We thank Yorick Post for the initial development of the protocol. This work was in part supported by an award from the Cancer Research UK Grand Challenge (C6307/A29058) and the Mark Foundation for Cancer Research to the SPECIFICANCER team.

<ol>
	<li>Garg, A., Zhang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lacrimal+gland+development:+From+signaling+interactions+to+regenerative+medicine.">Lacrimal gland development: From signaling interactions to regenerative medicine.</a> Developmental Dynamics. 246 (12), 970-980 (2017).</li><li>Selinger, D. S., Selinger, R. C., Reed, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resistance+to+infection+of+the+external+eye:+The+role+of+tears.">Resistance to infection of the external eye: The role of tears.</a> Survey of Ophthalmology. 24 (1), 33-38 (1979).</li><li>Messmer, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pathophysiology,+diagnosis,+and+treatment+of+dry+eye+disease.">The pathophysiology, diagnosis, and treatment of dry eye disease.</a> Deutsches Arzteblatt International. 112 (5), 71-81 (2015).</li><li>Massie, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+lacrimal+gland+spheroids+for+lacrimal+gland+tissue+regeneration.">Development of lacrimal gland spheroids for lacrimal gland tissue regeneration.</a> Journal of Tissue Engineering and Regenerative Medicine. 12 (4), 2001-2009 (2018).</li><li>Tiwari, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishing+human+lacrimal+gland+cultures+with+secretory+function.">Establishing human lacrimal gland cultures with secretory function.</a> PloS One. 7 (1), 29458 (2012).</li><li>Nguyen, D. H., Beuerman, R. W., Halbert, C. L., Ma, Q., Sun, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+immortalized+rabbit+lacrimal+gland+epithelial+cells.">Characterization of immortalized rabbit lacrimal gland epithelial cells.</a> In Vitro Cellular &amp; Developmental Biology. Animal. 35 (4), 198-204 (1999).</li><li>Bannier-H&#233;laou&#235;t, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+human+lacrimal+gland+using+organoids+and+single-cell+sequencing.">Exploring the human lacrimal gland using organoids and single-cell sequencing.</a> Cell Stem Cell. 28 (7), 1221-1232 (2021).</li><li>Hayashi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+3D+lacrimal+gland+organoids+from+human+pluripotent+stem+cells.">Generation of 3D lacrimal gland organoids from human pluripotent stem cells.</a> Nature. 605 (7908), 126-131 (2022).</li><li>Jeong, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+functional+epithelial+organoids+from+human+lacrimal+glands.">Establishment of functional epithelial organoids from human lacrimal glands.</a> Stem Cell Research &amp; Therapy. 12 (1), 247 (2021).</li><li>Hofer, M., Lutolf, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+organoids.">Engineering organoids.</a> Nature Reviews Materials. 6 (5), 402-420 (2021).</li><li>Meyenberg, M., Ferreira da Silva, J., Loizou, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+specific+DNA+repair+outcomes+shape+the+landscape+of+genome+editing.">Tissue specific DNA repair outcomes shape the landscape of genome editing.</a> Frontiers in Genetics. 12, 728520 (2021).</li><li>Geurts, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-based+adenine+editors+correct+nonsense+mutations+in+a+cystic+fibrosis+organoid+biobank.">CRISPR-based adenine editors correct nonsense mutations in a cystic fibrosis organoid biobank.</a> Cell Stem Cell. 26 (4), 503-510 (2020).</li><li>Overmyer, K. A., Thonusin, C., Qi, N. R., Burant, C. F., Evans, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+anesthesia+and+euthanasia+on+metabolomics+of+mammalian+tissues:+Studies+in+a+C57BL/6J+mouse+model.">Impact of anesthesia and euthanasia on metabolomics of mammalian tissues: Studies in a C57BL/6J mouse model.</a> PLoS One. 10 (2), 0117232 (2015).</li><li>Driehuis, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+mucosal+organoids+as+a+potential+platform+for+personalized+cancer+therapy.">Oral mucosal organoids as a potential platform for personalized cancer therapy.</a> Cancer Discovery. 9 (7), 852-871 (2019).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli+using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli using the heat shock method.</a> Journal of Visualized Experiments. (6), e253 (2007).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nature Protocols. 8 (11), 2281-2308 (2013).</li><li>Lian, J., Meng, X., Zhang, X., Hu, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+and+genetic+manipulation+of+murine+hepatocyte+organoids.">Establishment and genetic manipulation of murine hepatocyte organoids.</a> Journal of Visualized Experiments. (180), e62438 (2022).</li><li>L&#245;hmussaar, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-derived+organoids+model+cervical+tissue+dynamics+and+viral+oncogenesis+in+cervical+cancer.">Patient-derived organoids model cervical tissue dynamics and viral oncogenesis in cervical cancer.</a> Cell Stem Cell. 28 (8), 1380-1396 (2021).</li><li>Bloh, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deconvolution+of+complex+DNA+repair+(DECODR):+Establishing+a+novel+deconvolution+algorithm+for+comprehensive+analysis+of+CRISPR-edited+Sanger+sequencing+data.">Deconvolution of complex DNA repair (DECODR): Establishing a novel deconvolution algorithm for comprehensive analysis of CRISPR-edited Sanger sequencing data.</a> The CRISPR Journal. 4 (1), 120-131 (2021).</li><li>Latta, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathophysiology+of+aniridia-associated+keratopathy:+Developmental+aspects+and+unanswered+questions.">Pathophysiology of aniridia-associated keratopathy: Developmental aspects and unanswered questions.</a> The Ocular Surface. 22, 245-266 (2021).</li><li>Veernala, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lacrimal+gland+regeneration:+The+unmet+challenges+and+promise+for+dry+eye+therapy.">Lacrimal gland regeneration: The unmet challenges and promise for dry eye therapy.</a> The Ocular Surface. 25, 129-141 (2022).</li><li>Hayashi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+3D+lacrimal+gland+organoids+from+human+pluripotent+stem+cells.">Generation of 3D lacrimal gland organoids from human pluripotent stem cells.</a> Nature. 605 (7908), 126-131 (2022).</li></ol>

Hans Clevers is the head of Pharma Research and Early Development at Roche, Basel, and holds several patents related to organoid technology.

