Name: generation of first heart field-like cardiac progenitors and ventricular-like cardiomyocytes from human pluripotent stem cells
Uploaded: 2018-06-19T14:00:00.000+00:00
Duration: 8 min 37 s
Description: Watch this Scientific Journal Video about Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells at JoVE.com

We thank members of the Colas lab for helpful discussions and critical reviews of the manuscript. This study was supported by NIH/NIEHS R44ES023521-02 and CIRM DISC2-10110 grants to Dr. Colas.

1. Id1 Virus Preparation and Infection
<ol>
	<li>Generate Id1 overexpressing lentivirus by co-transfecting pCMVDR8.74, pMD2.G, and pCDH-EF1-Id1-PGK-PuroR (Addgene: plasmid #107735) into HEK293T cells. Collect viral particles, filtrate, purify from the supernatant, and store at -80 &#176;C as in Kitamura et al. (2003)19. Alternatively, produce Id1 lentivirus commercially by sending pCDH-EF1-Id1-PGK-PuroR to a lentivirus-producing vendor. 
	Caution: Please follow lentiviral safety regulations and standard operation protocols. 
	Note: IMPORTANT: Optimal virus titer should be at least 108 to 109 Transducing Units/mL (TU/mL).</li>
	<li>Prior to infection, coat one well of a 96 well plate with 50 &#181;l of coating reagent, typically a gelatinous protein mixture secreted by Engelbreth-Holm-Swarm mouse sarcoma cells (see Table of Materials).</li>
	<li>Dissociate one well of pluripotent stem cells grown in a 6 well plate by adding 1 mL of PBS without Ca2+ and Mg2+ and with 0.5 mM EDTA. 
	NOTE: Dissociation time varies from 3&#8211;10 min. When more than 80% of the cells are detached from the bottom of the plate, proceed to next step.</li>
	<li>Collect cell suspension with sterile pipet into 15 mL plastic centrifuge tube.</li>
	<li>Neutralize dissociation reagent with 5 mL of PBS-containing Ca2+ and Mg2+.</li>
	<li>Pellet cells by centrifugation (200 x g for 3 min).</li>
	<li>Remove supernatant and gently flick the tube in order to dislodge the pellet.</li>
	<li>Re-suspend cells in 1 mL of stem cell media.</li>
	<li>Count cells using an automated cell counter following vendor instructions.</li>
	<li>Plate 20,000 viable cells per coated well (96-well plate) in 50 &#181;L of stem cell media supplemented with 2 &#181;M RHO/ROCK pathway inhibitor (see Tables 1 and 2).</li>
	<li>After 24 h, monitor for cell attachment and replace media with 100 &#181;l stem cell media supplemented with 2 &#181;M RHO/ROCK pathway inhibitor and 6 ng/mL hexadimethrine bromide (see Tables 1 and 2), one h prior to lentiviral infection. 
	NOTE: Cells should be firmly attached to the bottom of the plate.</li>
	<li>Thaw Id1-lentivirus on ice.</li>
	<li>Add 3 &#181;L of purified lentivirus per well (virus titer should be between 108 to 109 TU/mL), and then transfer the plate back to cell culture incubator (37 &#176;C, 5% CO2, 20% O2).</li>
	<li>24 h post-viral infection, add 100 &#181;L of fresh stem cell media to infected cells.</li>
	<li>48 h post-lentiviral infection, replace virus containing media with 200 &#181;L of fresh stem cell media supplemented with 1 &#181;g/mL puromycin.</li>
	<li>Refresh media daily with 200 &#181;L of stem cell media supplemented with 1 &#181;g/mL puromycin.</li>
	<li>When cultures reach 80% confluency, dissociate cells using 200 &#181;L of PBS without Ca2+ and Mg2+ + 0.5 mM EDTA (for one well of a 96-well plate).</li>
	<li>Collect cell suspension into a centrifuge tube.</li>
	<li>Neutralize dissociation reagent with 5 mL of PBS-containing Ca2+ and Mg2+.</li>
	<li>Pellet cells by centrifugation (200 x g for 3 min).</li>
	<li>Remove supernatant and gently flick the tube in order to dislodge the pellet.</li>
	<li>Re-suspend cells in 1 mL of stem cell media supplemented with 2 &#181;M RHO/ROCK pathway inhibitor.</li>
	<li>Transfer all cells (1 mL) to a coated well of a 12-well plate.</li>
	<li>After 24 h, monitor for cell attachment to the well and replace media with 1 mL of stem cell media supplemented with 2 &#181;M RHO/ROCK pathway inhibitor and 6 ng/mL hexadimethrine bromide, one h prior to transduction.</li>
	<li>Thaw Id1-lentivirus on ice.</li>
	<li>Add 5 &#181;L of purified virus per well (12-well plate).</li>
	<li>24 h post-lentiviral infection, replace virus containing media with 1 mL of fresh stem cell media supplemented with 3 &#181;g/mL puromycin.</li>
	<li>48 h post lentiviral infection, replace virus containing media with 1 mL of fresh stem cell media supplemented with 6 &#181;g/mL puromycin.</li>
	<li>When cultures reach 80% confluency, dissociate cells using 500 &#181;L of PBS without Ca2+ and Mg2+ and with 0.5 mM EDTA (for one well of a 12-well plate).</li>
	<li>Transfer half (250 &#181;L) of the cell suspension to one well of a coating reagent coated 6-well plate containing 2 mL of stem cell media supplemented with 2 &#181;M RHO/ROCK pathway inhibitor.</li>
	<li>Use the other half (250 &#181;L) of the sample for RNA extraction and qRT-PCR in order to determine lentiviral-mediated Id1 expression levels, as in Colas et al. (2012)4. 
	NOTE: IMPORTANT: If Id1 mRNA expression levels are lower than 0.005 fold of GAPDH expression levels (see Table 3 for qRT-PCR primers), repeat infection process as described above until Id1 expression levels exceed the threshold.</li>
</ol>
2. hPSCsId1 Maintenance
<ol>
	<li>Culture hPSCsId1 in coated 6 well-plates and grow in 3 mL per well of stem cell media supplemented with 6 &#181;g/mL puromycin.</li>
	<li>When hPSCsId1 reach 80% confluency, passage cells as aggregates (1:6 split ratio) using enzyme-free dissociation reagent following vendor guidelines and grow in 3 mL per well of stem cell media supplemented with 6 &#181;g/mL puromycin.</li>
</ol>
3. Preparation of hPSCsId1 for Differentiation
<ol>
	<li>Coat a 12-well plate with 500 &#181;L per well of coating reagent.</li>
	<li>When hPSCsId1 reach 90% confluency dissociate cells by adding 1 mL of PBS without Ca2+ and Mg2+ and with 0.5 mM EDTA per well for 5&#8211;10 min. Check dissociation process every minute, and once 80% of the cells are dissociated from the plate, proceed to the next step.</li>
	<li>Collect cell suspension into a centrifuge tube.</li>
	<li>Neutralize dissociation reagent with 5 mL of PBS-containing Ca2+ and Mg2+.</li>
	<li>Pellet cells by centrifugation (200 x g for 3 min).</li>
	<li>Remove supernatant and gently flick the tube in order to dislodge the pellet.</li>
	<li>Re-suspend cells in 2 mL of stem cell media supplemented with 2 &#181;M RHO/ROCK pathway inhibitor.</li>
	<li>Count cells using an automated cell counter.</li>
	<li>Plate 300,000 cells per well in 1 mL of stem cell media supplemented with 2 &#181;M RHO/ROCK pathway inhibitor and 6 &#181;g/mL puromycin, and transfer plate into tissue culture incubator.</li>
	<li>Refresh media daily with 2 mL of stem cell media supplemented with 6 &#181;g/mL puromycin until cultures reach 90% confluency. At this point, initiate cardiac differentiation (next step).</li>
</ol>
4. Differentiation of hPSCsId1 into First Heart Field-like Cardiac Progenitors (FHF-L CPs)
<ol>
