USDA is an equal opportunity provider and employer. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information, and does not imply recommendation or endorsement by the U.S. Department of Agriculture. The Brazilian agency FAPESP (grant 2014/50981-0) financially supported this work; LGVF is funded with a fellowship from FAPESP (2017/06731-8 and 2019/20302-8). The funders had no role in study design, data collection and analysis, decision to publish, or manuscript preparation. The authors also thank Hannah Hill and Alexander Grimes from the USDA Visual Services for filming and editing the video protocol.

1. Protospacer definition and plasmid construction
NOTE: In this section, the first step of selecting appropriate protospacers for constructing the sgRNA and further ligation into pMaOri.dCas9, is described (Figure 1). This protospacer sequence comprises of a 20 nucleotides sequence against the desired target.
<ol>
	<li>Obtain the nucleotide sequence of the gene of interest for silencing at GenBank (https://www.ncbi.nlm.nih.gov/genbank). Submit it to the CHOPCHOP webserver (http://chopchop.cbu.uib.no/), with parameters defined for&#160;Streptococcus pyogenes Cas9 and protospacer adjacent motif NGG after selecting the &#34;Fasta Target&#34;. Define the parameters to &#34;CRISPR/Cas9&#34; and PAM (protospacer adjacent motif) NGG.</li>
	<li>Based on the results obtained, select protospacers with the best score possible (green arrow), that are located as close as possible to the 5&#180;end of the coding region and, most importantly, are contained in the template (minus) strand since the sgRNA must pair to the coding strand of the gene for complete gene silencing. 
	NOTE: The NGG motif is not included in the final sgRNA sequence.</li>
	<li>Use the lipL32 promoter to express the single guide RNA that contains a variable 20 nucleotide sequence at the 5&#39; end and a conserved dCas9 scaffold sequence. Merge the 20-nt sequence, termed protospacer, to the lipL32 promoter (at its 5&#180; end) and sgRNA scaffold (3&#39;end) (Figure 1B). 
	NOTE: For a well-defined lipL32 promoter, utilize the promoter region comprising -334 to the TSS (Transcription Start Site, based on Zhukova et al.9). Check the Supplementary File for the final sgRNA cassette.</li>
	<li>Generate the sgRNA cassette by sequential PCR5 or have it synthesized by a commercial provider.</li>
	<li>After obtaining the cassette, ligate it into pMaOri.dCas9 plasmid at the XmaI restriction site at both ends (cccggg)4.
	<ol>
		<li>Digest both the sgRNA cassette and pMaOri.dCas9 plasmid with XmaI restriction enzyme and proceed to ligation (Figure 1B).</li>
		<li>Perform the cloning steps in the dT auxotrophic E. coli strain &#960;110, due to the pMaOri11 (and by extension, pMaOri.dCas9) origin of replication, R6K-gamma. 
		&#8203;NOTE: For a detailed protocol for ligation and clone selection, refer to previous publications by Fernandes and Nascimento12. sgRNA-guided dCas9 will bind to the coding strand of the selected gene of interest and, therefore, will obstruct RNA polymerase elongation (Figure 1C), resulting in gene silencing.</li>
	</ol>
	</li>
</ol>
2. Leptospira transformation by conjugation
NOTE: A graphical scheme of this step is presented in Figure 2. To make HAN media and HAN plates, refer to Hornsby et al.13 and Fernandes et al.5.
<ol>
	<li>Grow pathogenic Leptospira cells at 29 or 37 &#176;C in HAN media13 under agitation by diluting a saturated culture in fresh HAN at 1:100; typically, L. interrogans serovar Copenhageni strain Fiocruz L1-130 takes 4-6 days to reach the appropriate cell density.
	<ol>
		<li>Ensure cultures reach an O.D. of 0.2-0.4 at 420 nm (2 to 5 x 108 cells/mL) before using for conjugation. 
		NOTE: Since HAN media changes color as cell densities increase (due to phenol red contained in DMEM media), centrifuge (4,000 x g, 15 min, room temperature) 1 mL of the culture media to remove leptospires and apply supernatant as a blank for measuring the O.D.</li>
	</ol>
	</li>
	<li>Transform the conjugative E. coli strain &#946;2163, auxotrophic for Diaminopimelic acid (DAP), with the plasmid pMaOri.dCas9 containing the sgRNA cassette. For E. coli transformation, use either heat-shock protocols or electroporation. Include transformation with the plasmid pMaOri.dCas9 with no sgRNA cassette as a control.
	<ol>
		<li>For heat-shock transformation, mix the plasmid DNA (100 ng) with chemically competent E. coli cells and incubate on ice for 30 min. Perform heat shock at 42 &#176;C for 90 s and place it again on ice for 5 min. Recover the cells by adding 1 mL of LB media, incubate at 37 &#176;C for 1 h and proceed to the plating.</li>
		<li>For electroporation, use electrocompetent cells mixed with 100 ng of plasmid DNA. Use the following parameters for pulse: 1.8 kV, 100 &#937;, and 25 &#181;F. Recover the cells as explained above.</li>
		<li>Plate the transformed donor E. coli cells in LB agar medium supplemented with Diaminopimelic acid (DAP) (0.3 mM) and spectinomycin (40 &#956;g/mL) to select for plasmids.</li>
	</ol>
	</li>
	<li>For conjugation, select one colony from each plate one day before the day of conjugation (which is determined by monitoring the O.D. of cultures of leptospires).
	<ol>
		<li>Select one colony of E. coli &#946;2163 from the empty pMaOri.dCas9, and one from pMaOri.dCas9sgRNA plates. Allow them to grow overnight in 10 mL of LB plus DAP and spectinomycin at 37 &#176;C.</li>
		<li>The next day, dilute the saturated cultures 1:100 in 10 mL of fresh LB plus DAP (do not include the antibiotic here) until OD420nm of 0.2-0.4. Normally, it takes 2-3 h for E. coli to reach these densities.</li>
	</ol>
	</li>
	<li>Inside a BSL2 biosafety hood, assemble a filtration apparatus by placing a 25 mm diameter, 0.1 &#181;m pore size, mixed cellulose esters membrane filter on the top of the glass base. Place a 15 mL glass funnel on the top and hold both pieces with spring clamps. Connect the glass to a vacuum pump and add the cultures to the funnel for filtration.</li>
	<li>Add 5 mL of Leptospira culture to the funnel. Add a volume of E. coli to constitute the 1:1 proportion based on the OD420nm values of both cultures. Turn on the vacuum pump and concentrate cells by filtration. After cell concentration in the membrane filter, carefully retrieve it. Ensure medium is filtered through the membrane. 
	NOTE: Filtration takes 5 to 10 min.</li>
	<li>Place the filter on a commercially available EMJH plate (see Table of Materials) supplemented with DAP (0.3 mM). Ensure that bacteria side is up. Incubate the plates at 29 &#176;C for 24 h. 
	NOTE: If HAN or supplemented in-house EMJH14 plates are used, E. coli can proliferate and overcome the intended 1:1 proportion, which in turn can decrease conjugation efficiency5.</li>
	<li>After 24 h, recover the filters from the plates and place each individual filter in a 50 mL conical tube.</li>
	<li>Use 1 mL of liquid HAN medium to release the cells from the filter surface by extensive pipetting and vortexing.</li>
	<li>Visualize the recovered mixed bacterial solutions by dark field microscopy to check for cell viability and motility, and Leptospira:E. coli proportions. 
	NOTE: At this stage, equivalent numbers of E. coli and Leptospira can be seen.</li>
	<li>Spread 100-200 &#956;L of this culture onto HAN plates containing 0.4% inactivated rabbit serum and 40 &#956;g/mL spectinomycin. Incubate plates at 37 &#176;C in a 3% CO2 atmosphere. 
	&#8203;NOTE: Normally, L. interrogans serovar Copenhageni strain Fiocruz L1-130 cells form colonies in 5-7 days on control plates and in 8-10 days on spectinomycin plates. At this stage, E. coli will not grow since they are auxotrophic for DAP.</li>
	<li>As a control, dilute cultures at 104 leptospires/mL and add 100 &#956;L onto plates without antibiotic, for monitoring leptospiral growth.</li>
</ol>
3. Colony selection and transconjugant growth and validation
NOTE: Colonies should be apparent by day 10. However, they are not too easy to visualize. Normally at this time point, HAN plates are a bit opaque because of the dried cells that were spread and Leptospira colonies can appear as a transparent halo against the whitish background. It is recommended to view the plates at different angles to achieve different light incidence, therefore, making the colonies more apparent. At longer incubation times, colonies can acquire a denser appearance, and in this case, they present as milky halos against a dark background.
<ol>
	<li>Add 100 &#956;L of liquid HAN media to each 1.5 mL microtube to recover mutants. Take at least 3 colonies from each plate.
	<ol>
		<li>With the aid of a micropipette tip, &#34;dig&#34; the agar to retrieve the colonies from the plates since leptospiral colonies can be subsurface. 
		NOTE: Agar is expected to be taken along at this stage. Colonies should be taken from control plates containing empty pMaOri.dCas9 plasmid, and plates with leptospires containing plasmids expressing both dCas9 and single guide RNA, designed for the target gene.</li>
		<li>Dispense the collected colony in 100 &#956;L of HAN media in a 1.5 mL microtube and vigorously homogenize. At this stage, ensure maximal break of the agar integrity to release cells. Vortex the suspension for 10 s.</li>
	</ol>
	</li>
	<li>Visualize the recovered cells by dark field microscopy at a 200-400x magnification by adding a 5 &#181;L drop onto a glass slide and cover the samples immediately with a coverslip.
	<ol>
		<li>Confirm the presence of live and viable leptospires recovered from the colonies.</li>
		<li>After visualization and confirmation of viable leptospires, transfer 100 &#956;L of cells to liquid HAN media containing 40 &#956;g/mL spectinomycin.</li>
	</ol>
	</li>
	<li>After growth in liquid HAN media, evaluate the cultures for the presence of the plasmid with primer pMaOri2 F (ACGCAATGTATCGATACCGAC) and R (ATAGGTGAAGTAGGCCCACCC), which recognize the region that flanks the sgRNA cassette.
	<ol>
		<li>Collect 200 &#956;L of culture, centrifuge (4,000 x g, 15 min), discard the supernatant, and resuspend the resulting pellet in 20 &#956;L of water.</li>
		<li>Use this suspension as a template for additional PCR, without the need for DNA extraction12. 
		NOTE: Cells with pMaOri.dCas9 will render an amplicon of 281 bp, compared to those containing the plasmids with the sgRNA cassette which will render an amplicon of 723 bp.</li>
	</ol>
	</li>
	<li>For confirmation of gene silencing, perform an immunoblot utilizing cell extracts from transconjugants containing only pMaOri.dCas9 (negative control) and pMaOri.dCas9sgRNA.
	<ol>
		<li>Apply the equivalent of 5 x 107 cells per lane of the sodium dodecyl sulfate (SDS) polyacrylamide gel.</li>
		<li>Electrotransfer proteins to a membrane for incubation with appropriate antibodies. Besides the antibody against the target gene for silencing, use another one for loading control.</li>
	</ol>
	</li>
	<li>Keep the mutant cultures in HAN media plus spectinomycin for maintaining the plasmid. If no antibiotics are applied to the media, complete gene silencing can be observed for at least three passages5.</li>
</ol>

