We greatly appreciate the valuable advice provided by Prof. J.P. van Pijkeren (University of Wisconsin-Madison), whose guidance on working with L. reuteri ATCC PTA 6475 provided a foundation for the methods described here.

1. Preparing L. reuteri DSM20016 electrocompetent cells
NOTE: This is based on a protocol by Berthier et al.17, with centrifugation speeds informed by Rattanachaikunsopon et al.18.
<ol>
	<li>In a 50 mL centrifuge tube, inoculate L. reuteri from glycerol stock into 6 mL of deMan Rogosa Sharpe (MRS) broth. Incubate aerobically overnight at 37 &#176;C in a static incubator.</li>
	<li>The next morning, inoculate 4 mL of the overnight culture into 200 mL of MRS broth (1:50 dilution).</li>
	<li>Allow to grow aerobically in a static 37 &#176;C incubator until the 600 nm optical density value (OD600) reaches 0.5-0.85; this should take roughly 2-3 h.</li>
	<li>As soon as an adequate OD600 value is reached, decant the media into 50 mL centrifuge tubes and place on ice while balancing the tubes.</li>
	<li>Centrifuge for 5 min at 5,000 x g in a pre-chilled, 4 &#176;C centrifuge.</li>
	<li>Discard the supernatant, resuspend each pellet in 50 mL of pre-chilled (0 &#176;C to 4 &#176;C) ddH2O, and centrifuge again with the same settings as the previous step. Keep the cells on ice as much as possible.</li>
	<li>Repeat step 1.6.</li>
	<li>Resuspend each pellet in 25 mL of ddH2O: 0.5 M sucrose, 10% glycerol. Centrifuge at 5,000 x g at 4 &#176;C for 10 min. Discard the supernatant and put the cells back on ice.</li>
	<li>Resuspend all the pellets in the same 2 mL of ddH2O: 0.5 M sucrose, 10% glycerol.</li>
	<li>Aliquot into 50 &#181;L to 100 &#181;L portions in pre-chilled microcentrifuge tubes; store at -80 &#176;C for later use.</li>
</ol>
2. Electroporation of L. reuteri 
NOTE: Avoid pipetting as much as possible in the following steps. Inclusion of a control electroporation, with no plasmid added, is advised to ensure the antibiotic selection is adequate.
<ol>
	<li>Take an entire electrocompetent L. reuteri aliquot and thaw it on ice.</li>
	<li>Gently mix 5 &#181;L to 10 &#181;L of plasmid (final plasmid concentration &#62;6 nM) into the thawed aliquot, avoiding pipetting as much as possible.</li>
	<li>Transfer to an ice-chilled, 1 mm gap electroporation cuvette.</li>
	<li>Electroporate at 1.25 kV, 400 &#8486;, and 25 &#181;F.</li>
	<li>Add 1 mL of room temperature (RT) MRS broth and mix by inverting the cuvette once or twice.</li>
	<li>Place the cuvettes into a static incubator at 37 &#176;C for 2.5-3 h to allow for recovery.</li>
	<li>Plate the entire amount onto multiple MRS agar plates with appropriate selection.</li>
	<li>Place the plates inside a completely airtight container with a small lit candle (&#34;tealight&#34;) and an anaerobic atmosphere-generating sachet.</li>
	<li>Grow at 37 &#176;C for 2-3 days or until visible colonies are present.</li>
</ol>
3. Measurement of the acid-resistant fluorescent reporter protein mCherry2
<ol>
	<li>Pick any colonies required for measurement and inoculate into a 96-well storage microplate with 1.5 mL of filter sterilized (non-autoclaved) MRS broth per well and an appropriate selection antibiotic.</li>
	<li>Incubate aerobically for 24 h overnight at 37 &#176;C without shaking. 
	NOTE: This storage microplate should be kept for use in section 4 (colony PCR).</li>
	<li>L. reuteri will precipitate out of the media when in the stationary phase; resuspend the overnight culture via pipetting.</li>
	<li>Transfer 200 &#181;L into a flat, clear-bottom, 96-well plate, transfer the plate to a plate reader, and measure the OD and fluorescence of mCherry2 (excitation [Ex]: 589 nm; emission [Em]: 610 nm) or other relevant reporters.</li>
</ol>
4. Confirmation of plasmid uptake via colony PCR
<ol>
	<li>From the 96-well storage microplate from section 3, transfer 5 &#181;L to a PCR tube. 