	<li>For 12-well plate format, initiate differentiation (day 0) by replacing stem cell media with 1.5 mL of induction media (Table 1) supplemented with Activin A (100 ng/mL) (see Table 2 for recommended volumes and Activin A concentrations for different plate formats).</li>
	<li>On day 1 (24 h after differentiation is initiated), replace media with 2 mL of induction media without Activin A (per well of a 12-well plate).</li>
	<li>On day 3, replace media with 2 mL of induction media without Activin A (per well of a 12-well plate).</li>
	<li>On day 5, collect FHF-L CPs for cryopreservation (next step). 
	NOTE: IMPORTANT: Cryopreservation is preferred at this point, as it enables to uncouple cardiac progenitor generation from subsequent cardiomyocyte production and biobank large batches of cells. Note that alternatively, day 5 FHF-L CPs can be passed to a freshly coated plate to continue differentiation, please refer to Steps 5.1&#8211;5.5 to passFHF-L CPs and then proceed to Step 6.5 for differentiation.</li>
</ol>
5. Cryopreservation of FHF-L CPs
<ol>
	<li>Aspirate all media from wells containing day 5 FHF-L CPs and quickly add 1 mL of warm (37 &#176;C) 1x enzyme-containing dissociation reagent (see Table of Materials). Place plate in the tissue culture incubator.</li>
	<li>After 1 min, shake plate side to side in the incubator.</li>
	<li>After 2 min (total time), remove plate from the incubator and add 1 mL of 10% FBS media.</li>
	<li>Gently pipet cells up and down with a 5 mL pipet to facilitate cell detachment from the plate.</li>
	<li>Collect cell suspension to a centrifuge tube and pellet cells by centrifugation at 200 x g for 3 min</li>
	<li>Re-suspend cell pellet in 2 mL of cryopreservation reagent.</li>
	<li>Count cells using an automated cell counter.</li>
	<li>Add cryopreservation reagent (see Table of Materials) at a sufficient volume to cryopreserve cells at desired concentration (typically 5&#8211;10 x 106&#160;cells/mL).</li>
	<li>Transfer cells to cryopreservation vials and place vials in cooling device (1 &#176;C/min) and place cooling device in -80 &#176;C freezer overnight.</li>
	<li>After 24 h, transfer frozen vials to liquid nitrogen for long term storage. 
	NOTE: The protocol can be paused here.</li>
</ol>
6. FHF-L CP Differentiation Into Ventricular-like Cardiomyocytes
<ol>
	<li>Transfer day 5 FHF-L CPs frozen vials from liquid nitrogen storage into dry ice container.</li>
	<li>Place vials in 37 &#176;C water bath for 2 to 3 min, until cell suspension is thawed completely. 
	NOTE: IMPORTANT: The thawing process is time-sensitive. Exposing cells to the cryopreservation media for an excessive amount of time (i.e., 10 min) will decrease cell viability.</li>
	<li>Transfer cells to 15 or 50 mL centrifuge tube, depending on the number of thawed vials.</li>
	<li>Dispense dropwise (5 drops every 30 seconds) pre-warmed (37 &#176;C) cardiogenic media (Table 1) to cell solution. Continue this process until a 1:3 cryopreservation media:cardiogenic media ratio is reached. At this point, increase the cardiogenic media addition rate until a 1:10 cryopreservation media:cardiogenic media ratio is reached. 
	NOTE: IMPORTANT: Rapid osmolarity changes will increase cell death during the thawing process; therefore, dropwise addition of cardiogenic media as described above is highly recommended.</li>
	<li>Centrifuge cell suspension and pellet cells by centrifugation (200 x g for 3 min).</li>
	<li>Remove supernatant and gently flick centrifuge tube to dislodge cell pellet.</li>
	<li>Re-suspend cells with cardiogenic media supplemented with 2 &#181;M RHO/ROCK pathway inhibitor. 
	Note: Cell viability can vary from thaw to thaw, and, in general, &#62; 65% viability predicts good plating efficiency.</li>
	<li>Dilute concentrated cell suspension with cardiogenic media supplemented with 2 &#181;M RHO/ROCK pathway inhibitor to obtain the desired cell concentration for plating (see Table 2 for different plate formats). 
	NOTE: IMPORTANT: Note that cardiac differentiation efficiency may decline if cells are seeded too sparsely.</li>
	<li>Seed cells on plate.</li>
	<li>Keep plate in the tissue culture hood for 20 min before transferring it to tissue culture incubator.</li>
	<li>On day 6 of differentiation, monitor cell attachment. 
	NOTE: Cardiac progenitors are cryopreserved on day 5 of the differentiation. 24 h after thawing the cells would be on day 6 of the differentiation. 
	NOTE: The presence of floating (dead) cells is common.</li>
	<li>On day 7, aspirate 50% of the media and replace with an equal amount of fresh cardiogenic media. 
	NOTE: The addition of RHO/ROCK pathway inhibitor to the cardiogenic media is not necessary after this point.</li>
	<li>Replace 50% of the media with cardiogenic media every other day.</li>
	<li>Note spontaneous beating that appears between day 11 and day 13.</li>
	<li>On day 15, quantify cardiac differentiation efficiency by immunofluorescence using DAPI (nucleus stain) and ACTC1 (pan-cardiac marker).</li>
</ol>
7. Passing and Maintenance of Ventricular-like Cardiomyocytes
NOTE: By day 14&#8211;16, a monolayer of spontaneously contracting ventricular-like cardiomyocytes should be obtained. At this point, it is suggested to dissociate and re-plate cardiomyocytes in order to homogenize the culture and prevent cells from detaching from the plate.
<ol>
	<li>Aspirate all media from wells and quickly add 1 mL of pre-warmed (37 &#176;C) 1x enzyme-containing dissociation reagent. 
	NOTE: 1x enzyme-containing dissociation reagent volumes vary depending on plate format, but should completely cover the bottom of the well surface.</li>
	<li>Transfer plate into a tissue culture incubator.</li>
	<li>Gently shake plate side to side every 2 min inside the incubator to accelerate the detachment process.</li>
	<li>After 5&#8211;15 min, when 80% to 100% of the cells are detached from the bottom of the plate, remove the plate from the incubator and inhibit 1x enzyme-containing dissociation reagent activity by adding an equal volume of 10% FBS media. 
	NOTE: Incubation time with 1x enzyme-containing dissociation for this process will vary from batch-to-batch.</li>
	<li>Collect cell suspension to a centrifuge tube.</li>
	<li>Mix cell suspension with pipet and count cells using an automated cell counter.</li>
	<li>Dilute cell suspension to desired cell concentration (see Table 2 for different plate formats) with maintenance media supplemented with 2 &#181;M RHO/ROCK pathway inhibitor.</li>
	<li>After seeding cardiomyocytes onto the plate, distribute the cells evenly and allow the cells to attach for 10&#8211;20 min before transferring plate to tissue culture incubator.</li>
	<li>24 h after re-plating, monitor cell attachment and recovery. 
	NOTE: The presence of floating (dead) cells is common. 48&#8211;72 h after re-plating, cardiomyocyte should resume spontaneous contraction.</li>
	<li>To maintain cardiomyocyte culture, replace 50% of the media with the maintenance media every other day until use of ventricular-like cardiomyocytes for subsequent experiments.</li>
</ol>

