PC2</td>
			<td>for brine shrimps/bloodworm collection</td>
		</tr>
		<tr>
			<td>Finish filter socks</td>
			<td>Aquaneering</td>
			<td>MFVB025C</td>
			<td>25 micron</td>
		</tr>
		<tr>
			<td>Central filtration fish housing system</td>
			<td></td>
			<td></td>
			<td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td>
		</tr>
	</tbody>
</table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of reference fish model systems, such as zebrafish and medaka. In recent years, an emerging fish &#8211; the turquoise killifish (Nothobranchius furzeri) &#8211; has been adopted by a growing number of research groups in the fields of biology of aging and ecology. With a captive life span of 4 - 8 months, this species is the shortest-lived vertebrate raised in captivity and allows the scientific community to test &#8211; in a short time &#8211; experimental interventions that can lead to alterations of the aging rate and life expectancy. Given the unique biology of this species, characterized by embryonic diapause, explosive sexual maturation, marked morphological and behavioral sexual dimorphism - and their relatively short adult life span -&#160;ad hoc husbandry practices are in urgent demand. This protocol reports a set of key husbandry measures that allow optimal turquoise killifish laboratory care, enabling the scientific community to adopt this species as a powerful laboratory animal model.

Turquoise killifish proper husbandry results in median survival ranging between 12 - 18 weeks in the GRZ strain (e.g. Figure 4A). Variations of median survival depend on diet, feeding frequency, and housing temperature conditions. Poor husbandry results in survival curves presenting increased early mortality and repetitive, sudden drops of survival throughout time, characterized by several inflection points (Figure 4B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg" /> 
Figure 1: Representative embryonic developmental stages with respective incubation substrate. (A) Freshly collected embryos, incubated in methylene blue solution in the incubator at 28 &#176;C. (B) Embryos ready to be transferred to solid medium, either filter paper or coconut fiber. (C) Embryos ready to be hatched, displaying typical golden irises. The scale bar is equal to 1 mm. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg" /> 
Figure 2: Stages of turquoise killifish post-hatching development. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg" /> 
Figure 3: Representative fish ID tag for fish from stage 3 onwards. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg" /> 
Figure 4: Representative survival curve for 70 male turquoise killifish. (A) Typical survival curve for laboratory-raised turquoise killifish. (B) Comparison of survival curves obtained from fish raised under optimal husbandry conditions (black) and poor husbandry (red and blue). The dashed red horizontal line indicates 50% survival, intersecting survival curve at median life span (indicated on the x-axis). <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>ID</td>
			<td colspan="2">Forward primer</td>
			<td colspan="2">Reverse primer</td>
			<td>Size range (bp)</td>
		</tr>
		<tr>
			<td>*NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
		<tr>
			<td>*NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
		<tr>
			<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
		<tr>
			<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
		<tr>
			<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
		<tr>
			<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
		<tr>
			<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
		<tr>
			<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
		<tr>
			<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
		<tr>
			<td>*NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
		<tr>
			<td colspan="6">*- sex determination markers</td>
		</tr>
	</tbody>
</table>
Table 1: Genotyping primers for strain identification.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Laboratory housing of turquoise killifish can be scaled up&#160;to house and efficiently raise thousands of individual fish in a centralized water filtration system, employing the same infrastructure used for standard zebrafish facilities. Here we detail a list of standardized procedures that allow efficient killifish maintenance.

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

Research

JoVE Journal

Biology

Protocol for Mosquito Rearing (A. gambiae)

Protocol for Mosquito Rearing A. gambiae

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night ...

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia (SCG)

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia SCG

The superior cervical ganglia (SCG) in rats are small, glossy, almond-shaped structures that contain sympathetic neurons.  These neurons provide ...

A Protocol for the Production of KLRG1 Tetramer

Killer cell lectin-like receptor G1 (KLRG1) is a type II transmembrane glycoprotein inhibitory receptor belonging to the C type lectin-like superfamily. ...

A Protocol for Computer-Based Protein Structure and Function Prediction

Genome sequencing projects have ciphered millions of protein sequence, which require knowledge of their structure and function to improve the ...

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

Using  recombinant phage as a scaffold to present various protein portions encoded by  a directionally cloned cDNA library to immobilized bait molecules ...

SIVQ-LCM Protocol for the ArcturusXT Instrument

SIVQ-LCM is a new methodology that automates and streamlines the more traditional, user-dependent laser dissection process.&#160;It aims to create an ...

A Protocol for Lentiviral Transduction and Downstream Analysis of Intestinal Organoids

Intestinal crypt-villus structures termed organoids, can be kept in sustained culture three dimensionally when supplemented with the appropriate growth ...

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the ...