	NOTE: If &#62;5 min have passed, it may be necessary to resuspend the L. reuteri a second time.</li>
	<li>In a portable benchtop microcentrifuge, spin down until the pellet can be seen (roughly 2 min at 2,000 x g), discard the supernatant, and resuspend the pellet in 20 &#181;L of 20 mM NaOH.</li>
	<li>Boil at 95 &#176;C for 5 min, vortex, and repeat the boil a second time.</li>
	<li>Immediately chill the samples; try to keep the samples on ice as much as possible in the following steps to lower the likelihood of template degradation and PCR inhibition.</li>
	<li>Spin down in a portable benchtop microcentrifuge at 2,000 x g for 2 min until the cell debris is pelleted, then take 1 &#181;L of the supernatant and dilute into 99 &#181;L of ice-cold DNase- and RNase-free ddH2O (100x dilution).</li>
	<li>Use the 100x dilution as the template DNA in a standard PCR reaction using plasmid-specific primers. Include a positive control with a plasmid derived from the E. coli mini-prep.</li>
	<li>Return the samples on ice and add an appropriate loading dye at a 1x concentration.</li>
	<li>Run in 1% agarose gel in TAE buffer (tris-acetate-ethylenediaminetetraacetic acid [EDTA]) at 110 V for 30 min. Image if necessary.</li>
</ol>
5. Mini-prep protocol for L. reuteri , followed by PCR to confirm plasmid presence
NOTE: Protocol intended for use with the mini-prep kit listed in the Table of Materials.
<ol>
	<li>Inoculate L. reuteri into 10 mL of MRS broth containing an appropriate antibiotic and incubate overnight aerobically at 37 &#176;C in a static incubator.</li>
	<li>Centrifuge at 5,000 x g for 10 min in a pre-chilled 4 &#176;C centrifuge.</li>
	<li>Wash the pellet in 2 mL of standard P1 buffer (included with the kit)&#160;in order to negate acidity that may interfere with later steps, centrifuge with the same setting as previously described, and discard the supernatant.</li>
	<li>Resuspend the pellet in 250 &#181;L of modified P1 buffer containing 10 mg/mL lysozyme and 100 U/mL mutanolysin in order to lyse bacterial cells. Incubate for 1-2 h at 37 &#176;C.</li>
	<li>Add 250 &#181;L of buffer P2, mix by inverting four to six times, and incubate at RT for no longer than 5 min.</li>
	<li>Add 350 &#181;L of buffer N3 (included with the kit) and immediately invert four to six times gently to mix.</li>
	<li>Centrifuge at 10,000 x g for 10 min.</li>
	<li>Transfer as much supernatant as possible to a spin column and centrifuge at 10,000 x g for 60 s. Discard the flow through.</li>
	<li>Wash the spin column with 500 &#181;L of buffer PB (included with the kit) and centrifuge at 10,000 x g for 60 s. Discard the flow through.</li>
	<li>Wash the spin column with 750 &#181;L of buffer PE (included with the kit), and centrifuge at 10,000 x g for 60 s. Discard the flow through and centrifuge for 60 s to remove any residual buffer.</li>
	<li>Place the spin column in a 1.5 mL microcentrifuge tube. Apply 20-30 &#181;L of DNAse- and RNAse-free ddH2O to the filter of the spin column and leave for 1-2 min, before centrifuging at 10,000 x g for 60 s.</li>
	<li>Perform a standard PCR reaction using plasmid-specific primers (pTRKH3_pTUSeq_F: CACCCGTTCTCGGAGCA, pTRKH3_pTUSeq_R: CTACGAGTTGCATGATAAAGAAGACA), with eluate providing the template DNA. Include a positive control with a plasmid derived from the E. coli mini-prep. 