<ol>
	<li>Chong, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic-stem-cell-derived+cardiomyocytes+regenerate+non-human+primate+hearts.">Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts.</a> Nature. 510, 273-277 (2014).</li><li>Kodo, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iPSC-derived+cardiomyocytes+reveal+abnormal+TGF-beta+signalling+in+left+ventricular+non-compaction+cardiomyopathy.">iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy.</a> Nature cell biology. 18, 1031-1042 (2016).</li><li>Kim, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+arrhythmogenic+right+ventricular+dysplasia+with+patient-specific+iPSCs.">Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs.</a> Nature. 494, 105-110 (2013).</li><li>Colas, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+microRNA+screening+identifies+let-7+and+mir-18+as+regulators+of+germ+layer+formation+during+early+embryogenesis.">Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis.</a> Genes &amp; development. 26, 2567-2579 (2012).</li><li>Cunningham, T. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Id+genes+are+essential+for+early+heart+formation.">Id genes are essential for early heart formation.</a> Genes &amp; development. , (2017).</li><li>McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serum-free+generation+of+multipotent+mesoderm+(Kdr+)+progenitor+cells+in+mouse+embryonic+stem+cells+for+functional+genomics+screening.">Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening.</a> Current protocols in stem cell biology. , 13 (2012).</li><li>McKeithan, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+automated+platform+for+assessment+of+congenital+and+drug-induced+arrhythmia+with+hipsc-derived+cardiomyocytes.">An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes.</a> Frontiers in physiology. 8, 766 (2017).</li><li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+tyrosine+kinase+inhibitor+cardiotoxicity+with+human+induced+pluripotent+stem+cells.">High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells.</a> Science translational medicine. 9, (2017).</li><li>Burridge, P. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+defined+generation+of+human+cardiomyocytes.">Chemically defined generation of human cardiomyocytes.</a> Nature methods. 11, 855-860 (2014).</li><li>Kattman, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+optimization+of+activin/nodal+and+BMP+signaling+promotes+cardiac+differentiation+of+mouse+and+human+pluripotent+stem+cell+lines.">Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines.</a> Cell stem cell. 8, 228-240 (2011).</li><li>Laflamme, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocytes+derived+from+human+embryonic+stem+cells+in+pro-survival+factors+enhance+function+of+infarcted+rat+hearts.">Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts.</a> Nature biotechnology. 25, 1015-1024 (2007).</li><li>Lian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Robust+cardiomyocyte+differentiation+from+human+pluripotent+stem+cells+via+temporal+modulation+of+canonical+Wnt+signaling.">Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling.</a> Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).</li><li>Willems, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecule-mediated+TGF-beta+type+II+receptor+degradation+promotes+cardiomyogenesis+in+embryonic+stem+cells.">Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells.</a> Cell stem cell. 11, 242-252 (2012).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+cardiovascular+progenitor+cells+develop+from+a+KDR++embryonic-stem-cell-derived+population.">Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population.</a> Nature. 453, 524-528 (2008).</li><li>Palpant, N. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generating+high-purity+cardiac+and+endothelial+derivatives+from+patterned+mesoderm+using+human+pluripotent+stem+cells.">Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells.</a> Nature protocols. 12, 15-31 (2017).</li><li>DeLaughter, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+resolution+of+temporal+gene+expression+during+heart+development.">Single-cell resolution of temporal gene expression during heart development.</a> Developmental cell. 39, 480-490 (2016).</li><li>Liu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+genetics+of+hypoplastic+left+heart+syndrome.">The complex genetics of hypoplastic left heart syndrome.</a> Nature genetics. 49, 1152-1159 (2017).</li><li>Corrado, D., Link, M. S., Calkins, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arrhythmogenic+right+ventricular+cardiomyopathy.">Arrhythmogenic right ventricular cardiomyopathy.</a> New England journal of medicine. 376, 1489-1490 (2017).</li><li>Kitamura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrovirus-mediated+gene+transfer+and+expression+cloning:+powerful+tools+in+functional+genomics.">Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics.</a> Experimental hematology. 31, 1007-1014 (2003).</li></ol>

The authors have nothing to disclose.

For successful differentiations, make sure to closely follow instructions listed above. In addition, here we highlight key parameters that strongly influence differentiation outcomes. Before starting a differentiation, the following three morphological parameters should be observed: a stem morphology of hPSCsId1, a high cellular compaction and a high confluence (&#62;90%) of the culture at day 0. In that regard, optimal differentiation conditions are best created by plating dissociated hPSCsId1 as single cells and allowing them to form tightly clustered monolayers that grow to ~90% confluence during the course of 2 to 3 days. Conversely, if hPSCId1 cultures show poor cell and colony morphology, low colony compaction and the presence of large areas of differentiation within the culture, successful FHF-L CP differentiation are unlikely.
Media volume and Activin A concentrations are critical parameters of FHF-L CP differentiation and plate format-dependent (see Table 2). Also note that optimal Activin A concentrations may vary depending on used hPSC line and may require concentration optimization.
Id1 mRNA levels in hPSCs are crucial to efficiently promote FHF-L CP. Suboptimal Id1 levels will fail to produce robust FHF-L CP differentiation and massive cell death by day 1 of differentiation will be observed. The relative expression ratio of Id1-to-GAPDH must exceed 0.005 to promote efficient differentiation. Continued selection using higher doses of puromycin (6&#8211;10 &#181;g/mL) is recommended in order to retain high levels of lentiviral-mediated Id1 expression. An evaluation of Id1 mRNA levels every 10 passages is recommended.
Plating densities of day 5 FHF-L CPsis also a critical parameter for cardiac differentiation efficiency. If day 5 FHF-L CPs are plated at low densities, the relative cardiac yield will decrease. Optimal plating densities are listed in Table 2 and are plate format-dependent.
The main limitation for this protocol is the use of lentiviral-mediated Id1 overexpression to promoteFHF-L CP differentiation which may restrict the therapeutic use of resulting progenitors and ventricular-like cardiomyocytes. Also, since lentiviruses may integrate at sites that could potentially affect hPSC maintenance and/or developmental potential, stemness of hPSCsId1 colonies should be monitored by evaluating stem gene expression and observing morphological signs of differentiation. Note that overexpressing Id1 using non-integrative vectors would overcome this limitation and is currently being investigated in our laboratory.
One convenient feature of this method is the simplicity of the differentiation protocol as it only requires one cytokine, Activin A, to generate FHF-L CPs from hPSCsId1.&#160;In comparison, other protocols 9,10,11,12,13,14,15 require complex sequences of combinations of cytokines and/or small molecules in order to promote and maintain cardiac differentiation. In addition, this protocol uniquely describes a convenient cryopreservation step which enables to uncouple FHF-L CP generation from subsequent cardiomyocyte production. This feature enables to biobank large batches of FHF-L CPs and to quickly generate cardiomyocytes from frozen progenitors, as cardiac differentiation resumes from day 5 upon thawing. This strategy allows to gain 1 to 2 weeks of time as compared to starting cardiac differentiation from hPSCs. In addition, and most importantly, this protocol is the first protocol to date to generate cardiac progenitors of defined heart field origin, while other protocols9,10,11,12,13,14,15 remain undefined in that regard.
In summary, this protocol outlines a robust and scalable method to produce large amounts (&#62;108&#8211;109) of developmentally-relevant FHF-L CPs and ventricular-like cardiomyocytes. In turn, resulting cells can be used to identify novel regulatory pathways controlling cardiac differentiation and physiology, and for regenerative and disease modeling purposes.