This protocol describes the establishment and use of lacrimal gland organoids for functional assays, mutation modeling, and transplantation. When establishing mouse and human lacrimal gland organoids, tissue dissociation is crucial. If the tissue is not sufficiently digested, the organoid yield will be low. If the tissue is over-digested, the cells will die and not grow out as organoids. Each tissue should be digested with a specific enzyme for a specific time to ensure optimal organoid outgrowth14,17,18. The lacrimal gland is a rather soft tissue for which a collagenase digestion of 5-10 min combined with pipetting-based mechanical dissociation is sufficient to isolate small pieces of tissue. If single cells need to be obtained for applications such as single-cell RNA sequencing, the dissociation can be carried out for longer until the single-cell stage is reached, but dissociation should be stopped as soon as single cells are obtained to limit any decrease in viability. As tissue dissociation is so crucial, over-digestion is the most likely reason for the failure of lacrimal gland organoid establishment.
The appropriate maintenance of lacrimal gland organoids is important to their use. Long-term maintenance is a hallmark of adult stem cell-derived lacrimal gland organoids, compared to induced pluripotent stem cell-derived organoids7,17. To achieve long-term maintenance, regular organoid splitting and medium changes should be performed. Without this, organoids begin to differentiate and develop decreased stem cell potential, which hampers their long-term maintenance7. At this step again, over-digestion can kill the stem cells and impair organoid maintenance. For regular maintenance, organoid dissociation into single cells is not required. However, to generate clonal knock-out organoid lines, it is critical to begin with single cells. If not, the organoids will be constituted of a mosaic of cells with different genetic backgrounds, making analyzing the effect of a single, defined mutation impossible. Here, we describe the use of a C &#62; T base editor to generate stop codons. This genome editor relies on the presence of arginine, glutamine, or tryptophane codons within 12-18 bases from an NGG PAM. When these conditions are not met in designing a gRNA, conventional Cas9 or C &#62;T base editors with alternative PAMs can be used7,18. However, conventional Cas9 introduces double-stranded breaks that result in indels upon repair11. As both alleles may harbor different indels, clone genotyping requires additional caution. Deconvolution of the modifications introduced should be performed to ensure both alleles contain out-of-frame indels and, hence, that the organoid clones are knocked out for the gene targeted19. The advantage of C &#62; T base editors lies in the fact that they can be used to model point mutations that do not necessarily result in stop codons. For instance, they can be used to model specific Pax6 mutations found in patients with aniridia to study their impact on lacrimal gland physiology20.
The lacrimal gland secretes the aqueous part of the tear film1. Tear secretion can be recapitulated in human organoids after differentiation mediated by growth factor withdrawal and NOTCH inhibition. Under these conditions, organoids undergo terminal differentiation and cannot be further maintained. Yet, differentiated lacrimal gland organoids can guide the development of tearing-inducing drugs in the context of dry eye disease, potentially in high-throughput screens. The tearing assay presented in this protocol is the one that currently gives the biggest change in organoid size in a short amount of time, which makes it easier to quantify in the context of a drug screen7,9,17.
Stem cell therapy holds great promise for lacrimal gland regeneration in dry eye disease21. Adult stem cell-derived lacrimal gland organoids could be a source material for such applications. The protocol presented here results in human lacrimal gland organoid engraftment, mostly as cysts. Low organoid engraftment can arise due to organoids being injected in the wrong site. Training the injection procedure with a dye allows the tracking of the injection site and, ultimately, improves the injection accuracy. Alternatively, the mouse epidermis can be incised to have direct access to the lacrimal gland, as done in rats before22. This method takes longer but may be more accurate. On the other hand, with the present protocol, the organoids did not functionally integrate into the mouse lacrimal gland. Similar results have been observed for iPSC-derived lacrimal gland engraftment22. The transplantation method could be further improved by wounding the lacrimal gland in advance, using a dry eye mouse model, and/or injecting the organoids as single cells or small clumps. Nevertheless, adult stem cell-derived lacrimal gland organoids and the related toolkit can be the basis of future applications in lacrimal gland research and regenerative medicine.