	NOTE: The PCR settings used in this study are: 98 &#176;C for 5 min, (98 &#176;C for 30 s, 55 &#176;C for 30 s, 72 &#176;C for 45 s) 30 cycles, 72 &#176;C for 2 min, 4 &#176;C hold. The parameters are highly dependent on the polymerase used, fragment length, and exact primers used by any person utilizing this protocol.</li>
</ol>

Measurement of Reporter Proteins in Limosilactobacillus reuteri DSM20016

<ol>
	<li>Makarova, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+genomics+of+the+lactic+acid+bacteria.">Comparative genomics of the lactic acid bacteria.</a> Proceedings of the National Academy of Sciences. 103 (42), 15611-15616 (2006).</li><li>Zheng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+taxonomic+note+on+the+genus+Lactobacillus:+Description+of+23+novel+genera,+emended+description+of+the+genus+Lactobacillus+beijerinck+1901,+and+union+of+Lactobacillaceae+and+Leuconostocaceae.">A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae.</a> International Journal of Systematic and Evolutionary Microbiology. 70 (4), 2782-2858 (2020).</li><li>Adams, M. R., Marteau, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+safety+of+lactic+acid+bacteria+from+food.">On the safety of lactic acid bacteria from food.</a> International Journal of Food Microbiology. 27 (2-3), 263-264 (1995).</li><li>Urba&#324;ska, M., Gieruszczak-Bia&#322;ek, D., Szajewska, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+review+with+meta-analysis:+Lactobacillus+reuteri+DSM+17938+for+diarrhoeal+diseases+in+children.">Systematic review with meta-analysis: Lactobacillus reuteri DSM 17938 for diarrhoeal diseases in children.</a> Alimentary Pharmacology and Therapeutics. 43 (10), 1025-1034 (2016).</li><li>Jansson, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probiotic+treatment+using+a+mix+of+three+Lactobacillus+strains+for+lumbar+spine+bone+loss+in+postmenopausal+women:+a+randomised,+double-blind,+placebo-controlled,+multicentre+trial.">Probiotic treatment using a mix of three Lactobacillus strains for lumbar spine bone loss in postmenopausal women: a randomised, double-blind, placebo-controlled, multicentre trial.</a> The Lancet Rheumatology. 1 (3), e154-e162 (2019).</li><li>Yang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+non-viable+Lactobacillus+reuteri+combining+with+14-day+standard+triple+therapy+on+Helicobacterpylori+eradication:+A+randomized+double-blind+placebo-controlled+trial.">Effects of non-viable Lactobacillus reuteri combining with 14-day standard triple therapy on Helicobacterpylori eradication: A randomized double-blind placebo-controlled trial.</a> Helicobacter. 26 (6), 12856 (2021).</li><li>Nikawa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lactobacillus+reuteri+in+bovine+milk+fermented+decreases+the+oral+carriage+of+mutans+streptococci.">Lactobacillus reuteri in bovine milk fermented decreases the oral carriage of mutans streptococci.</a> International Journal of Food Microbiology. 95 (2), 219-223 (2004).</li><li>Reuter, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Lactobacillus+and+Bifidobacterium+microflora+of+the+human+intestine:+Composition+and+succession.">The Lactobacillus and Bifidobacterium microflora of the human intestine: Composition and succession.</a> Current Issues in Intestinal Microbiology. 2 (2), 43-53 (2001).</li><li>Aukrust, T. W., Brurberg, M. B., Nes, I. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Lactobacillus+by+electroporation.">Transformation of Lactobacillus by electroporation.</a> Methods in Molecular Biology. 47, 201-208 (1995).</li><li>Lubkowicz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+probiotic+Lactobacillus+reuteri+as+a+biosensor+for+Staphylococcus+aureus+derived+AIP-I+detection.">Reprogramming probiotic Lactobacillus reuteri as a biosensor for Staphylococcus aureus derived AIP-I detection.</a> ACS Synthetic Biology. 7 (5), 1229-1237 (2018).</li><li>Walter, J., Britton, R. A., Roos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-microbial+symbiosis+in+the+vertebrate+gastrointestinal+tract+and+the+Lactobacillus+reuteri+paradigm.">Host-microbial symbiosis in the vertebrate gastrointestinal tract and the Lactobacillus reuteri paradigm.</a> Proceedings of the National Academy of Sciences. 108, 4645-4652 (2011).</li><li>Ahmad, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+bimodal+molecular+weight+levan+by+a+Lactobacillus+reuteri+isolate+from+fish+gut.">Production of bimodal molecular weight levan by a Lactobacillus reuteri isolate from fish gut.</a> Folia Microbiologica. 67 (1), 21-31 (2022).</li><li>MacKenzie, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain-specific+diversity+of+mucus-binding+proteins+in+the+adhesion+and+aggregation+properties+of+Lactobacillus+reuteri.">Strain-specific diversity of mucus-binding proteins in the adhesion and aggregation properties of Lactobacillus reuteri.</a> Microbiology. 156 (11), 3368-3378 (2010).</li><li>Oh, J. H., van Pijkeren, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9-assisted+recombineering+in+Lactobacillus+reuteri.">CRISPR-Cas9-assisted recombineering in Lactobacillus reuteri.