Large scale production of human pluripotent stem cells (hPSCs)-derived cardiac progenitors and cardiomyocytes is a pre-requisite for stem cell-based therapies1, disease modeling2,3 and the rapid characterization of novel pathways regulating cardiac differentiation4,5,6 and physiology7,8. Although a number of studies9,10,11,12,13,14,15 have previously described highly efficient cardiac differentiation protocols from hPSCs, none has addressed the heart field origin of resulting cardiomyocytes, in spite of the identification of significant molecular differences between left (first heart field) and right (second heart field) ventricular cardiomyocytes16 and the existence of heart field-specific congenital heart diseases; i.e., hypoplastic left heart syndrome17 or arrhythmogenic right ventricular dysplasia18. Thus, the generation of cardiac progenitors and cardiomyocytes of defined heart field origin from hPSCs is becoming a necessity in order to increase their relevance as therapeutic and disease modeling tools.
This protocol relies on the constitutive overexpression of Id1, a recently identified5 first heart field-specifying cue that in combination with Activin A, is both necessary and sufficient to initiate cardiogenesis in hPSCs. Notably, Cunningham et al. (2017)5 show that Id1-induced progenitors specifically express first heart field (HCN4, TBX5) but not second heart field markers (SIX2, ISL1) as they undergo cardiac differentiation. In addition, the authors also show that transgenic mouse embryos lacking the entire Id family of genes (Id1-4), develop without forming first heart field cardiac progenitors, while more medial and posterior cardiac progenitors (second heart field) can still form, thereby suggesting that Id proteins are essential to initiate first heart field cardiogenesis in vivo. Conveniently, Id1-induced progenitors can be cryopreserved and spontaneously differentiate into cardiomyocytes displaying ventricular-like characteristics, including ventricular-specific markers (IRX4, MYL2) expression and ventricular-like action potentials.
Here we describe a simple and scalable method to generate first heart field-like (FHF-L) cardiac progenitors and ventricular-like cardiomyocytes from Id1 overexpressing hPSCs. An important feature of this protocol is the possibility to uncouple cardiac progenitor generation from subsequent cardiomyocyte production using a convenient cryopreservation step. In summary, this protocol details the necessary steps to (1) generate Id1-overexpressing hPSCs, (2) generate FHF-L cardiac progenitors from hPSCs, (3) cryopreserve resulting progenitors, and (4) resume FHF-L cardiac progenitor differentiation and generate highly enriched (&#62;70&#8211;90%) beating ventricular-like cardiomyocytes.

<table><tbody><tr><td>ACTC1 antibody</td><td>Sigma</td><td>A7811</td><td></td></tr><tr><td>Activin A</td><td>Stem Cell Technologies</td><td>Hu Recom Activin A</td><td></td></tr><tr><td>Antibiotic Antimycotic (Anti-Anti)</td><td>Thermo Fisher Scientific</td><td>15240062</td><td></td></tr><tr><td>B27 supplement</td><td>Thermo Fisher Scientific</td><td>17504044</td><td></td></tr><tr><td>B27 supplement w/o - insulin</td><td>Thermo Fisher Scientific</td><td>A1895601</td><td></td></tr><tr><td>B27 supplement w/o - vitamin A</td><td>Thermo Fisher Scientific</td><td>12587001</td><td></td></tr><tr><td>CDH5 antibody</td><td>R&amp;amp;D Systems</td><td>AF938</td><td></td></tr><tr><td>CryoStor CS10</td><td>Stem Cell Technologies</td><td>7930</td><td>Cryopreservation reagent</td></tr><tr><td>DMEM high Glucose</td><td>Mediatech</td><td>10-013-CV&amp;nbsp;</td><td></td></tr><tr><td>DPBS w/ Ca &amp;amp; Mg</td><td>Corning</td><td>21-030-CV</td><td></td></tr><tr><td>EDTA</td><td>Thermo Fisher Scientific</td><td>15575-038</td><td></td></tr><tr><td>FBS</td><td>VWR</td><td>89510-186</td><td></td></tr><tr><td>FluoVolt membrane potential kit&amp;nbsp;&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>F10488</td><td>For optical action potential acquisition, please refer to McKeithan et al. 2017</td></tr><tr><td>KnockOut Serum Replacement</td><td>Gibco</td><td>10828010</td><td></td></tr><tr><td>Matrigel, Growth Factor Reduced</td><td>Corning</td><td>356231</td><td>Coating reagent</td></tr><tr><td>mTeSR1 media kit</td><td>Stem Cell Technologies</td><td>5850</td><td></td></tr><tr><td>PBS w/o Ca &amp;amp; Mg</td><td>Corning</td><td>21-040-CV</td><td></td></tr><tr><td>Penicillin-Streptomycin</td><td>Gibco</td><td></td><td></td></tr><tr><td>Puromycin&amp;nbsp;</td><td>Acros</td><td>227422500</td><td></td></tr><tr><td>ReLeSR</td><td>Stem Cell Technologies</td><td>5872</td><td>Enzyme-free dissociation reagent</td></tr><tr><td>RPMI 1640</td><td>Thermo Fisher Scientific</td><td>11875-093</td><td></td></tr><tr><td>TAGLN antibody</td><td>Abcam</td><td>ab14106</td><td></td></tr><tr><td>Thiazovivin</td><td>Stem Cell Technologies</td><td>72254</td><td>RHO/ROCK pathway inhibitor</td></tr><tr><td>TrypLE Express</td><td>Thermo Fisher Scientific</td><td>12605 -010</td><td>1X enzyme-containing dissociation reagent</td></tr><tr><td>Tyrodes solution mix packets&amp;nbsp;&amp;nbsp;</td><td>Sigma</td><td>T2145-10X1L</td><td>(For optical action potential acquisition, please refer to McKeithan et al. 2017)</td></tr></tbody></table>

generation of first heart field-like cardiac progenitors and ventricular-like cardiomyocytes from human pluripotent stem cells

The generation of large amounts of functional human pluripotent stem cells-derived cardiac progenitors and cardiomyocytes of defined heart field origin is a pre-requisite for cell-based cardiac therapies and disease modeling. We have recently shown that Id genes are both necessary and sufficient to specify first heart field progenitors during vertebrate development. This differentiation protocol leverages these findings and uses Id1 overexpression in combination with Activin A as potent specifying cues to produce first heart field-like (FHF-L) progenitors. Importantly, resulting progenitors efficiently differentiate (~70&#8211;90%) into ventricular-like cardiomyocytes. Here we describe a detailed method to 1) generate Id1-overexpressing hPSCs and 2) differentiate scalable quantities of cryopreservable FHF-L progenitors and ventricular-like cardiomyocytes.