The lacrimal gland is the glandular epithelium responsible for producing most of the aqueous layer of the tear film1. The aqueous layer of the tear film not only contains water to lubricate the ocular surface but also a large repertoire of antimicrobial components that protect the ocular surface from infections2. When the lacrimal gland is damaged or inflamed, dry eye disease occurs, which results in discomfort for patients and can eventually lead to loss of vision3. Over the years, model systems to study the lacrimal gland, in particular the human gland, have been limited4,5,6. This has contributed to a knowledge gap regarding lacrimal gland function under physiological and pathological conditions.
Recently, in vitro models have been developed to study the lacrimal gland in a dish7,8,9. These lacrimal gland organoids are derived from adult stem cells grown as three-dimensional structures in an extracellular matrix supplemented with a cocktail of growth factors that sustains their regenerative capacities in vitro7. The advantage of adult stem cell (ASC)-derived organoids is that they can be maintained for a very long time while recapitulating healthy tissue features. This type of organoid solely consists of epithelial cells, unlike induced pluripotent stem cell (iPSC)-derived organoids, which may also contain stromal cells, for instance. Unlike pluripotent stem cell (PSC)-derived organoids, ASC organoids are established directly from adult tissue and do not require any genetic modifications to be expanded. ASC organoids express adult characteristics10.
This protocol contains a toolbox to derive lacrimal gland organoids from mouse and human primary tissue. The protocol describes how to further enhance the organoids&#39; functionality by simple growth factor withdrawal and how to provoke the organoids to secrete tear fluid by performing a swelling assay. This protocol additionally includes an electroporation-based transfection method to genetically engineer mouse organoids using CRISPR-derived base editors. Unlike conventional Cas9, the use of base editors allows the modification of single bases in the genome without generating a double-stranded break11,12. Lastly, the orthotopic transplantation of human lacrimal gland organoids into immunodeficient mice and the subsequent histological assessment of the engraftment is described. This lacrimal gland organoid toolkit can be used in research on lacrimal gland regeneration and function and for&#160;genetic and inflammatory disease modeling.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1.5 mL safe-lock centrifuge tubes</td>
			<td>Eppendorf</td>
			<td>EP0030 120.094</td>
			<td></td>
		</tr>
		<tr>
			<td>3,3&#8242;-Diaminobenzidine tetrahydrochloride hydrate (DAB)</td>
			<td>Sigma-Aldrich</td>
			<td>D5637</td>
			<td>CAS: 868272-85-9 , CAUTION, 6 g/L solution can be stored aliquotted at -20 &#176;C</td>
		</tr>
		<tr>
			<td>5x green GoTaq Flexi buffer</td>
			<td>Promega</td>
			<td>M891A</td>
			<td>Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>A83-01</td>
			<td>Tocris</td>
			<td>2939</td>
			<td>Store at -20 &#176;C, stock at 30 mM, 10000x</td>
		</tr>
		<tr>
			<td>Advanced DMEM/F12</td>
			<td>Invitrogen</td>
			<td>12634-010</td>
			<td>store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Agar plates containing Ampicillin</td>
			<td>Hubrecht Institute</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Sigma-Aldrich</td>
			<td>A9518</td>
			<td></td>
		</tr>
		<tr>
			<td>Autoclave VAPOUR-Line lite</td>
			<td>VWR chemicals</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>B27 supplement</td>
			<td>Invitrogen</td>
			<td>17504-044</td>
			<td>Store at -20 &#176;C, 50x</td>
		</tr>
		<tr>
			<td>BD Micro-Fine insulin needle 1 mL</td>
			<td>BD Bioscience</td>
			<td>324825</td>
			<td></td>
		</tr>
		<tr>
			<td>Benchtop microscope DMI1</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine serum albumine (BSA)</td>
			<td>MP biomedicals</td>
			<td>160069</td>
			<td>Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>BTXpress</td>
			<td>BTX</td>
			<td>MDS450805</td>
			<td></td>
		</tr>
		<tr>
			<td>C57BL/6 mice</td>
			<td>Hubrecht Institute</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cassettes</td>
			<td>Klinipath</td>
			<td>410-02S</td>
			<td></td>
		</tr>
		<tr>
			<td>CellBanker 1</td>
			<td>amsbio</td>
			<td>11910</td>
			<td>Cryopreservation medium, adhere to instructions</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Citric acid monohydrate</td>
			<td>J.T. Baker</td>
			<td>0088</td>
			<td>CAS: 5949-29-1</td>
		</tr>
		<tr>
			<td>Collagenase I</td>
			<td>Sigma Aldrich</td>
			<td>C9407</td>
			<td>Aliquots at 20 mg/mL, 20x, store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Conical tubes 15 mL</td>
			<td>Greiner Bio-One</td>
			<td>5618-8271</td>
			<td></td>
		</tr>
		<tr>
			<td>Conical tubes 50 mL</td>
			<td>Corning</td>
			<td>CLS430828-500EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Coverslips 24 mm x 50 mm</td>
			<td>Menzel-Gl&#228;zer</td>
			<td>BB024050S1</td>
			<td></td>
		</tr>
		<tr>
			<td>Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 - extracellular matrix</td>
			<td>R&#38;D Systems, Bio-Techne</td>
			<td>3533-001-02</td>
			<td>Store at -20 &#176;C, keep at 4 &#176;C for up to 1 month</td>
		</tr>
		<tr>
			<td>DAPT</td>
			<td>Sigma Aldrich</td>
			<td>D5942</td>
			<td>Store at -20 &#176;C, stock at 10 mM, 1000x</td>
		</tr>
		<tr>
			<td>Disodium hydrogen phosphate anhydrous</td>
			<td>VWR chemicals</td>
			<td>28026.292</td>
			<td>CAS: 7558-79-4</td>
		</tr>
		<tr>
			<td>Di-sodiumhydrogenphosphate dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>71643</td>
			<td>CAS:10028-24-7</td>
		</tr>
		<tr>
			<td>Dispase</td>
			<td>ThermoFisher Scientific</td>
			<td>17105-041</td>
			<td>Aliquots at 50 U/mL, store at -20 &#176;C until use, 400x</td>
		</tr>
		<tr>
			<td>Disposable Scalpel Sterile N&#176; 10</td>
			<td>Swann Morton</td>
			<td>3033838</td>
			<td></td>
		</tr>
		<tr>
			<td>DM4000 microscope</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>dNTPs 25 mM</td>
			<td>Promega</td>
			<td>U1420</td>
			<td>Mix all 4 nucleotides together, Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Dpn1</td>
			<td>New England Biolabs</td>
			<td>R0176</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Phosphate-bufferd Saline (DPBS)</td>
			<td>Gibco</td>
			<td>14190144</td>
			<td>1x</td>
		</tr>
		<tr>
			<td>Easy strainers 70 &#181;m</td>
			<td>Greiner</td>
			<td>542170</td>
			<td></td>
		</tr>
		<tr>
			<td>Electroporation cuvette</td>
			<td>Nepagene</td>
			<td>EC002S</td>
			<td></td>
		</tr>
		<tr>
			<td>EnVision+/HRP mouse</td>
			<td>Agilent</td>
			<td>K400111-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol 100%</td>
			<td>BOOM</td>
			<td>84045206;5000</td>
			<td>CAUTION, Use to prepare other Ethanol dilutions</td>
		</tr>
		<tr>
			<td>Ethanol 70%</td>
			<td>BOOM</td>
			<td>84010059.5000</td>
			<td>CAUTION</td>
		</tr>
		<tr>
			<td>Ethanol 96%</td>
			<td>BOOM</td>
			<td>84050065.5000</td>
			<td>CAUTION</td>
		</tr>
		<tr>
			<td>EVOS FL Auto 2 Cell Imaging System</td>
			<td>ThermoFisher Scientific</td>
			<td></td>
			<td>Live-imaging brightfield microscrope</td>