<ol>
	<li>Bharti, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leptospirosis:+A+zoonotic+disease+of+global+importance.">Leptospirosis: A zoonotic disease of global importance.</a> Lancet Infectious Disease. 3 (12), 757-771 (2003).</li><li>Costa, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+morbidity+and+mortality+of+Leptospirosis:+A+systematic+review.">Global morbidity and mortality of Leptospirosis: A systematic review.</a> PLoS Neglected Tropical Disease. 9 (9), 0003898 (2015).</li><li>Shapiro, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas9-based+gene+drive+platform+for+genetic+interaction+analysis+in+Candida+albicans.">A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans.</a> Nature Microbiology. 3 (1), 73-82 (2018).</li><li>Fernandes, L. G. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+silencing+based+on+RNA-guided+catalytically+inactive+Cas9+(dCas9):+a+new+tool+for+genetic+engineering+in+Leptospira.">Gene silencing based on RNA-guided catalytically inactive Cas9 (dCas9): a new tool for genetic engineering in Leptospira.</a> Science Reports. 9 (1), 1839 (2019).</li><li>Fernandes, L. G. V., Hornsby, R. L., Nascimento, A. L. T. O., Nally, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+manipulation+of+pathogenic+Leptospira:+CRISPR+interference+(CRISPRi)-mediated+gene+silencing+and+rapid+mutant+recovery+at+37+C.">Genetic manipulation of pathogenic Leptospira: CRISPR interference (CRISPRi)-mediated gene silencing and rapid mutant recovery at 37 C.</a> Science Reports. 11 (1), 1768 (2021).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Qi, L. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repurposing+CRISPR+as+an+RNA-guided+platform+for+sequence-specific+control+of+gene+expression.">Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression.</a> Cell. 152 (5), 1173-1183 (2013).</li><li>Choudhary, E., Thakur, P., Pareek, M., Agarwal, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+silencing+by+CRISPR+interference+in+mycobacteria.">Gene silencing by CRISPR interference in mycobacteria.</a> Nature Communication. 6, 6267 (2015).</li><li>Zhukova, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+transcriptional+start+site+mapping+and+sRNA+identification+in+the+pathogen.">Genome-wide transcriptional start site mapping and sRNA identification in the pathogen.</a> Frontiers in Cell and Infectious Microbiology. 7, 10 (2017).</li><li>Demarre, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+family+of+mobilizable+suicide+plasmids+based+on+broad+host+range+R388+plasmid+(IncW)+and+RP4+plasmid+(IncPalpha)+conjugative+machineries,+and+their+cognate+Escherichia+coli+host+strains.">A new family of mobilizable suicide plasmids based on broad host range R388 plasmid (IncW) and RP4 plasmid (IncPalpha) conjugative machineries, and their cognate Escherichia coli host strains.</a> Research in Microbiology. 156 (2), 245-255 (2005).</li><li>Pappas, C. J., Benaroudj, N., Picardeau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+replicative+plasmid+vector+allows+efficient+complementation+of+pathogenic+Leptospira+strains.">A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.</a> Applied Environmental Microbiology. 81 (9), 3176-3181 (2015).</li><li>Fernandes, L. G. V., Nascimento, A. L. T. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+gene+silencing+in+Leptospira+biflexa+by+RNA-guided+catalytically+inactive+Cas9+(dCas9).">Specific gene silencing in Leptospira biflexa by RNA-guided catalytically inactive Cas9 (dCas9).</a> Methods in Molecular Biology. 2134, 109-122 (2020).</li><li>Hornsby, R. L., Alt, D. P., Nally, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+propagation+of+leptospires+at+37+&#176;C+directly+from+the+mammalian+host.">Isolation and propagation of leptospires at 37 &#176;C directly from the mammalian host.</a> Science Reports. 10 (1), 9620 (2020).</li><li>Haake, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hamster+model+of+leptospirosis.">Hamster model of leptospirosis.</a> Current Protocols in Microbiology. , (2006).</li><li>Nascimento, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+genomics+of+two+Leptospira+interrogans+serovars+reveals+novel+insights+into+physiology+and+pathogenesis.">Comparative genomics of two Leptospira interrogans serovars reveals novel insights into physiology and pathogenesis.</a> Journal of Bacteriology. 186 (7), 2164-2172 (2004).</li><li>Nascimento, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+features+of+Leptospira+interrogans+serovar+Copenhageni.">Genome features of Leptospira interrogans serovar Copenhageni.</a> Brazillian Journal of Medical Biology Research. 37 (4), 459-477 (2004).</li><li>Ren, S. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+physiological+and+pathogenic+features+of+Leptospira+interrogans+revealed+by+whole-genome+sequencing.">Unique physiological and pathogenic features of Leptospira interrogans revealed by whole-genome sequencing.</a> Nature. 422 (6934), 888-893 (2003).</li><li>Bulach, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+reduction+in+Leptospira+borgpetersenii+reflects+limited+transmission+potential.">Genome reduction in Leptospira borgpetersenii reflects limited transmission potential.</a> Proceedings of the National Academy of Science U. S. A. 103 (39), 14560-14565 (2006).</li><li>Picardeau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+saprophyte+Leptospira+biflexa+provides+insights+into+the+evolution+of+Leptospira+and+the+pathogenesis+of+leptospirosis.">Genome sequence of the saprophyte Leptospira biflexa provides insights into the evolution of Leptospira and the pathogenesis of leptospirosis.</a> PLoS One. 3 (2), 1607 (2008).</li><li>Fernandes, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=OmpL1+is+an+extracellular+matrix-+and+plasminogen-interacting+protein+of+Leptospira+spp.">OmpL1 is an extracellular matrix- and plasminogen-interacting protein of Leptospira spp.</a> Infections and Immunity. 80 (10), 3679-3692 (2012).</li><li>Fernandes, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leptospira+spp.:+Novel+insights+into+host-pathogen+interactions.">Leptospira spp.: Novel insights into host-pathogen interactions.</a> Veterinary Immunology and Immunopathology. 176, 50-57 (2016).</li><li>Castiblanco-Valencia, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leptospiral+immunoglobulin-like+proteins+interact+with+human+complement+regulators+factor+H,+FHL-1,+FHR-1,+and+C4BP.">Leptospiral immunoglobulin-like proteins interact with human complement regulators factor H, FHL-1, FHR-1, and C4BP.