Generation of hPSCsId1lines 
hPSCs are infected with a lentivirus mediating Id1 overexpression (Figure 1A). Once hPSCId1 are generated, transgene expression is quantified by qRT-PCR (Figure 1B). Only hPSCId1 lines expressing Id1 mRNA at levels greater than 0.005 fold of that of GAPDH should be used for differentiation.
hPSCsId1 Maintenance and Preparation for Differentiation 
Optimal culture conditions are necessary and critical for successful first heart field-like cardiac progenitor differentiation (Figure 2A). hPSCId1 cultures should be monitored daily for stem morphology maintenance and continuous proliferation. Differentiation should be initiated when tightly packed stem cell colonies reach &#62;90% confluency (Figure 2B). If differentiation is initiated prior to optimal confluency, cell death is enhanced and differentiation efficiency may decline (Figure 2C). Similarly, overgrown cultures will perform poorly (Figure 2D).
Generation of First Heart Field-Like Cardiac Progenitors (FHF-L CPs) From hPSCsId1 
On day 1 (24 h post differentiation initiation), cells should be monitored to observe loss of stem morphology (cells appear flatter and darker than stem cells). Note that cell death is common during the first day of differentiation, but cell confluence should be maintained at &#62;75% (Figure 2E). If after 24 h of differentiation, 50% or more of the covered surface area is lost, cells should be discarded.
On day 3, differentiating cells should remain clustered and have filled gaps created during the initial 24 h time period (Figure 2F). Flat cells growing independently are indicative of suboptimal differentiation conditions.
On day 4, optimal differentiation should show continued expansion and coverage of the plate.
On day 5, cells are harvested and cryopreserved. Optimal differentiations should result in tightly connected cell clusters with homogeneous morphology appearance (Figure 2G). Note that low density clusters of flat cells mark a suboptimal differentiation outcome. See Table 2 for the average yield of day 5 cardiac progenitors per well in various culture formats.
Generation of Ventricular-like Cardiomyocytes From FHF-L CPs 
Day 5 FHF-L CPs are thawed at plate format-dependent densities described in Table 2, in order to maximize their cardiac differentiation potential (Figure 3A and Table 2). The viability after thawing needs to be monitored. Generally, viability ranges from 70&#8211;80%. If the viability is below 60%, the yield of cardiomyocytes would be affected.
On day 6 (24 h after resuming differentiation), FHF-L CPs should cover &#62;90% of the available surface area and appear as a homogenous single layer of cells (Figure 3B). Low confluence on day 6 will reduce FHF-L CPs differentiation into cardiomyocytes.
Resulting cardiomyocytes start to beat by day 11&#8211;13 of differentiation (Figure 3C and&#160;Movie 1). During the day 14&#8211;16 replating process, see Table 2 for the average yield of cardiomyocytes per well in various culture formats. Differentiation efficiency is typically assessed by immunofluorescence for cardiac (ACTC1), fibroblast (TAGLN) and vascular endothelial markers (CDH5) and nuclear (DAPI) markers. Lineage quantification is performed using automated imaging and fluorescence quantification, as in Cunningham et al. (2017)5 (Figure 3D-E). Subtype characterization of resulting cardiomyocytes is performed by qRT-PCR (Figure 3F) and action potential transient analysis using kinetic imaging and voltage sensing probes (Figure 3G and Movie 2). Fluorescence quantification for the voltage probe and resulting action potential trace analysis (Figure 3H) is performed as described in McKeithan et al. (2017)7.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57688/57688fig1.jpg" /> 
Figure 1:&#160;Generation of hPSCId1&#160;lines.&#160;(A) Schematic representation of the hPSCsId1 generation protocol. (B) Examples of qRT-PCR results showing representative Id1 mRNA levels generated by lentiviral-mediated expression from distinct lines of hPSCId1 including one hESC line and two lines of hPSC lines. Dashed line represents Id1 expression threshold, below which hPSCId1 lines need to undergo an additional cycle of Id1-lentivirus infection. &#34;p&#34; indicates the passage number. The number in the parenthesis indicates the number of rounds of Id1-lentiviral infection. Error bars represent standard deviation of experiments performed in triplicate. <a href="/files/ftp_upload/57688/57688fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57688/57688fig2.jpg" /> 
Figure 2:&#160;Generation of First Heart Field-Like Cardiac Progenitors (FHF-L CPs) Differentiation From hPSCId1. (A) Schematic representation of the FHF-L CP generation protocol. Representative bright field pictures of hPSCId1 (day 0) at optimal (B), sub-confluent (yellow arrowheads indicate the void regions between cells) (C) and over-confluent (D) densities. Representative bright-field pictures of differentiating hPSCId1 at day 1, 3 and 5 respectively (E), (F), (G).Scale bar = 100 &#181;m. <a href="/files/ftp_upload/57688/57688fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57688/57688fig3.jpg" /> 
Figure 3:&#160;Generation of Ventricular-like Cardiomyocyte From FHF-L CPs.&#160;(A)Schematic representation of the ventricular-like cardiomyocyte generation protocol. (B) Bright field image of day 6 differentiation cells (one day post-thawing). (C) Bright field image of a day 12 beating culture. (D) Representative immunofluorescence image of day 15 cultures (384-well plate format). ACTC1 marks cardiomyocytes, TAGLN: fibroblasts/smooth muscle, CDH5: vascular endothelial cells, and DAPI: nuclei (shown in the inset). (E) Lineage quantification of day 15 cultures. (F) qRT-PCR data time course expression from day 5 to day 25 of ventricular-specific markers (IRX4 and MYL2) and pan-cardiac marker (MYL7). (G) Representative action potential trace from ventricular-like cardiomyocytes at day 25 of differentiation. (H) Action potential duration measurements (APD50 and APD90) of resulting ventricular-like cardiomyocytes (n = 12). Error bars represent standard deviation of experiments performed in quadruplicate (unless otherwise noted). Scale bars = 100 &#181;m. RFU, relative fluorescence unit. <a href="/files/ftp_upload/57688/57688fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Medium</td>
			<td>Base medium</td>
			<td>Additive</td>
		</tr>
		<tr>
			<td>Stem Cell Media</td>
			<td>mTesR1&#160;</td>
			<td>n/a</td>
		</tr>
		<tr>
			<td>Induction Media</td>
			<td>RPMI 1640 Medium</td>
			<td>B-27 Serum-Free Supplement without insulin, 1x</td>
		</tr>
		<tr>
			<td>Induction Media</td>
			<td>RPMI 1640 Medium</td>
			<td>Puromycin, 6 &#181;g/ml</td>
		</tr>
		<tr>
			<td>Induction Media</td>
			<td>RPMI 1640 Medium</td>
			<td>Penicillin-Streptomycin, 1x</td>
		</tr>
		<tr>
			<td>Cardiogenic Media</td>
			<td>RPMI 1640 Medium</td>
			<td>B-27 Serum-Free Supplement, 1x</td>
		</tr>
		<tr>
			<td>Cardiogenic Media</td>
			<td>RPMI 1640 Medium</td>
			<td>Penicillin-Streptomycin, 1x</td>
		</tr>
		<tr>
			<td>Maintenance Media</td>
			<td>RPMI 1640 Medium</td>
			<td>B-27 Serum-Free Supplement, 1x</td>
		</tr>
		<tr>
			<td>Maintenance Media</td>
			<td>RPMI 1640 Medium</td>
			<td>KnockOut Serum Replacement, 2%</td>
		</tr>
		<tr>
			<td>Maintenance Media</td>
			<td>RPMI 1640 Medium</td>
			<td>Penicillin-Streptomycin, 1x</td>
		</tr>
	</tbody>
</table>
Table 1: Media components (see Table of Materials for base media and additives).
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td></td>
			<td>384 well</td>
			<td>96 well</td>
			<td>12 well</td>
			<td>6 well</td>
			<td>100 mm</td>
			<td>150 mm</td>
		</tr>
		<tr>
			<td>Coating volume (per well)</td>
			<td>10 &#181;L</td>
			<td>50 &#181;L</td>
			<td>500 &#181;L</td>
			<td>1 mL</td>
			<td>5 mL</td>
			<td>10 mL</td>
		</tr>
		<tr>
			<td>Medium volume 
			(per well)</td>
			<td>100 &#181;L</td>
			<td>300 &#181;L</td>
			<td>2 mL</td>
			<td>5 mL</td>
			<td>12 mL</td>
			<td>30 mL</td>
		</tr>
		<tr>
			<td>Differentiation day 0 activin A concentration (ng/mL)</td>
			<td></td>
			<td></td>
			<td>100</td>
			<td>100</td>
			<td>100</td>
			<td>300</td>
		</tr>
		<tr>
			<td>Cardiac progenitor 
			day 5 yield 
			(cells/well)</td>
			<td></td>
			<td></td>
			<td>1.0 &#8211; 1.2 x 105</td>
			<td>2.5 &#8211; 3.0 x 105</td>
			<td>1.0-1.5 x 107</td>
			<td>2.0 &#8211; 3.0 x 107</td>
		</tr>
		<tr>
			<td>Cardiac progenitor day 5 replating or thawing density (cells/well)</td>
			<td>2.0 x 104</td>
			<td></td>
			<td>7.5 x 105</td>
			<td>4.5 x 106</td>
			<td>8.0&#160; x 106</td>
			<td>2.2 x 107</td>
		</tr>
		<tr>
			<td>Ventricular-like cardiomyocyte 
			day 14&#8211;16 yield 
			(cells/well)</td>
			<td>2.0 &#8211; 5.0 x 104</td>
			<td></td>
			<td>0.8 &#8211; 1.2 x 106</td>
			<td>3.5 &#8211; 5.0 x 106</td>
			<td>0.8 &#8211; 1.2 x 107</td>
			<td>1.8 &#8211; 2.5 x 107</td>
		</tr>
		<tr>
			<td>Ventricular-like cardiomyocyte replating density 
			(cells/well)</td>
			<td>2.5 x 104</td>
			<td></td>
			<td>1.0 x 106</td>
			<td>4.5 x 106</td>
			<td>1.0 x 107</td>
			<td>2.2 x 107</td>
		</tr>
	</tbody>
</table>
Table 2: Scalable differentiation parameters (coating volume, medium volume, Activin A concentration, yields, replating densities).
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Gene Name</td>
			<td>Gene Bank Accession</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>GAPDH</td>
			<td>NM_001256799</td>
			<td>F: GGAGCGAGATCCCTCCAAAAT 
			R: GGCTGTTGTCATACTTCTCATGG</td>
		</tr>
		<tr>
			<td>mouse Id1</td>
			<td>NM_010495</td>
			<td>F: CCTAGCTGTTCGCTGAAGGC 
			R: CTCCGACAGACCAAGTACCAC</td>
		</tr>
		<tr>
			<td>IRX4</td>
			<td>NM_016358</td>
			<td>F: GGCTCCCCAGTTCTTGATGG 
			R: TAGACCGGGCAGTAGACCG</td>
		</tr>
		<tr>
			<td>MYL2</td>
			<td>NM_000432</td>
			<td>F: TTGGGCGAGTGAACGTGAAAA 
			R: CCGAACGTAATCAGCCTTCAG</td>
		</tr>
		<tr>
			<td>MYL7</td>
			<td>NM_021223</td>
			<td>F: GCCCAACGTGGTTCTTCCAA 
			R: CTCCTCCTCTGGGACACTC</td>
		</tr>
	</tbody>
</table>
Table 3: qRT-PCR primer sequences.
<img alt="Movie 1" src="/files/ftp_upload/57688/57688movie1.jpg" /> 
Movie 1: Bright field recording (100 frames/s) of day 15 cardiomyocytes where spontaneous contractions can be observed. <a href="https://www.jove.com/files/ftp_upload/57688/Movie_s1.avi" target="_blank">Please click here to view this video. (Right-click to download.)</a>
<img alt="Movie 2" src="/files/ftp_upload/57688/57688movie2.jpg" /> 
Movie 2: Kinetic imaging (100 frames/s) of voltage-sensitive fluorescent probe in day 25 id1-induced ventricular-like cardiomyocytes. <a href="https://www.jove.com/files/ftp_upload/57688/Movie_s2.avi" target="_blank">Please click here to view this video. (Right-click to download.)</a>