		</tr>
		<tr>
			<td>FGF10</td>
			<td>Peprotech</td>
			<td>100-26</td>
			<td>Store at -20 &#176;C, stock at 100 mg/mL in base medium, 100x</td>
		</tr>
		<tr>
			<td>Fiji</td>
			<td>NIH, Fiji developers</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde solution 4%</td>
			<td>Sigma-Aldrich</td>
			<td>1.00496</td>
			<td>CAS: 50-00-0, CAUTION</td>
		</tr>
		<tr>
			<td>Forskolin</td>
			<td>Tocris</td>
			<td>1099</td>
			<td>Store at -20 &#176;C, stock at 10 mM, 10000x</td>
		</tr>
		<tr>
			<td>Glutamax</td>
			<td>Gibco</td>
			<td>35050-061</td>
			<td>100x</td>
		</tr>
		<tr>
			<td>GoTaq G2 Flexi DNA Polymerase</td>
			<td>Promega</td>
			<td>M7805</td>
			<td>Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Haematoxylin</td>
			<td>VWR chemicals</td>
			<td>10047105</td>
			<td>Store at room temperature</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Gibco</td>
			<td>15630-080</td>
			<td>Store at 4 &#176;C, 100x</td>
		</tr>
		<tr>
			<td>Histocore H and C, Tissue embedding machine</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Hot plate</td>
			<td>Meidax</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human nucleolar antigen antibody</td>
			<td>Abcam</td>
			<td>ab-190710</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrochloric acid 5 N</td>
			<td>ThermoFisher Scientific</td>
			<td>10605882</td>
			<td>CAS: 7647-01-0, CAUTION</td>
		</tr>
		<tr>
			<td>Hydrogen peroxyde 30%</td>
			<td>Chem-lab</td>
			<td>CL00.2308.1000</td>
			<td>CAS: 7722-84-1, CAUTION</td>
		</tr>
		<tr>
			<td>Hygromycin B-gold</td>
			<td>InvivoGen</td>
			<td>ant-hg</td>
			<td>Stock at 100 mg/&#181;L, 1000x</td>
		</tr>
		<tr>
			<td>Hygromycin resistance cassette-containing plasmid</td>
			<td></td>
			<td></td>
			<td>Andersson-Rolf et al, Nature Methods, 2017. doi: 10.1038/nmeth.4156</td>
		</tr>
		<tr>
			<td>IsoFlo 100%</td>
			<td>Mecan</td>
			<td>5960501</td>
			<td></td>
		</tr>
		<tr>
			<td>LB medium</td>
			<td>Hubrecht Institute</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2 25 mM</td>
			<td>Promega</td>
			<td>A351H</td>
			<td>Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Microtome RM2235</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Midiprep DNA isolation kit</td>
			<td>ThermoFisher Scientific</td>
			<td>K210005</td>
			<td></td>
		</tr>
		<tr>
			<td>Miniprep DNA isolation kit</td>
			<td>ThermoFisher scientific</td>
			<td>K210003</td>
			<td></td>
		</tr>
		<tr>
			<td>N-acetylcysteine</td>
			<td>Sigma Aldrich</td>
			<td>A9165</td>
			<td>Store at -20 &#176;C, stock at 500 mM, 400x</td>
		</tr>
		<tr>
			<td>NEPA21 electroporator</td>
			<td>Nepagene</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nicotinamide</td>
			<td>Sigma Aldrich</td>
			<td>N0636</td>
			<td>Store at -20 &#176;C, stock at 1M, 100x</td>
		</tr>
		<tr>
			<td>NOD Scid Gamma (NSG) mice</td>
			<td>Hubrecht Institute colony</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Noggin conditioned medium</td>
			<td>U-Protein Express</td>
			<td>Custom order</td>
			<td>Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Noradrenaline</td>
			<td>Sigma Aldrich</td>
			<td>A7257</td>
			<td>Store at -20 &#176;C, stock at 100 mM</td>
		</tr>
		<tr>
			<td>Oven</td>
			<td>Memmert</td>
			<td></td>
			<td>Set at 58 &#176;C</td>
		</tr>
		<tr>
			<td>P20, P200 and P1000 pipettes</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin</td>
			<td>VWR chemicals</td>
			<td>10048502</td>
			<td></td>
		</tr>
		<tr>
			<td>Pasteur pipettes, glass plugged</td>
			<td>ThermoFisher Scientific</td>
			<td>1150-6973</td>
			<td></td>
		</tr>
		<tr>
			<td>Pax6_C&#62;T_F: AGACTGTTCCAGGATGGCTG&#160;</td>
			<td>IDT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pax6_C&#62;T_R: TCTCCTAGGTACTGGAAGCC&#160;</td>
			<td>IDT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pCMV_ABEmax_P2A_GFP</td>
			<td>Addgene</td>
			<td>112101</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Invitrogen</td>
			<td>15140-122</td>
			<td>Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Pertex</td>
			<td>Klinipath</td>
			<td>AM-08010</td>
			<td></td>
		</tr>
		<tr>
			<td>pFYF1320&#160;</td>
			<td>Addgene</td>
			<td>47511</td>
			<td></td>
		</tr>
		<tr>
			<td>Primocin</td>
			<td>InvivoGen</td>
			<td>ant-pm-1</td>
			<td>1000X, store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Prostaglandin E2 (PGE2)</td>
			<td>Tocris</td>
			<td>2296</td>
			<td>Store at -20 &#176;C, stock at 10 mM, 10000x</td>
		</tr>
		<tr>
			<td>Petri dish, 10 cm</td>
			<td>Greiner</td>
			<td>633102</td>
			<td></td>
		</tr>
		<tr>
			<td>Q5 buffer</td>
			<td>New England Biolabs</td>
			<td>B9027S</td>
			<td></td>
		</tr>
		<tr>
			<td>Q5 high-fidelity DNA polymerase</td>
			<td>New England Biolabs</td>
			<td>M0491S</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>QuickExtract DNA Extraction Solution</td>
			<td>Lucigen</td>
			<td>QE09050</td>
			<td>Store aliquots at -20 &#176;C</td>
		</tr>
		<tr>
			<td>R-spondin 3 conditioned medium</td>
			<td>U-Protein Express</td>
			<td>Custom order</td>
			<td>Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>sgRNA Reverse Primer: TCTGCGCCCATCTGTTGCTT CGGTGTTTCGTCCTTTCCACAAG</td>
			<td>IDT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Slides</td>
			<td>StarFrost</td>
			<td>MBB-0302-55A</td>
			<td>Adhesive, ground</td>
		</tr>
		<tr>
			<td>Sodium azide</td>
			<td>Merck</td>
			<td>8.22335.1000</td>
			<td>CAS: 26628-22-8, CAUTION</td>
		</tr>
		<tr>
			<td>Sodium cytrate dihydrate</td>
			<td>J.T. Baker</td>
			<td>0280</td>
			<td>CAS: 6132-04-3</td>
		</tr>
		<tr>
			<td>Standard Forward Primer: &#8220;/5phos/ GTTTTAGAGCTAGAAATAGCAAG 
			TTAAAATAAGGC</td>
			<td>IDT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Subcloning efficiency competent cells DH5alpha</td>
			<td>Invitrogen</td>
			<td>18265-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Suspension cell culture plates (24-well)</td>
			<td>Greiner Bio-One</td>
			<td>662102</td>
			<td>24-well</td>
		</tr>
		<tr>
			<td>Suspension cell culture plates (12-well)</td>
			<td>Greiner Bio-One</td>
			<td>665102</td>
			<td>12-well</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td>M0202</td>
			<td></td>
		</tr>
		<tr>
			<td>TAE buffer</td>
			<td>ThermoFisher Scientific</td>
			<td>B49</td>
			<td>Stock at 50x, dilute to 1x with ultrapure water</td>
		</tr>
		<tr>
			<td>Transposase-containing plasmid</td>
			<td></td>
			<td></td>
			<td>Andersson-Rolf et al, Nature Methods, 2017. doi: 10.1038/nmeth.4156</td>
		</tr>
		<tr>
			<td>TrypLE Express Enzyme</td>
			<td>Invitrogen</td>
			<td>12605-028</td>
			<td>store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>U6_Forward primer: GGGCAGGAAGAGGGCCTAT</td>
			<td>IDT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure Agarose 1000</td>
			<td>Invitrogen</td>
			<td>16550</td>
			<td></td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Tulabo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Xylene</td>
			<td>Klinipath</td>
			<td>4055-9005</td>
			<td>CAS: 1330-20-7, CAUTION</td>
		</tr>
		<tr>
			<td>Y-27632</td>
			<td>Abmole Bioscience</td>
			<td>Y-27632 dihydrochloride</td>
			<td>Store at -20 &#176;C, stock at 10 mM, 1000x</td>
		</tr>
	</tbody>
</table>