</a> Journal of Infectious Diseases. 205 (6), 995-1004 (2012).</li><li>Choy, H. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multifunctional+LigB+adhesin+binds+homeostatic+proteins+with+potential+roles+in+cutaneous+infection+by+pathogenic+Leptospira+interrogans.">The multifunctional LigB adhesin binds homeostatic proteins with potential roles in cutaneous infection by pathogenic Leptospira interrogans.</a> PLoS One. 6 (2), 16879 (2011).</li><li>Siqueira, G. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+recombinant+LIC10508+is+a+plasma+fibronectin,+plasminogen,+fibrinogen+and+C4BP-binding+protein+of+Leptospira+interrogans.">The recombinant LIC10508 is a plasma fibronectin, plasminogen, fibrinogen and C4BP-binding protein of Leptospira interrogans.</a> Pathogen and Diseases. 74 (2), (2016).</li><li>Teixeira, A. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Features+of+two+new+proteins+with+OmpA-like+domains+identified+in+the+genome+sequences+of+Leptospira+interrogans.">Features of two new proteins with OmpA-like domains identified in the genome sequences of Leptospira interrogans.</a> PLoS One. 10 (4), 0122762 (2015).</li><li>Kochi, L. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+of+two+novel+putative+proteins+of+Leptospira+interrogans+with+E-cadherin,+plasminogen+and+complement+components+with+potential+role+in+bacterial+infection.">The interaction of two novel putative proteins of Leptospira interrogans with E-cadherin, plasminogen and complement components with potential role in bacterial infection.</a> Virulence. 10 (1), 734-753 (2019).</li><li>Murray, G. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+transposon+mutagenesis+in+pathogenic+Leptospira+species.">Genome-wide transposon mutagenesis in pathogenic Leptospira species.</a> Infections and Immunity. 77 (2), 810-816 (2009).</li><li>Bourhy, P., Louvel, H., Saint Girons, I., Picardeau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+insertional+mutagenesis+of+Leptospira+interrogans,+the+agent+of+leptospirosis,+using+a+mariner+transposon.">Random insertional mutagenesis of Leptospira interrogans, the agent of leptospirosis, using a mariner transposon.</a> Journal of Bacteriology. 187 (9), 3255-3258 (2005).</li><li>P&#283;tro&#353;ov&#225;, H., Picardeau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+of+a+Leptospira+biflexa+mutant+library+to+identify+genes+involved+in+ethidium+bromide+tolerance.">Screening of a Leptospira biflexa mutant library to identify genes involved in ethidium bromide tolerance.</a> Applied Environmental Microbiology. 80 (19), 6091-6103 (2014).</li><li>Slamti, L., Picardeau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+library+of+random+mutants+in+the+spirochete+Leptospira+biflexa+using+a+mariner+transposon.">Construction of a library of random mutants in the spirochete Leptospira biflexa using a mariner transposon.</a> Methods in Molecular Biology. 859, 169-176 (2012).</li><li>Croda, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+mutagenesis+in+pathogenic+Leptospira+species:+Disruption+of+the+LigB+gene+does+not+affect+virulence+in+animal+models+of+leptospirosis.">Targeted mutagenesis in pathogenic Leptospira species: Disruption of the LigB gene does not affect virulence in animal models of leptospirosis.</a> Infections and Immunity. 76 (12), 5826-5833 (2008).</li><li>Picardeau, M., Brenot, A., Saint Girons, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+evidence+for+gene+replacement+in+Leptospira+spp.+Inactivation+of+L.+biflexa+flaB+results+in+non-motile+mutants+deficient+in+endoflagella.">First evidence for gene replacement in Leptospira spp. Inactivation of L. biflexa flaB results in non-motile mutants deficient in endoflagella.</a> Molecular Microbiology. 40 (1), 189-199 (2001).</li><li>King, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-temperature+protein+G+is+an+essential+virulence+factor+of+Leptospira+interrogans.">High-temperature protein G is an essential virulence factor of Leptospira interrogans.</a> Infections and Immunity. 82 (3), 1123-1131 (2014).</li><li>Lambert, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FlaA+proteins+in+Leptospira+interrogans+are+essential+for+motility+and+virulence+but+are+not+required+for+formation+of+the+flagellum+sheath.">FlaA proteins in Leptospira interrogans are essential for motility and virulence but are not required for formation of the flagellum sheath.</a> Infections and Immunity. 80 (6), 2019-2025 (2012).</li><li>Murray, G. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leptospira+interrogans+requires+heme+oxygenase+for+disease+pathogenesis.">Leptospira interrogans requires heme oxygenase for disease pathogenesis.</a> Microbes and Infections. 11 (2), 311-314 (2009).</li><li>Ristow, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+OmpA-like+protein+Loa22+is+essential+for+leptospiral+virulence.">The OmpA-like protein Loa22 is essential for leptospiral virulence.</a> PLoS Pathogens. 3 (7), 97 (2007).</li><li>Sasaki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leptospiral+flagellar+sheath+protein+FcpA+interacts+with+FlaA2+and+FlaB1+in+Leptospira+biflexa.">Leptospiral flagellar sheath protein FcpA interacts with FlaA2 and FlaB1 in Leptospira biflexa.</a> PLoS One. 13 (4), 0194923 (2018).</li><li>Gaj, T., Gersbach, C. A., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN,+TALEN,+and+CRISPR/Cas-based+methods+for+genome+engineering.">ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering.</a> Trends in Biotechnology. 31 (7), 397-405 (2013).</li><li>Cress, B. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+CRISPR/dCas9-regulated,+orthogonally+repressible+hybrid+T7-lac+promoters+for+modular,+tuneable+control+of+metabolic+pathway+fluxes+in+Escherichia+coli.">Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli.</a> Nucleic Acids Research. 44 (9), 4472-4485 (2016).</li><li>Zhao, C., Shu, X., Sun, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+gene+knockdown+system+based+on+catalytically+inactive+("dead")+Cas9+(dCas9)+in+Staphylococcus+aureus.">Construction of a gene knockdown system based on catalytically inactive ("dead") Cas9 (dCas9) in Staphylococcus aureus.</a> Applied Environmental Microbiology. 83 (12), (2017).</li><li>Zhao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/dCas9-mediated+multiplex+gene+repression+in+Streptomyces.">CRISPR/dCas9-mediated multiplex gene repression in Streptomyces.</a> Biotechnology Journal. , 1800121 (2018).</li></ol>