Watch this Scientific Journal Video about Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells at JoVE.com

Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells

Here we describe a scalable method, using a simple combination of Activin A and lentivirus-mediated Id1-overexpression, to generate first heart field-like cardiac progenitors and ventricular-like cardiomyocytes from human pluripotent stem cells.

The generation of large amounts of functional human pluripotent stem cells-derived cardiac progenitors and cardiomyocytes of defined heart field origin is ...

generation-first-heart-field-like-cardiac-progenitors-ventricular

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

6.9K Views.  Sanford Burnham Prebys Medical Discovery Institute. Here we describe a scalable method, using a simple combination of Activin A and lentivirus-mediated Id1-overexpression, to generate first heart field-like cardiac progenitors and ventricular-like cardiomyocytes from human pluripotent stem cells.

Video: Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells

Derivation of Cardiac Progenitor Cells from Embryonic Stem Cells

Cardiac progenitor cells (CPCs) have the capacity to differentiate into cardiomyocytes, smooth muscle cells (SMC), and endothelial cells and hold great promise in cell therapy against heart disease. Among various methods to isolate CPCs, differentiation of embryonic stem cell (ESC) into CPCs attracts great attention in the field since ESCs can provide unlimited cell source. As a result, numerous strategies have been developed to derive CPCs from ESCs. In this protocol, differentiation and purification of embryonic CPCs from both mouse and human ESCs is described. Due to the difficulty of using cell surface markers to isolate embryonic CPCs, ESCs are engineered with fluorescent reporters activated by CPC-specific cre recombinase expression. Thus, CPCs can be enriched by fluorescence-activated cell sorting (FACS). This protocol illustrates procedures to form embryoid bodies (EBs) from ESCs for CPC specification and enrichment. The isolated CPCs can be subsequently cultured for cardiac lineage differentiation and other biological assays. This protocol is optimized for robust and efficient derivation of CPCs from both mouse and human ESCs.

In this protocol, derivation of cardiac progenitor cells from both mouse and human embryonic stem cells will be illustrated. A major strategy in this protocol is to enrich cardiac progenitor cells with flow cytometry using fluorescent reporters engineered into the embryonic stem cell lines.

Cardiac progenitor cells (CPCs) have the capacity to differentiate into cardiomyocytes, smooth muscle cells (SMC), and endothelial cells and hold great ...