establishment, maintenance, differentiation, genetic manipulation, and transplantation of mouse and human lacrimal gland organoids

The lacrimal gland is an essential organ for ocular surface homeostasis. By producing the aqueous part of the tear film, it protects the eye from desiccation stress and external insults. Little is known about lacrimal gland (patho)physiology because of the lack of adequate in vitro models. Organoid technology has proven itself as a useful experimental platform for multiple organs. Here, we share a protocol to establish and maintain mouse and human lacrimal gland organoids starting from lacrimal gland biopsies. By modifying the culture conditions, we enhance lacrimal gland organoid functionality. Organoid functionality can be probed through a "crying" assay, which involves exposing the lacrimal gland organoids to selected neurotransmitters to trigger tear release in their lumen. We explain how to image and quantify this phenomenon. To investigate the role of genes of interest in lacrimal gland homeostasis, these can be genetically modified. We thoroughly describe how to genetically modify lacrimal gland organoids using base editors-from guide RNA design to organoid clone genotyping. Lastly, we show how to probe the regenerative potential of human lacrimal gland organoids by orthotopic implantation in the mouse. Together, this comprehensive toolset provides resources to use mouse and human lacrimal gland organoids to study lacrimal gland (patho)physiology.

Following the dissection of the mouse lacrimal gland (Figure 2A), the enzymatic and mechanical digestion generated small tissue fragments, among which the acini and ducts could be distinguished (Figure 2B). The remaining large pieces of tissue would destabilize the ECM, which would reduce initial organoid outgrowth. The mouse lacrimal gland organoid derivation was successful when cystic organoids of ~500 &#181;m diameter were found after ~7 days, the stage at which the organoids were ready to be split (Figure 2C). Even if the overall organoid derivation is successful, some organoids may begin to grow before stopping eventually. Human lacrimal gland organoids grew out as cysts within 3-4 days and reached full-grown size in 10-14 days after tissue isolation (Figure 2D). For both mice and humans, organoid derivation sometimes failed, with no or few organoids growing out; this was generally caused by over-digestion of the tissue. The mouse lacrimal gland organoids could be passaged at least 40x and the human organoids at least 20x. Passaging was done every 7-10 days on average, depending on the organoid growth.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65040/65040fig02.jpg" /> 
Figure 2: Establishment of mouse and human lacrimal gland organoids.&#160;(A) Photographs of the different stages of mouse lacrimal gland dissection. The arrow points at the lacrimal gland under its protective membrane. (B) Brightfield images of mouse lacrimal gland cells right after tissue digestion, with insets showing an acinus and a duct. (C) Brightfield images of a successful and an unsuccessful mouse lacrimal gland organoid derivation. (D) Brightfield images of human organoid outgrowth over the course of 14 days.&#160;<a href="https://www.jove.com/files/ftp_upload/65040/65040fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The lacrimal gland organoids contain a large proportion of stem cells when cultured in the expansion medium. To increase their differentiation level, we set up a mouse and a human differentiation medium with reduced growth factor content. After 5 days and 7 days, respectively, in the differentiation medium, the mouse and human lacrimal gland organoids became denser (Figure 3A-B). This morphological change correlated with increased functional properties. Applying the cyclic AMP activator forskolin or the neurotransmitter norepinephrine resulted in organoid swelling (i.e., apical water secretion) within less than 3 h (Figure 3C). When the swelling took longer than 3-4 h, this suggested that the organoids were not differentiated enough and/or did not express functional markers, such as receptors for neurotransmitters.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65040/65040fig03.jpg" /> 
Figure 3: Differentiation of mouse and human lacrimal gland organoids and functional swelling assay in human organoids.&#160;(A)&#160;Brightfield images of mouse lacrimal gland organoids cultured in expansion medium for 7 days and in differentiation medium for 5 days after 2 days in expansion medium. (B) Brightfield images of human lacrimal gland organoids cultured in expansion medium for 11 days and in differentiation medium for 9 days after 2 days in expansion medium. (C) Brightfield images of differentiated human lacrimal gland organoids exposed to fresh differentiation medium (control), to 1 &#181;M forskolin, and to 100 &#181;M norepinephrine over the course of 3 h.&#160;<a href="https://www.jove.com/files/ftp_upload/65040/65040fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
To knock out Pax6 in mouse lacrimal gland organoids, a plasmid containing the chosen Pax6-targeting gRNA was generated by PCR and ligation (Figure 4A). This gRNA-containing plasmid was electroporated along with the Piggy-Bac plasmids (hygromycin resistance transposon-containing and transposase-containing plasmids) and the C &#62; T base editor Cas9 in mouse lacrimal gland organoids dissociated into single cells. After 3 days, when the organoids had recovered, they were exposed to hygromycin to select for clones that had incorporated the hygromycin resistance cassette. In successful electroporations, organoids resistant to hygromycin grew out (Figure 4B). The growing organoid clones that were larger than ~300 &#181;m were picked, ideally before they started to spontaneously differentiate (Figure 4C). DNA was extracted from part of the organoid while keeping the remainder in culture. The PCR amplification of the Pax6 locus targeted by the gRNA yielded a 367 bp band for each of the clones picked (Figure 4D). After sequencing the amplified locus, clones that were homozygously C &#62; T edited (n = 1) were kept. On the other hand, clones that were not edited (n = 4), heterozygously edited, or wrongly edited (n = 1) were discarded (Figure 4E). Overall, using this gRNA targeting Pax6, one homozygous knock-out mouse lacrimal gland clone out of six sequenced was obtained. Some clones grew out well, but some organoid clones were lost after picking or began to differentiate (Figure 4F). Out of the 10 organoid clones picked, 7 grew out well.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/65040/65040fig04.jpg" /> 
Figure 4: Base editing-mediated knock-out of&#160;Pax6&#160;in mouse lacrimal gland organoids.&#160;(A)&#160;Sanger sequencing trace of pFYF1320 after correct integration of the gRNA targeting the&#160;Pax6&#160;locus. (B) Brightfield images of mouse lacrimal gland organoids 5 days after exposure to hygromycin following electroporation. The organoids were cultured in mouse expansion medium. On the left is an example of a failed electroporation, with no clone resistant to hygromycin growing out. On the right is an example of a successful electroporation, with several hygromycin-resistant organoid clones surviving. (C) Brightfield images of clones that should be picked and clones that should not be picked. (D) Agarose gel showing the amplification of the&#160;Pax6&#160;locus targeted with the gRNA. In green, the band of the expected size of 367 bp is highlighted. (E) Sanger sequencing trace of three organoid clones that were resistant to hygromycin. The top clone is unedited. The middle clone is a homozygous C &#62; T edition and, hence, a homozygous knock-out. The bottom clone presents two heterozygous point mutations and is either a heterozygous knock-out or a mixed clone and has been wrongly edited. (F) Brightfield images of the picked organoid clones with various levels of outgrowth.&#160;<a href="https://www.jove.com/files/ftp_upload/65040/65040fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Lastly, to perform human lacrimal gland organoid orthotopic transplantation in mice, organoids that were split 3 days in advance (&#60; 100 &#181;m in diameter) were used. Organoid engraftment was confirmed 1 month after injecting the organoids into the mouse lacrimal gland by staining for a human-specific marker, the human nucleolar antigen (Figure 5). The absence of punctate staining from all the sections of the mouse lacrimal gland signified a lack of human organoid engraftment.
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/65040/65040fig05.jpg" /> 
Figure 5: Transplantation of human lacrimal gland organoids into the mouse lacrimal gland. Staining of transplanted mouse lacrimal glands for the human nucleolar marker to monitor engraftment 1 month after transplantation. <a href="https://www.jove.com/files/ftp_upload/65040/65040fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Supplementary Table 1: Composition of the media and buffers. <a href="https://www.jove.com/files/ftp_upload/65040/Supplementary Table 1.xlsx" target="_blank">Please click here to download this Table.</a>