The authors have nothing to disclose.

After the early sequencing of pathogenic15,16,17,18 and saprophytic19&#160;Leptospira species, data mining of the genome shed light on several aspects of leptospiral pathogenesis. In most cases, protein function was explored by using the recombinant counterpart of putative leptospiral surface-exposed proteins and subsequent speculation of the native protein function20,21,22,23,24,25,26.
The generation of mutants, and evaluation of their respective phenotype, are key components of functional genomic analysis. Initial attempts to generate mutants in Leptospira spp. were achieved by random transposon mutagenesis27,28,29,30; however, after extensive and laborious analysis for inferring the identity of disrupted genes, it was noted that only 15% of all genes in L. interrogans serovar Manilae were disrupted27. Targeted gene knockout was further achieved by homologous recombination utilizing suicide plasmids to deliver an antibiotic resistance cassette flanked by homologous arms within the desired target31,32.
By applying these technologies, several aspects of leptospiral basic biology and virulence were explored31,33,34,35,36,37. The development of the E. coli-Leptospira conjugative shuttle vector, pMaOri 11, allowed the delivery of components for episomal gene silencing.
It was previously shown that the Cas9-induced double-strand break is lethal to Leptospira spp. and, as an alternative, the catalytically inactive variant of the enzyme, dCas9, can be used to achieve gene silencing in both saprophytic and pathogenic species4, 5. By using the plasmid pMaOri.dCas9 as a backbone for sgRNA cassette ligation, specific and stable gene silencing can be obtained due to the expression of both dCas9 and sgRNA; dCas9-bound sgRNA will lead the protein to the desired target by Watson-Crick base pairing.
For complete gene silencing, the protospacer should be designed based on the template strand of the desired gene so that base pairing of the sgRNA occurs with the coding strand. Based on an average C+G content of 35% in Leptospira spp., the PAM 5&#39;-NGG-3&#39; will occur at least 3 times every 100 bp. Therefore, virtually any gene within the genome of Leptospira will contain at least one PAM. However, if the motif NGG is not found, the alternative NAG motif can be evaluated.
Previous gene silencing techniques, such as zinc fingers and TALE (transcription activator-like effectors), relied on the construction of one different protein to each target, making these techniques laborious and costly38. In the case of CRISPRi, the variable component is the sgRNA, making it necessary to only change the 20 bp at the 5&#39; end. Complete, stable, and targeted gene silencing has been observed not only in Leptospira spp.4,5, but also in other bacteria8,39,40,41.
The development of HAN media13 favored the recovery of mutants by drastically reducing the incubation time for colony formation and allowing Leptospira to grow at 37 oC. However, during the conjugation step, its use is not recommended since E. coli can vigorously proliferate in this media and overcome the intended 1:1 proportion between donor and recipient cells. At this stage, EMJH plus DAP is the better choice, since E. coli replicate poorly in this media. It is worth mentioning that some laboratories make in-house supplemented EMJH, which can contain additional components that might also support the growth of E. coli cells.
The conjugation protocol presented here was optimized for L. interrogans serovar Copenhageni strain Fiocruz L1-130, and it was also proven to be effective in the transformation of a recently isolated pathogenic strain from soil samples5. Initial attempts with different serovars of L. borgpetersenii species indicate lower conjugation efficiencies with the described protocol. Thus, when working with different species/serovars of Leptospira, optimal conditions for conjugation should be determined empirically, considering donor:recipient cell proportions, initial cell densities, conjugation media and time (24 and 48 h). It is reasonable to assume that different Leptospira species and serovars will behave differently with different conjugation protocols.
Even though saprophytic Leptospira colonies are relatively easy to visualize on plates, pathogenic colonies can be more difficult to observe. Normally, by using HAN media supplemented with 0.4% rabbit serum and spectinomycin, transconjugant colonies can be observed at day 10. In our experience, colonies initially present as a transparent halo at the media surface. In the video protocol, denser colonies, after 14 days of growth, are shown since the transparent ones were difficult to film. At this stage, rotating the plate to achieve different light incidence and shifting between white and dark backgrounds can help identify colonies.
For mutant validation, immunoblotting offers a straightforward approach; however, since antibodies are not always available against target proteins, alternative strategies to validate gene silencing can be pursued. Quantitative reverse-transcriptase PCR (qRT-PCR) using primers for the target gene and a constitutive control is effective to validate gene silencing since sgRNA-guided dCas9 is responsible for blockage of gene transcription. If the target gene encodes a clearly defined protein band in protein gels, SDS-PAGE can demonstrate silencing, and as per the lipL32 gene silencing5. If LPS biosynthesis genes are silenced, LPS staining can be employed; in the case of silencing genes encoding for enzymes with well-defined substrates, kinetic assays with chromogenic substrates are valid strategies; &#946;-galactosidase silencing in L. biflexa was validated by the use of X-gal and ONPG (ortho-Nitrophenyl-&#946;-galactoside) substrates4.
After confirmation of gene silencing, experiments can be designed to further evaluate phenotype. Binding assays can be performed in the case of silencing bacterial adhesins; serum-challenge assays confirmed the role of LigA and LigB in serum survival displayed by pathogenic Leptospira5. Mutants can also be used to inoculate animals to assess attenuation of virulence; in this case, animals inoculated with the mutant should be compared to those infected with cells containing pMaOri.dCas9 only.
In conclusion, the current protocol describes the application of CRISPRi for gene silencing in pathogenic Leptospira species using HAN media to facilitate mutant recovery within 10 days. Gene silencing combined with functional genomic analysis will improve our understanding of pathogenic mechanisms of Leptospira, and ultimately leading to the development of better prophylactic strategies for disease control.