Electrophysiological Analysis of human Pluripotent Stem Cell-derived Cardiomyocytes (hPSC-CMs) Using Multi-electrode Arrays (MEAs)

Cardiomyocytes can now be derived with high efficiency from both human embryonic and human induced-Pluripotent Stem Cells (hPSC). hPSC-derived cardiomyocytes (hPSC-CMs) are increasingly recognized as having great value for modeling cardiovascular diseases in humans, especially arrhythmia syndromes. They have also demonstrated relevance as in vitro systems for predicting drug responses, which makes them potentially useful for drug-screening and discovery, safety pharmacology and perhaps eventually for personalized medicine. This would be facilitated by deriving hPSC-CMs from patients or susceptible individuals as hiPSCs. For all applications, however, precise measurement and analysis of hPSC-CM electrical properties are essential for identifying changes due to cardiac ion channel mutations and/or drugs that target ion channels and can cause sudden cardiac death. Compared with manual patch-clamp, multi-electrode array (MEA) devices offer the advantage of allowing medium- to high-throughput recordings. This protocol describes how to dissociate 2D cell cultures of hPSC-CMs to small aggregates and single cells and plate them on MEAs to record their spontaneous electrical activity as field potential. Methods for analyzing the recorded data to extract specific parameters, such as the QT and the RR intervals, are also described here. Changes in these parameters would be expected in hPSC-CMs carrying mutations responsible for cardiac arrhythmias and following addition of specific drugs, allowing detection of those that carry a cardiotoxic risk.

Electrophysiological Analysis of human Pluripotent Stem Cell-derived Cardiomyocytes hPSC-CMs Using Multi-electrode Arrays MEAs

Electrophysiological characterization of cardiomyocytes derived from human Pluripotent Stem Cells (hPSC-CMs) is crucial for cardiac disease modeling and for determining drug responses. This protocol provides the necessary information to dissociate and plate hPSC-CMs on multi-electrode arrays, measure their field potential, and a method for analyzing QT and RR intervals.

Cardiomyocytes can now be derived with high efficiency from both human embryonic and human induced-Pluripotent Stem Cells (hPSC). hPSC-derived ...

In Vitro Differentiation of Human Mesenchymal Stem Cells into Functional Cardiomyocyte-like Cells

Myocardial infarction and the subsequent ischemic cascade result in the extensive loss of cardiomyocytes, leading to congestive heart failure, the leading cause of mortality worldwide. Mesenchymal stem cells (MSCs) are a promising option for cell-based therapies to replace current, invasive techniques. MSCs can differentiate into mesenchymal lineages, including cardiac cell types, but complete differentiation into functional cells has not yet been achieved. Previous methods of differentiation were based on pharmacological agents or growth factors. However, more physiologically relevant strategies can also enable MSCs to undergo cardiomyogenic transformation. Here, we present a differentiation method using MSC aggregates on cardiomyocyte feeder layers to produce cardiomyocyte-like contracting cells.
Human umbilical cord perivascular cells (HUCPVCs) have been shown to have a greater differentiation potential than commonly investigated MSC types, such as bone marrow MSCs (BMSCs). As an ontogenetically younger source, we investigated the cardiomyogenic potential of first-trimester (FTM) HUCPVCs compared to older sources. FTM HUCPVCs are a novel, rich source of MSCs that retain their in utero immunoprivileged properties when cultured in vitro. Using this differentiation protocol, FTM and term HUCPVCs achieved significantly increased cardiomyogenic differentiation compared to BMSCs, as indicated by the increased expression of cardiomyocyte markers (i.e., myocyte enhancer factor 2C, cardiac troponin T, heavy chain cardiac myosin, signal regulatory protein &#945;, and connexin 43). They also maintained significantly lower immunogenicity, as demonstrated by their lower HLA-A expression and higher HLA-G expression. Applying aggregate-based differentiation, FTM HUCPVCs showed increased aggregate formation potential and generated contracting cells clusters within 1 week of co-culture on cardiac feeder layers, becoming the first MSC type to do so. 
Our results demonstrate that this differentiation strategy can effectively harness the cardiomyogenic potential of young MSCs, such as FTM HUCPVCs, and suggests that in vitro pre-differentiation could be a potential strategy to increase their regenerative efficacy in vivo.

In Vitro Differentiation of Human Mesenchymal Stem Cells into Functional Cardiomyocyte-like Cells

Here, we present a method to efficiently harness the cardiac differentiation potential of young sources of human mesenchymal stem cells in order to generate functional, contracting, cardiomyocyte-like cells in vitro.

Myocardial infarction and the subsequent ischemic cascade result in the extensive loss of cardiomyocytes, leading to congestive heart failure, the leading ...

In Vitro Generation of Heart Field-specific Cardiac Progenitor Cells

Pluripotent stem cells offer great potential for understanding heart development and disease and for regenerative medicine. While recent advances in developmental cardiology have led to generating cardiac cells from pluripotent stem cells, it is unclear if the two cardiac fields - the first and second heart fields (FHF and SHF) &#8212; are induced in pluripotent stem cells systems. To address this, we generated a protocol for in vitro specification and isolation of heart field-specific cardiac progenitor cells. We used embryonic stem cells lines carrying Hcn4-GFP and Tbx1-Cre; Rosa-RFP reporters of the FHF and the SHF, respectively, and live cell immunostaining of the cell membrane protein Cxcr4, a SHF marker. With this approach, we generated progenitor cells which recapitulate the functional properties and transcriptome of their in vivo counterparts. Our protocol can be utilized to study early specification and segregation of the two heart fields and to generate chamber-specific cardiac cells for heart disease modelling. Since this is an in vitro organoid system, it may not provide precise anatomical information. However, this system overcomes the poor accessibility of gastrulation-stage embryos and can be upscaled for high-throughput screens.

The purpose of this method is to generate heart field-specific cardiac progenitor cells in vitro in order to study the progenitor cell specification and functional properties, and to generate chamber specific cardiac cells for heart disease modelling.

Pluripotent stem cells offer great potential for understanding heart development and disease and for regenerative medicine. While recent advances in ...

Generating Self-Assembling Human Heart Organoids Derived from Pluripotent Stem Cells

The ability to study human cardiac development in health and disease is highly limited by the capacity to model the complexity of the human heart in vitro. Developing more efficient organ-like platforms that can model complex in vivo phenotypes, such as organoids and organs-on-a-chip, will enhance the ability to study human heart development and disease. This paper describes a protocol to generate highly complex human heart organoids (hHOs) by self-organization using human pluripotent stem cells and stepwise developmental pathway activation using small molecule inhibitors. Embryoid bodies (EBs) are generated in a 96-well plate with round-bottom, ultra-low attachment wells, facilitating suspension culture of individualized constructs.
The EBs undergo differentiation into hHOs by a three-step Wnt signaling modulation strategy, which involves an initial Wnt pathway activation to induce cardiac mesoderm fate, a second step of Wnt inhibition to create definitive cardiac lineages, and a third Wnt activation step to induce proepicardial organ tissues. These steps, carried out in a 96-well format, are highly efficient, reproducible, and produce large amounts of organoids per run. Analysis by immunofluorescence imaging from day 3 to day 11 of differentiation reveals first and second heart field specifications and highly complex tissues inside hHOs at day 15, including myocardial tissue with regions of atrial and ventricular cardiomyocytes, as well as internal chambers lined with endocardial tissue. The organoids also exhibit an intricate vascular network throughout the structure and an external lining of epicardial tissue. From a functional standpoint, hHOs beat robustly and present normal calcium activity as determined by Fluo-4 live imaging. Overall, this protocol constitutes a solid platform for in vitro studies in human organ-like cardiac tissues.

Here, we describe a protocol to create developmentally relevant human heart organoids (hHOs) efficiently using human pluripotent stem cells by self-organization. The protocol relies on the sequential activation of developmental cues and produces highly complex, functionally relevant human heart tissues.

The ability to study human cardiac development in health and disease is highly limited by the capacity to model the complexity of the human heart in ...