Watch this Scientific Journal Video about Establishment, Maintenance, Differentiation, Genetic Manipulation, and Transplantation of Mouse and Human Lacrimal Gland Organoids at JoVE.com

Establishment, Maintenance, Differentiation, Genetic Manipulation, and Transplantation of Mouse and Human Lacrimal Gland Organoids

This protocol describes how to establish, maintain, genetically modify, differentiate, functionally characterize, and transplant lacrimal gland organoids derived from primary mouse and human tissue.

The lacrimal gland is an essential organ for ocular surface homeostasis. By producing the aqueous part of the tear film, it protects the eye from ...

establishment-maintenance-differentiation-genetic-manipulation

Research

JoVE Journal

Biology

2.6K Views.  University Medical Center Utrecht. This protocol describes how to establish, maintain, genetically modify, differentiate, functionally characterize, and transplant lacrimal gland organoids derived from primary mouse and human tissue.

Video: Establishment, Maintenance, Differentiation, Genetic Manipulation, and Transplantation of Mouse and Human Lacrimal Gland Organoids

Culture and Maintenance of Human Embryonic Stem Cells  

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be  fed  every day by performing a complete medium change to replenish lost nutrients and to keep the cultures free of unwanted differentiation factors. Although a small amount of differentiation is normal and expected in stem cell cultures, the culture should be routinely cleaned up by manually removing, or "picking" differentiated areas. Identifying and removing excess differentiation from hES cell cultures are essential techniques in the maintenance of a healthy population of cells.

Culture and Maintenance of Human Embryonic Stem Cells

This protocol demonstrates how to maintain healthy, undifferentiated human embryonic stem (ES) cells.

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and a working heart on the other. Thus, cardiomyocytes serve as good models for cardiac cellular physiology and pathophysiology, for pharmaceutical investigations as well as for the exploration of transgenic animal models. Here we describe a method of isolating the cells from the heart. Furthermore we show how a genetic manipulation on cardiac myocytes can be performed without breeding a transgenic animal: This is the combination of long term culture (1 week) and adenoviral gene transfer. The latter one is described from the construction of the virus to the transduction of the cells. It can be used for the expression of genetically encoded biosensors (GEBs), fluorescent fusion proteins, but also for protein over expression and down regulation, e.g. using RNAi. Here we provide an example for the expression of a fusion protein staining a subcellular structure (Golgi). Such protein expression can be visualized by confocal imaging of z-stacks for a 3D-reconstruction of subcellular structures. The protocol comprises state-of-the-art in cell culture, molecular biology and biophysics and thus provides an approach for exploring new horizons in cellular cardiology.

Adult cardiac myocytes are primary cells that can be isolated from animal hearts and cultured for several days. Within this culture period adenoviral gene transfer can be used to express genetically encoded biosensors (GEBs) or fluorescent fusion proteins. Both approaches allow cellular investigations by means of confocal microscopy.

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and ...