Leptospirosis is a neglected worldwide zoonosis caused by pathogenic and virulent species of the genus Leptospira. In humans, the disease accounts for more than one million cases and 60,000 deaths per year worldwide1,2. So far, there is no long-term and effective vaccine for the disease. The identification of virulence factors and pathogenic mechanisms is pivotal to the development of better therapeutic and prophylactic strategies. Therefore, the ability to generate genetic mutations and assess the resulting phenotype is critical to functional genomic analysis3.
The construction of mutants in pathogenic Leptospira was considered, until now, inherently inefficient, laborious, costly, and difficult to implement. This scenario drastically changed with the application of the recent CRISPR interference (CRISPRi) to saprophytic4 and pathogenic5 leptospires.
Gene silencing is achieved by the expression of two components: a variant of the CRISPR/Cas (clustered regularly interspaced short palindromic repeat/CRISPR associated) enzyme Cas9 from Streptococcus pyogenes, called catalytically dead Cas9 (dCas9) and a single-guide RNA (sgRNA), that can be edited according to the desired target6,7,8. dCas9 protein, when bound to the sgRNA, is directed to specific DNA targets by Watson and Crick base pairing, causing a steric blockage to RNA polymerase elongation, resulting in gene silencing due to the obstructed gene transcription7 (Figure 1).
This manuscript aims to describe the construction of the plasmid for expressing both dCas9 and sgRNA, conjugation between donor E. coli &#946;2163 and recipient Leptospira cells, transconjugant recovery, and finally, validation of selected mutant colonies.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.1 &#181;m pore size mixed cellulose esters membrane</td>
			<td>Millipore</td>
			<td>VCWP02500</td>
			<td>Filtration for bacterial conjugation</td>
		</tr>
		<tr>
			<td>2,6-Diaminopimelic acid (DAP)</td>
			<td>Sigma</td>
			<td>D1377</td>
			<td>Growth of auxotrophic E. coli &#946;2163</td>
		</tr>
		<tr>
			<td>Agar Noble</td>
			<td>BD &#38; Company</td>
			<td>214230</td>
			<td>Used for preparation of solid EMJH and HAN plates</td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD &#38; Company</td>
			<td>214010</td>
			<td>Used for preparation of solid LB plates</td>
		</tr>
		<tr>
			<td>Clarity Western ECL substrate</td>
			<td>Biorad</td>
			<td>170-5060</td>
			<td>Chemiluminescent substrate</td>
		</tr>
		<tr>
			<td>dNTP set</td>
			<td>Thermo Fisher</td>
			<td>10297-018</td>
			<td>dNTPs for PCR reaction</td>
		</tr>
		<tr>
			<td>Glass Microanalysis Filter Holder</td>
			<td>Millipore</td>
			<td>XX1012530</td>
			<td>Filtration for bacterial conjugation</td>
		</tr>
		<tr>
			<td>Imaging System</td>
			<td>Biorad</td>
			<td>ChemiDoc MP</td>
			<td>Chemiluminescence detection</td>
		</tr>
		<tr>
			<td>LB broth, Miller</td>
			<td>BD &#38; Company</td>
			<td>244620</td>
			<td>Lysogenic liquid medium for E. coli culturing</td>
		</tr>
		<tr>
			<td>Leptospira Enrichment EMJH</td>
			<td>BD &#38; Company</td>
			<td>279510</td>
			<td>Supplementation of EMJH media</td>
		</tr>
		<tr>
			<td>Leptospira Medium Base EMJH</td>
			<td>BD &#38; Company</td>
			<td>279410</td>
			<td>EMJH medium for Leptospira</td>
		</tr>
		<tr>
			<td>Mini-PROTEAN TGX Gels 12%</td>
			<td>Biorad</td>
			<td>4568043</td>
			<td>Used for polyacrylamide gel eletrophoresis</td>
		</tr>
		<tr>
			<td>Optical density reader</td>
			<td>Molecular Devices</td>
			<td>SpectraMax M2</td>
			<td>For optical density measurements of bacterial cultures</td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline 7.4</td>
			<td>Sigma</td>
			<td>806552</td>
			<td>Saline solution for washing bacterial pellets</td>
		</tr>
		<tr>
			<td>Spectinomycin</td>
			<td>Sigma</td>
			<td>S0692</td>
			<td>Selection of pMaOri backbone plasmids</td>
		</tr>
		<tr>
			<td>Taq DNA Polymerase</td>
			<td>Thermo Fisher</td>
			<td>EP0402</td>
			<td>Enyme, buffer and MgCl2 for PCR reaction</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>Applied Biosystem</td>
			<td>GeneAmp PCR System 9700</td>
			<td>Used for PCR reaction cycling</td>
		</tr>
		<tr>
			<td>Thymidine (dT)</td>
			<td>Sigma</td>
			<td>T9250</td>
			<td>Growth of auxotrophic E. coli &#960;1</td>
		</tr>
		<tr>
			<td>XmaI restriction enzyme</td>
			<td>New Englan BioLabs</td>
			<td>R0180L</td>
			<td>Digestion of plasmids and inserts</td>
		</tr>
	</tbody>
</table>