Biochemistry

Generation and Expansion of Human Cardiomyocytes from Patient Peripheral Blood Mononuclear Cells

Generating patient-specific cardiomyocytes from a single blood draw has attracted tremendous interest in precision medicine on cardiovascular disease. Cardiac differentiation from human induced pluripotent stem cells (iPSCs) is modulated by defined signaling pathways that are essential for embryonic heart development. Numerous cardiac differentiation methods on 2-D and 3-D platforms have been developed with various efficiencies and cardiomyocyte yield. This has puzzled investigators outside the field as the variety of these methods can be difficult to follow. Here we present a comprehensive protocol that elaborates robust generation and expansion of patient-specific cardiomyocytes from peripheral blood mononuclear cells (PBMCs). We first describe a high-efficiency iPSC reprogramming protocol from a patient&#39;s blood sample using non-integration Sendai virus vectors. We then detail a small molecule-mediated monolayer differentiation method that can robustly produce beating cardiomyocytes from most human iPSC lines. In addition, a scalable cardiomyocyte expansion protocol is introduced using a small molecule (CHIR99021) that could rapidly expand patient-derived cardiomyocytes for industrial- and clinical-grade applications. At the end, detailed protocols for molecular identification and electrophysiological characterization of these iPSC-CMs are depicted. We expect this protocol to be pragmatic for beginners with limited knowledge on cardiovascular development and stem cell biology.

Here, we present a protocol to robustly generate and expand human cardiomyocytes from patient peripheral blood mononuclear cells.

Generating patient-specific cardiomyocytes from a single blood draw has attracted tremendous interest in precision medicine on cardiovascular disease. ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Biology

Generation, High-Throughput Screening, and Biobanking of Human-Induced Pluripotent Stem Cell-Derived Cardiac Spheroids

Human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are of paramount importance for human cardiac disease modeling and therapeutics. We recently published a cost-effective strategy for the massive expansion of hiPSC-CMs in two dimensions (2D). Two major limitations are cell immaturity and a lack of three-dimensional (3D) arrangement and scalability in high-throughput screening (HTS) platforms. To overcome these limitations, the expanded cardiomyocytes form an ideal cell source for the generation of 3D cardiac cell culture and tissue engineering techniques. The latter holds great potential in the cardiovascular field, providing more advanced and physiologically relevant HTS. Here, we describe an HTS-compatible workflow with easy scalability for the generation, maintenance, and optical analysis of cardiac spheroids (CSs) in a 96-well-format. These small CSs are essential to fill the gap present in current in vitro disease models and/or generation for 3D tissue engineering platforms. The CSs present a highly structured morphology, size, and cellular composition. Furthermore, hiPSC-CMs cultured as CSs display increased maturation and several functional features of the human heart, such as spontaneous calcium handling and contractile activity. By automatization of the complete workflow, from the generation of CSs to functional analysis, we increase intra- and inter-batch reproducibility as demonstrated by high-throughput (HT) imaging and calcium handling analysis. The described protocol allows modeling of cardiac diseases and assessing drug/therapeutic effects at the single-cell level within a complex 3D cell environment in a fully automated HTS workflow. In addition, the study describes a straightforward procedure for long-term preservation and biobanking of whole-spheroids, thereby providing researchers the opportunity to create next-generation functional tissue storage. HTS combined with long-term storage will substantially contribute to translational research in a wide range of areas, including drug discovery and testing, regenerative medicine, and the development of personalized therapies.

Presented here is a set of protocols for the generation and cryopreservation of cardiac spheroids (CSs) from human-induced pluripotent stem cell-derived cardiomyocytes cultured in a high-throughput, multidimensional format. This three-dimensional model functions as a robust platform for disease modeling, high-throughput screenings, and maintains its functionality after cryopreservation.

Human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are of paramount importance for human cardiac disease modeling and therapeutics. We ...

Bioengineering

Generation of Human Cardiomyocytes: A Differentiation Protocol from Feeder-free Human Induced Pluripotent Stem Cells

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is essential first to generate functional human cardiomyocytes (CMs). The use of these cells in drug discovery and toxicology studies would also be highly beneficial, allowing new pharmacological molecules for the treatment of cardiac disorders to be validated pre-clinically on cells of human origin. Of the possible sources of CMs, induced pluripotent stem (iPS) cells are among the most promising, as they can be derived directly from readily accessible patient tissue and possess an intrinsic capacity to give rise to all cell types of the body 1. Several methods have been proposed for differentiating iPS cells into CMs, ranging from the classical embryoid bodies (EBs) aggregation approach to chemically defined protocols 2,3. In this article we propose an EBs-based protocol and show how this method can be employed to efficiently generate functional CM-like cells from feeder-free iPS cells.

Pluripotent stem cells, either embryonic or induced pluripotent stem (iPS) cells, constitute a valuable source of human differentiated cells, including cardiomyocytes. Here, we will focus on cardiac induction of iPS cells, showing how to use them to obtain functional human cardiomyocytes through an embryoid bodies-based protocol.

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is ...

Generation of Ventricular-Like HiPSC-Derived Cardiomyocytes and High-Quality Cell Preparations for Calcium Handling Characterization

Human induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) provide a valuable human source for studying the basic science of calcium (Ca2+) handling and signaling pathways as well as high-throughput drug screening and toxicity assays. Herein, we provide a detailed description of the methodologies used to generate high-quality iPSC-CMs that can consistently reproduce molecular and functional characteristics across different cell lines. Additionally, a method is described to reliably assess their functional characterization through the evaluation of Ca2+ handling properties. Low oxygen (O2) conditions, lactate selection, and prolonged time in culture produce high-purity and high-quality ventricular-like cardiomyocytes. Similar to isolated adult rat cardiomyocytes (ARCMs), 3-month-old iPSC-CMs exhibit higher Ca2+ amplitude, faster rate of Ca2+ reuptake (decay-tau), and a positive lusitropic response to &#946;-adrenergic stimulation compared to day 30 iPSC-CMs. The strategy is technically simple, cost-effective, and reproducible. It provides a robust platform to model cardiac disease and for the large-scale drug screening to target Ca2+ handling proteins.

Here we describe and validate a method to consistently generate robust human induced pluripotent stem cell-derived cardiomyocytes and characterize their function. These techniques may help in developing mechanistic insight into signaling pathways, provide a platform for large-scale drug screening, and reliably model cardiac diseases.

Human induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) provide a valuable human source for studying the basic science of calcium (Ca2+) ...

Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells

Summary

Explore More Videos

Chapters in this video

Derivation of Cardiac Progenitor Cells from Embryonic Stem Cells

Electrophysiological Analysis of human Pluripotent Stem Cell-derived Cardiomyocytes (hPSC-CMs) Using Multi-electrode Arrays (MEAs)

In Vitro Differentiation of Human Mesenchymal Stem Cells into Functional Cardiomyocyte-like Cells

In Vitro Generation of Heart Field-specific Cardiac Progenitor Cells

Generating Self-Assembling Human Heart Organoids Derived from Pluripotent Stem Cells

Generation and Expansion of Human Cardiomyocytes from Patient Peripheral Blood Mononuclear Cells

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

Generation, High-Throughput Screening, and Biobanking of Human-Induced Pluripotent Stem Cell-Derived Cardiac Spheroids

Generation of Human Cardiomyocytes: A Differentiation Protocol from Feeder-free Human Induced Pluripotent Stem Cells

Generation of Ventricular-Like HiPSC-Derived Cardiomyocytes and High-Quality Cell Preparations for Calcium Handling Characterization