Genetic Modification and Recombination of Salivary Gland Organ Cultures

Branching morphogenesis occurs during the development of many organs, and the embryonic mouse submandibular gland (SMG) is a classical model for the study of branching morphogenesis. In the developing SMG, this process involves iterative steps of epithelial bud and duct formation, to ultimately give rise to a complex branched network of acini and ducts, which serve to produce and modify/transport the saliva, respectively, into the oral cavity1-3. The epithelial-associated basement membrane and aspects of the mesenchymal compartment, including the mesenchyme cells, growth factors and the extracellular matrix, produced by these cells, are critical to the branching mechanism, although how the cellular and molecular events are coordinated remains poorly understood 4. The study of the molecular mechanisms driving epithelial morphogenesis advances our understanding of developmental mechanisms and provides insight into possible regenerative medicine approaches. Such studies have been hampered due to the lack of effective methods for genetic manipulation of the salivary epithelium. Currently, adenoviral transduction represents the most effective method for targeting epithelial cells in adult glands in vivo5. However, in embryonic explants, dense mesenchyme and the basement membrane surrounding the epithelial cells impedes viral access to the epithelial cells. If the mesenchyme is removed, the epithelium can be transfected using adenoviruses, and epithelial rudiments can resume branching morphogenesis in the presence of Matrigel or laminin-1116,7. Mesenchyme-free epithelial rudiment growth also requires additional supplementation with soluble growth factors and does not fully recapitulate branching morphogenesis as it occurs in intact glands8. Here we describe a technique which facilitates adenoviral transduction of epithelial cells and culture of the transfected epithelium with associated mesenchyme. Following microdissection of the embryonic SMGs, removal of the mesenchyme, and viral infection of the epithelium with a GFP-containing adenovirus, we show that the epithelium spontaneously recombines with uninfected mesenchyme, recapitulating intact SMG glandular structure and branching morphogenesis. The genetically modified epithelial cell population can be easily monitored using standard fluorescence microscopy methods, if fluorescently-tagged adenoviral constructs are used. The tissue recombination method described here is currently the most effective and accessible method for transfection of epithelial cells with a wild-type or mutant vector within a complex 3D tissue construct that does not require generation of transgenic animals.

A technique to genetically manipulate epithelial cells within whole ex vivo cultured embryonic mouse submandibular glands (SMGs) using viral gene transfer is described. This method takes advantage of the innate ability of SMG epithelium and mesenchyme to spontaneously recombine after separation and infection of epithelial rudiments with adenoviral vectors.

Branching  morphogenesis occurs during the development of many organs, and the embryonic  mouse submandibular gland (SMG) is a classical model for the ...

Generation of Human Cardiomyocytes: A Differentiation Protocol from Feeder-free Human Induced Pluripotent Stem Cells

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is essential first to generate functional human cardiomyocytes (CMs). The use of these cells in drug discovery and toxicology studies would also be highly beneficial, allowing new pharmacological molecules for the treatment of cardiac disorders to be validated pre-clinically on cells of human origin. Of the possible sources of CMs, induced pluripotent stem (iPS) cells are among the most promising, as they can be derived directly from readily accessible patient tissue and possess an intrinsic capacity to give rise to all cell types of the body 1. Several methods have been proposed for differentiating iPS cells into CMs, ranging from the classical embryoid bodies (EBs) aggregation approach to chemically defined protocols 2,3. In this article we propose an EBs-based protocol and show how this method can be employed to efficiently generate functional CM-like cells from feeder-free iPS cells.

Pluripotent stem cells, either embryonic or induced pluripotent stem (iPS) cells, constitute a valuable source of human differentiated cells, including cardiomyocytes. Here, we will focus on cardiac induction of iPS cells, showing how to use them to obtain functional human cardiomyocytes through an embryoid bodies-based protocol.

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is ...

Alternative Cultures for Human Pluripotent Stem Cell Production, Maintenance, and Genetic Analysis

Human pluripotent stem cells (hPSCs) hold great promise for regenerative medicine and biopharmaceutical applications. Currently, optimal culture and efficient expansion of large amounts of clinical-grade hPSCs are critical issues in hPSC-based therapies. Conventionally, hPSCs are propagated as colonies on both feeder and feeder-free culture systems. However, these methods have several major limitations, including low cell yields and generation of heterogeneously differentiated cells. To improve current hPSC culture methods, we have recently developed a new method, which is based on non-colony type monolayer (NCM) culture of dissociated single cells. Here, we present detailed NCM protocols based on the Rho-associated kinase (ROCK) inhibitor Y-27632. We also provide new information regarding NCM culture with different small molecules such as Y-39983 (ROCK I inhibitor), phenylbenzodioxane (ROCK II inhibitor), and thiazovivin (a novel ROCK inhibitor). We further extend our basic protocol to cultivate hPSCs on defined extracellular proteins such as the laminin isoform 521 (LN-521) without the use of ROCK inhibitors. Moreover, based on NCM, we have demonstrated efficient transfection or transduction of plasmid DNAs, lentiviral particles, and oligonucleotide-based microRNAs into hPSCs in order to genetically modify these cells for molecular analyses and drug discovery. The NCM-based methods overcome the major shortcomings of colony-type culture, and thus may be suitable for producing large amounts of homogeneous hPSCs for future clinical therapies, stem cell research, and drug discovery.

Here, we present human pluripotent stem cell (hPSC) culture protocols, based on non-colony type monolayer (NCM) growth of dissociated single cells. This new method, utilizing Rho-associated kinase inhibitors or the laminin isoform 521 (LN-521), is suitable for producing large amounts of homogeneous hPSCs, genetic manipulation, and drug discovery.

Human pluripotent stem cells (hPSCs) hold great promise for regenerative medicine and biopharmaceutical applications. Currently, optimal culture and ...

Manipulating the Murine Lacrimal Gland

The lacrimal gland (LG) secretes aqueous tears necessary for maintaining the structure and function of the cornea, a transparent tissue essential for vision. In the human a single LG resides in the orbit above the lateral end of each eye delivering tears to the ocular surface through 3 - 5 ducts. The mouse has three pairs of major ocular glands, the most studied of which is the exorbital lacrimal gland (LG) located anterior and ventral to the ear. Similar to other glandular organs, the LG develops through the process of epithelial branching morphogenesis in which a single epithelial bud within a condensed mesenchyme undergoes multiple rounds of bud and duct formation to form an intricate interconnected network of secretory acini and ducts. This elaborate process has been well documented in many other epithelial organs such as the pancreas and salivary gland. However, the LG has been much less explored and the mechanisms controlling morphogenesis are poorly understood. We suspect that this under-representation as a model system is a consequence of the difficulties associated with finding, dissecting and culturing the LG. Thus, here we describe dissection techniques for harvesting embryonic and post-natal LG and methods for ex vivo culture of the tissue.