application of crispr interference (crispri) for gene silencing in pathogenic species of leptospira

Leptospirosis is a global neglected zoonosis, responsible for at least 1 million cases per year and almost 60 thousand deaths. The disease is caused by pathogenic and virulent bacteria of the genus Leptospira, either by direct contact with the bacteria or indirectly by exposure to contaminated water or soil. Domestic and wild animals act as reservoir hosts of infection, shedding leptospires from colonized renal tubules of the kidney, via urine, into the environment. The generation of mutant strains of Leptospira is critical to evaluate and understand pathogenic mechanisms of infection. CRISPR interference (CRISPRi) has proven to be a straightforward, affordable, and specific tool for gene silencing in pathogenic Leptospira. Therefore, the methodological details of obtaining the plasmid constructs containing both dCas9 and guide RNA, delivery of plasmids to Leptospira by conjugation with the E. coli strain &#946;2163, and transconjugant recovery and evaluation, will be described. In addition, the recently described Hornsby-Alt-Nally (HAN) media allows for the relatively rapid isolation and selection of mutant colonies on agar plates.

Even though the CG content in Leptospira spp. genomes is typically around 35%; virtually every gene is likely to contain the PAM 5&#39;NGG 3&#39;; this motif needs to be considered in the template strand. After inputting the coding sequence of a gene (from start to stop codons), based on the CHOPCHOP results, protospacers must be selected at the minus (-, template) strand. It is important to not include the NGG motif in the 20-nt sgRNA protospacer.
If conjugation is performed with a 1:1 donor:recipient cell proportion, for 24 h on the surface of EMJH agar plates plus DAP, and 200 &#956;L of the recovered bacterial suspension are spread onto HAN plus spectinomycin agar plates, transconjugants colonies should be visible at approximately 8-10 days. Spreading of this volume normally results in 20-40 colonies per plate (Figure 3A). In order to check for cell viability after conjugation, cells can be spread onto HAN plates with no antibiotic selection. In this case, colonies can be observed as soon as 7 days. HAN plates turn pale yellow in a 3% CO2 atmosphere.
After colony picking and growth in liquid media plus spectinomycin, PCR using whole cells and pMaOri2 primers can be used for an initial quality check of the transconjugants (Figure 3B). Leptospiral cells containing the control pMaOri.dCas9 plasmid should result in an amplicon of 281 bp, while those cells containing the plasmid for silencing, that is, containing both dCas9 and sgRNA, should result in a 723 bp amplicon. pMaOri2 F and R primers were designed to flank the XmaI restriction site, which is the site used during sgRNA cassette ligation.
With the confirmation of plasmid presence, cells can be harvested from the media, washed twice with PBS, and then used to prepare a whole-cell extract for immunoblotting. If the silencing occurred, the target proteins, in this case, either LipL32 or both LigA and LigB, should be observed only in the wild type cells and in those containing pMaOri.dCas9; even with higher exposure times, no corresponding proteins should be visible in the cells containing pMaOri.dCas9sgRNA (Figure 3C).
If experiments to assess leptospiral virulence after gene silencing are planned, cultures used for conjugation should be low passage virulent Leptospira. After gene silencing is confirmed, several aliquots can be frozen as a backup. If the silenced gene has a measurable phenotype, e.g., based on previous work with recombinant proteins, cultures can be used for validation and, in this case, cells containing pMaOri.dCas9 only, can be included as a negative control.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62631/62631fig01.jpg" /> 
Figure 1: Development of dCas9 and sgRNA expressing plasmid. (A) A 20-nt long protospacer, followed by the S. pyogenes dCas9 PAM 5&#39;-NGG-3&#39;, is selected within the template strand of the target gene so the subsequent sgRNA can perform Watson and Crick base pairing to the corresponding coding strand, resulting in complete gene silencing. (B) The sgRNA cassette is composed of the lipL32 promoter, 20-nt protospacer, and dCas9 scaffold. The pMaOri.dCas9 plasmid is used as a backbone for sgRNA cassette ligation at the XmaI restriction site. The resulting plasmid, termed pMaOri.dCas9sgRNA is delivered to leptospires, and the expression of both dCas9 and sgRNA is responsible for the gene silencing. (C) sgRNA-directed dCas9 acts as a physical barrier to RNA polymerase elongation, therefore, hampering transcription. <a href="https://www.jove.com/files/ftp_upload/62631/62631fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62631/62631fig02.jpg" /> 
Figure 2: Schematic representation of conjugation protocol. The desired Leptospira species is grown in HAN media, under agitation, until O.D. of 0.2-0.4 (mid-log phase) at 420 nm. One day before conjugation, a colony of recombinant donor E. coli &#946;2163 containing the plasmid of interest is picked from LB+DAP+Spc agar plates, as cells are grown overnight in liquid LB with the same supplementation. The next day, saturated E. coli cultures are diluted in LB plus DAP and grown until O.D. of 0.2-0.4 at 420 nm. Both donor E. coli and recipient Leptospira are mixed at 1:1 cell proportion onto the surface of a 0.1 &#956;m filter by a filtration apparatus under negative pressure. Then, filters are placed on top of the EMJH agar plates supplemented with DAP, and incubation proceeds for 24 h at 29 &#176;C. The use of EMJH limits E. coli proliferation, and the intended 1:1 proportion is maintained. Bacteria are recovered from filters by pipetting with 1 mL HAN media, and suspensions are visualized under darkfield microscopy. Finally, 100-200 &#956;L of each suspension are seeded onto HAN agar plates containing 0.4% rabbit serum and incubated at 37 &#176;C in 3% CO2. At this stage, DAP is omitted, and as a result, auxotrophic E. coli will not grow. <a href="https://www.jove.com/files/ftp_upload/62631/62631fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62631/62631fig03.jpg" /> 
Figure 3: Representative results for mutants&#39; evaluation. (A) Colonies from plates containing Leptospira transformed with empty pMaOri.dCas9 (negative control for further experiments) and plasmids pMaOri.dCas9sgRNA (with targeted gene silenced) are picked, vigorously homogenized in liquid HAN and grown in liquid HAN containing spectinomycin. Recombinant cells can be validated by PCR with primers flanking the XmaI site within pMaOri.dCas9. (B) In this case, cells containing pMaOri.dCas9 only resulted in an amplicon of 281 bp, while those cells containing the plasmid for silencing, containing both dCas9 and sgRNA, showed a 723 bp amplicon. After confirmation of the presence of the plasmids, gene silencing was validated by immunoblot analysis. (C) Incubation with antibodies to both target protein and a loading control protein is recommended; in the representative immunoblot, whole-cell extracts from transconjugants containing pMaOri.dCas9 alone or with sgRNA cassettes targeting lipL32 (pMaOri.dCas9sgRNAlipL32) and both LigA and LigB (pMaOri.dCas9sgRNAligAB) genes are displayed. Co-incubation with anti-LipL32, anti-LigAB and anti-LipL41 (non-target, loading control) confirms that the expression of LipL32 protein is abolished in cells containing pMaOri.dCas9sgRNAlipL32 and both LigA and LigB in cells containing pMaOri.dCas9sgRNAligAB. <a href="https://www.jove.com/files/ftp_upload/62631/62631fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Supplementary File: Single guide RNA (sgRNA) cassette sequence. The sgRNA transcription is directed by the constitutive lipL32 promoter (bold nucleotides). sgRNA is composed of 20 nucleotides referring to the protospacer, responsible for base pairing to the coding strand of the target gene, and dCas9 scaffold sequence (underlined nucleotides). XmaI restriction sites (cccggg) are included at both ends for ligation at pMaOri.dCas9 plasmid. <a href="https://www.jove.com/files/ftp_upload/62631/Supplementary File.docx" target="_blank">Please click here to download this File.</a>

Watch this Scientific Journal Video about Application of CRISPR Interference CRISPRi for Gene Silencing in Pathogenic Species of Leptospira at JoVE.com

Application of CRISPR Interference CRISPRi for Gene Silencing in Pathogenic Species of Leptospira

Here, the application of CRISPR interference (CRISPRi) for specific gene silencing in Leptospira species is described. Leptospira cells are transformed by conjugation with plasmids expressing dCas9 (catalytically "dead" Cas9) and a single-guide RNA (sgRNA), responsible for base pairing to the desired genomic target. Methods to validate gene silencing are presented.

Application of CRISPR Interference (CRISPRi) for Gene Silencing in Pathogenic Species of Leptospira

Leptospirosis is a global neglected zoonosis, responsible for at least 1 million cases per year and almost 60 thousand deaths. The disease is caused by ...

application-crispr-interference-crispri-for-gene-silencing-pathogenic

Research

JoVE Journal

Genetics

4.9K Views.  United States Department of Agriculture. Here, the application of CRISPR interference (CRISPRi) for specific gene silencing in Leptospira species is described. Leptospira cells are transformed by conjugation with plasmids expressing dCas9 (catalytically "dead" Cas9) and a single-guide RNA (sgRNA), responsible for base pairing to the desired genomic target. Methods to validate gene silencing are presented. 

Video: Application of CRISPR Interference CRISPRi for Gene Silencing in Pathogenic Species of Leptospira

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene function. Gene knockout has been used to study these gene functions in vivo. The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system is a powerful tool used to edit genomic DNA sequences to alter gene function. While the traditional approach has been to introduce CRISPR/Cas9 mRNA into the single cell embryos through microinjection, this can be a slow and inefficient process in catfish. Here, a detailed protocol for microinjection of channel catfish embryos with CRISPR/Cas9 protein is described. Briefly, eggs and sperm were collected and then artificial fertilization performed. Fertilized eggs were transferred to a Petri dish containing Holtfreter's solution. Injection volume was calibrated and then guide RNAs/Cas9 targeting the toll/interleukin 1 receptor domain-containing adapter molecule (TICAM 1) gene and rhamnose binding lectin (RBL) gene were microinjected into the yolk of one-cell embryos. The gene knockout was successful as indels were confirmed by DNA sequencing. The predicted protein sequence alterations due to these mutations included frameshift and truncated protein due to premature stop codons.

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

A simple and efficient microinjection protocol for gene editing in channel catfish embryos using the CRISPR/Cas9 system is presented. In this protocol, guide RNAs and Cas9 protein were microinjected into the yolk of one-cell embryos. This protocol has been validated by knocking out two channel catfish immune-related genes.

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene ...

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells and mediating high levels of gene expression. However, their ability to integrate into the host cell genome enhances the risk of insertional mutagenicity and thus raises safety concerns and limits their usage in clinical settings. Further, the persistent expression of gene-editing components delivered by these integration-competent lentiviral vectors (ICLVs) increases the probability of promiscuous gene targeting. As an alternative, a new generation of integrase-deficient lentiviral vectors (IDLVs) has been developed that addresses many of these concerns. Here the production protocol of a new and improved IDLV platform for CRISPR-mediated gene editing and list the steps involved in the purification and concentration of such vectors is described and their transduction and gene-editing efficiency using HEK-293T cells was demonstrated. This protocol is easily scalable and can be used to generate high titer IDLVs that are capable of transducing cells in vitro and in vivo. Moreover, this protocol can be easily adapted for the production of ICLVs.