The lacrimal gland (LG) is a branching organ that produces the aqueous components of tears necessary for maintaining vision and ocular health. Here we describe murine LG dissection and ex vivo culture techniques to decipher signaling pathways involved in LG development.

The lacrimal gland (LG) secretes aqueous tears necessary for maintaining the structure and function of the cornea, a transparent tissue essential for ...

Establishment and Maintenance of Gnotobiotic American Cockroaches (Periplaneta americana)

Gnotobiotic animals are a powerful tool for the study of controls on microbiome structure and function. Presented here is a protocol for the establishment and maintenance of gnotobiotic American cockroaches (Periplaneta americana). This approach includes built-in sterility checks for ongoing quality control. Gnotobiotic insects are defined here as cockroaches that still contain their vertically transmitted endosymbiont (Blattabacterium) but lack other microbes that normally reside on their surface and in their digestive tract. For this protocol, egg cases (oothecae) are removed from a (nonsterile) stock colony and surface sterilized. Once collected and sterilized, the oothecae are incubated at 30 &#176;C for approximately 4&#8722;6 weeks on brain-heart infusion (BHI) agar until they hatch or are removed due to contamination. Hatched nymphs are transferred to an Erlenmeyer flask containing a BHI floor, sterile water, and sterile rat food. To ensure that the nymphs are not housing microbes that are unable to grow on BHI in the given conditions, an additional quality control measure uses restriction fragment-length polymorphism (RFLP) to test for nonendosymbiotic microbes. Gnotobiotic nymphs generated using this approach can be inoculated with simple or complex microbial communities and used as a tool in gut microbiome studies.

Establishment and Maintenance of Gnotobiotic American Cockroaches Periplaneta americana

This protocol is used in establishing and maintaining gnotobiotic American cockroaches (Periplaneta americana) by surface sterilizing the egg cases (oothecae) prior to hatching. These gnotobiotic insects contain their vertically transmitted Blattabacterium endosymbionts but have axenic guts.

Gnotobiotic animals are a powerful tool for the study of controls on microbiome structure and function. Presented here is a protocol for the establishment ...

Establishment and Genetic Manipulation of Murine Hepatocyte Organoids

The liver is the largest organ in mammals. It plays an important role in glucose storage, protein secretion, metabolism and detoxification. As the executor for most of the liver functions, primary hepatocytes have limited proliferating capacity. This requires the establishment of ex vivo hepatocyte expansion models for liver physiological and pathological research. Here, we isolated murine hepatocytes by two steps of collagenase perfusion and established a 3D organoid culture as the 'mini-liver' to recapitulate cell-cell interactions and physical functions. The organoids consist of heterogeneous cell populations including progenitors and mature hepatocytes. We introduce the process in detailed to isolate and culture the murine hepatocytes or fetal hepatocyte to form organoids within 2-3 weeks and show how to passage them by mechanically pipetting up and down. In addition, we will also introduce how to digest the organoids into single cells for lentivirus infection of shRNA/ectopic construction, siRNA transfection and CRISPR-Cas9 engineering. The organoids can be used for drug screens, disease modelling, and basic liver research by modeling liver biology and pathobiology.

A long-term ex vitro 3D organoid culture system was established from mouse hepatocytes. These organoids can be passaged and genetically manipulated by lentivirus infection of shRNA/ectopic construction, siRNA transfection and CRISPR-Cas9 engineering.

The liver is the largest organ in mammals. It plays an important role in glucose storage, protein secretion, metabolism and detoxification. As the ...

Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells

Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture method to obtain a sufficient number of LG stem cells (LGSCs) is one obstacle for further research and application. The three-dimensional (3D), serum-free culture method for adult mouse LGSCs is well established and shown here. The LGSCs could be continuously passaged and induced to differentiate to acinar or ductal-like cells.
For the LGSC primary culture, the LGs from 6-8-week-old mice were digested with dispase, collagenase I, and trypsin-EDTA. A total of 1 &#215; 104 single cells were seeded into 80 &#181;L of matrix gel-lacrimal gland stem cell medium (LGSCM) matrix in each well of a 24-well plate, precoated with 20 &#181;L of matrix gel-LGSCM matrix. The mix was solidified after incubation for 20 min at 37 &#176;C, and 600 &#181;L of LGSCM added.
For LGSC maintenance, LGSCs cultured for 7 days were disaggregated into single cells by dispase and trypsin-EDTA. The single cells were implanted and cultured according to the method used in the LGSC primary culture. LGSCs could be passaged over 40 times and continuously express stem/progenitor cell markers Krt14, Krt5, P63, and nestin. LGSCs cultured in LGSCM have self-renewal capacity and can differentiate into acinar or ductal-like cells in vitro and in vivo.

The three-dimensional, serum-free culture method for adult lacrimal gland (LG) stem cells is well established for the induction of LG organoid formation and differentiation into acinar or ductal-like cells.

Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture ...

Establishing Human Lung Organoids and Proximal Differentiation to Generate Mature Airway Organoids

The lack of a robust in vitro model of the human respiratory epithelium hinders the understanding of the biology and pathology of the respiratory system. We describe a defined protocol to derive human lung organoids from adult stem cells in the lung tissue and induce proximal differentiation to generate mature airway organoids. The lung organoids are then consecutively expanded for over 1 year with high stability, while the differentiated airway organoids are used to morphologically and functionally simulate human airway epithelium to a near-physiological level. Thus, we establish a robust organoid model of the human airway epithelium. The long-term expansion of lung organoids and differentiated airway organoids generates a stable and renewable source, enabling scientists to reconstruct and expand the human airway epithelial cells in culture dishes. The human lung organoid system provides a unique and physiologically active in vitro model for various applications, including studying virus-host interaction, drug testing, and disease modeling.

The protocol presents a method to derive human lung organoids from primary lung tissues, expand the lung organoids and induce proximal differentiation to generate 3D and 2D airway organoids that faithfully phenocopy the human airway epithelium.

The lack of a robust in vitro model of the human respiratory epithelium hinders the understanding of the biology and pathology of the respiratory system. ...