We describe the production strategy of integrase-deficient lentiviral vectors (IDLVs) as vehicles for delivering CRISPR/Cas9 to cells. With an ability to mediate quick and robust gene editing in cells, IDLVs present a safer and equally effective vector platform for gene delivery compared to integrase-competent vectors.

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells ...

Production and Purification of Baculovirus for Gene Therapy Application

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a promising vector for gene therapy application. Here, baculovirus is produced by transient transfection of the baculovirus plasmid DNA (bacmid) in an adherent culture of Sf9 cells. Baculovirus is subsequently expanded in Sf9 cells in a serum-free suspension culture until the desired volume is obtained. It is then purified from the culture supernatant using heparin affinity chromatography. Virus supernatant is loaded onto the heparin column which binds baculovirus particles in the supernatant due to the affinity of heparin for baculovirus envelop glycoprotein. The column is washed with a buffer to remove contaminants and baculovirus is eluted from the column with a high-salt buffer. The eluate is diluted to an isotonic salt concentration and baculovirus particles are further concentrated using ultracentrifugation. Using this method, baculovirus can be concentrated up to 500-fold with a 25% recovery of infectious particles. Although the protocol described here demonstrates the production and purification of the baculovirus from cultures up to 1 L, the method can be scaled-up in a closed-system suspension culture to produce a clinical-grade vector for gene therapy application.

In this protocol, baculovirus is produced by transient transfection of baculovirus plasmid into Sf9 cells and amplified in a serum-free suspension culture. The supernatant is purified by heparin affinity chromatography and further concentrated by ultracentrifugation. This protocol is useful for the production and purification of baculovirus for gene therapy application.

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

CRISPR-Mediated Reorganization of Chromatin Loop Structure

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene expression, but whether looping is responsible for or a result of alterations in gene expression is still unknown. Until recently, how chromatin looping affects the regulation of gene activity and cellular function has been relatively ambiguous, and limitations in existing methods to manipulate these structures prevented in-depth exploration of these interactions. To resolve this uncertainty, we engineered a method for selective and reversible chromatin loop re-organization using CRISPR-dCas9 (CLOuD9). The dynamism of the CLOuD9 system has been demonstrated by successful localization of CLOuD9 constructs to target genomic loci to modulate local chromatin conformation. Importantly, the ability to reverse the induced contact and restore the endogenous chromatin conformation has also been confirmed. Modulation of gene expression with this method establishes the capacity to regulate cellular gene expression and underscores the great potential for applications of this technology in creating stable de novo chromatin loops that markedly affect gene expression in the contexts of cancer and development.

Chromatin looping plays a significant role in gene regulation; however, there have been no technological advances that allow for selective and reversible modification of chromatin loops. Here we describe a powerful system for chromatin loop re-organization using CRISPR-dCas9 (CLOuD9), demonstrated to selectively and reversibly modulate gene expression at targeted loci.

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene ...

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical regions, is caused by infection with Plasmodium parasites. The development of more effective drugs to combat malaria can be accelerated by improving our understanding of the biology of this complex parasite. Genetic manipulation of these parasites is key to understanding their biology; however, historically the genome of P. falciparum has been difficult to manipulate. Recently, CRISPR/Cas9 genome editing has been utilized in malaria parasites, allowing for easier protein tagging, generation of conditional protein knockdowns, and deletion of genes. CRISPR/Cas9 genome editing has proven to be a powerful tool for advancing the field of malaria research. Here, we describe a CRISPR/Cas9 method for generating glmS-based conditional knockdown mutants in P. falciparum. This method is highly adaptable to other types of genetic manipulations, including protein tagging and gene knockouts.

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

We describe a method for generating glmS-based conditional knockdown mutants in Plasmodium falciparum using CRISPR/Cas9 genome editing.

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical ...

Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these enhancers combine to produce a transcriptional response. As millions of enhancers have been identified, high-throughput tools are needed to determine enhancer function on a genome-wide scale. Current methods for studying enhancer function include making genetic deletions using nuclease-proficient Cas9, but it is difficult to study the combinatorial effects of multiple enhancers using this technique, as multiple successive clonal cell lines must be generated. Here, we present Enhancer-i, a CRISPR interference-based method that allows for functional interrogation of multiple enhancers simultaneously at their endogenous loci. Enhancer-i makes use of two repressive domains fused to nuclease-deficient Cas9, SID and KRAB, to achieve enhancer deactivation via histone deacetylation at targeted loci. This protocol utilizes transient transfection of guide RNAs to enable transient inactivation of targeted regions and is particularly effective at blocking inducible transcriptional responses to stimuli in tissue culture settings. Enhancer-i is highly specific both in its genomic targeting and its effects on global gene expression. Results obtained from this protocol help to understand whether an enhancer is contributing to gene expression, the magnitude of the contribution, and how the contribution is affected by other nearby enhancers.

This protocol describes the steps needed to design and perform multiplexed targeting of enhancers with the deactivating fusion protein SID4X-dCas9-KRAB, also known as enhancer interference (Enhancer-i). This protocol enables the identification of enhancers that regulate gene expression and facilitates the dissection of relationships between enhancers regulating a common target gene.

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these ...

Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since 2007. These studies have confirmed that lncRNAs are altered in almost all diseases. However, studying the functional roles for lncRNAs in the context of disease remains difficult due to the lack of protein products, tissue-specific expression, low expression levels, complexities in splice forms, and lack of conservation among species. Given the species-specific expression, lncRNA studies are often restricted to human research contexts when studying disease processes. Since lncRNAs function at the molecular level, one way to dissect lncRNA biology is to either remove the lncRNA or overexpress the lncRNA and measure cellular effects. In this article, a written and visualized protocol to overexpress lncRNAs in vitro is presented. As a representative experiment, an lncRNA associated with inflammatory bowel disease, Interferon Gamma Antisense 1 (IFNG-AS1), is shown to be overexpressed in a Jurkat T-cell model. To accomplish this, the activating clustered regularly interspaced short palindromic repeats (CRISPR) technique is used to enable overexpression at the endogenous genomic loci. The activating CRISPR technique targets a set of transcription factors to the transcriptional start site of a gene, enabling a robust overexpression of multiple lncRNA splice forms. This procedure will be broken down into three steps, namely (i) guide RNA (gRNA) design and vector construction, (ii) virus generation and transduction, and (iii) colony screening for overexpression. For this representative experiment, a greater than 20-fold enhancement in IFNG-AS1 in Jurkat T cells was observed.

Traditional cDNA-based overexpression techniques have a limited applicability for the overexpression of long noncoding RNAs due to their multiple splice forms with potential functionality. This review reports a protocol using CRISPR technology to overexpress multiple splice variants of a long noncoding RNA.

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since ...