</a> Nucleic Acids Research. 42 (17), 131 (2014).</li><li>Song, X., Huang, H., Xiong, Z., Ai, L., Yang, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9D10A+nickase-assisted+genome+editing+in+Lactobacillus+casei.">CRISPR-Cas9D10A nickase-assisted genome editing in Lactobacillus casei.</a> Applied and Environmental Microbiology. 83 (22), e01259 (2017).</li><li>Goh, Y. J., Barrangoua, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Portable+CRISPR-Cas9N+system+for+flexible+genome+engineering+in+Lactobacillus+acidophilus,+Lactobacillus+gasseri,+and+Lactobacillus+paracasei.">Portable CRISPR-Cas9N system for flexible genome engineering in Lactobacillus acidophilus, Lactobacillus gasseri, and Lactobacillus paracasei.</a> Applied and Environmental Microbiology. 87 (6), e02669 (2021).</li><li>Berthier, F., Zagorec, M., Champomier-Verg, M., Ehrlich, S. D., Morel-Devillel, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+Lactobacillus+sake+by+electroporation.">Efficient transformation of Lactobacillus sake by electroporation.</a> Microbiology. 142 (5), 1273-1279 (1996).</li><li>Rattanachaikunsopon, P., Phumkhachorn, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glass+bead+transformation+method+for+gram-positive+bacteria.">Glass bead transformation method for gram-positive bacteria.</a> Brazilian Journal of Microbiology. 40 (4), 923 (2009).</li><li>Pfl&#252;gl, S., Marx, H., Mattanovich, D., Sauer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+Lactobacillus+diolivorans.">Genetic engineering of Lactobacillus diolivorans.</a> FEMS Microbiology Letters. 344 (2), 152-158 (2013).</li><li>Spath, K., Heinl, S., Grabherr, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+cloning+in+Lactobacillus+plantarum:+Electroporation+with+non-methylated+plasmid+DNA+enhances+transformation+efficiency+and+makes+shuttle+vectors+obsolete.">Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete.</a> Microbial Cell Factories. 11, 141 (2012).</li><li>Ortiz-Velez, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+alterations+associated+with+improved+transformation+efficiency+in+Lactobacillus+reuteri.">Genome alterations associated with improved transformation efficiency in Lactobacillus reuteri.</a> Microbial Cell Factories. 17 (1), 138 (2018).</li><li>O'Sullivan, D. J., Klaenhammer, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+mini-prep+isolation+of+high-quality+plasmid+DNA+from+Lactococcus+and+Lactobacillus+spp.">Rapid mini-prep isolation of high-quality plasmid DNA from Lactococcus and Lactobacillus spp.</a> Applied and Environmental Microbiology. 59 (8), 2730-2733 (1993).</li><li>Lizier, M., Sarra, P. G., Cauda, R., Lucchini, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+expression+vectors+in+Lactobacillus+reuteri+strains.">Comparison of expression vectors in Lactobacillus reuteri strains.</a> FEMS Microbiology Letters. 308 (1), 8-15 (2010).</li><li>Roberts, R. J., Vincze, T., Posfai, J., Macelis, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=REBASE-a+database+for+DNA+restriction+and+modification:+Enzymes,+genes+and+genomes.">REBASE-a database for DNA restriction and modification: Enzymes, genes and genomes.</a> Nucleic Acids Research. 43, D298-D299 (2015).</li><li>Ahrne, S., Molin, G., Axelsson, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Lactobacillus+reuteri+with+electroporation:+Studies+on+the+erythromycin+resistance+plasmid+pLUL631.">Transformation of Lactobacillus reuteri with electroporation: Studies on the erythromycin resistance plasmid pLUL631.</a> Current Microbiology. 24, 199-205 (1992).</li></ol>

No conflicts of interest exist.

The most critical step for the transformation of L. reuteri DSM20016 is the generation of anaerobic growth conditions after transformations are plated; colonies gained in aerobic conditions are only very occasional and generally fail to grow when inoculated in MRS broth. Plating the entire recovery volume should also be practiced to maximize the probability of colony growth. Even with these two critical steps, transformation efficiency is still a limitation on experimentation, as expected colonies can number as ...

The genus Lactobacillus were historically classified as gram-positive, rod-shaped, non-spore-forming, either facultative anaerobes or microaerophiles that break sugars down to primarily produce lactic acid1. These loose criteria led to Lactobacillus being, phenotypically and genotypically, an extremely diverse genus. This broad categorization resulted in the genus being reclassified, introducing 23 novel genera in 20202.
The old, broader genus included major commensal and probiotic species generally regarded as safe (GRAS) for consumption3. The Lactobacillaceae family maintains a public perception of being &#39;good bacteria&#39; due to many reported health benefits bestowed via the consumption of various strains4,5,6,7. The ease with which they can navigate the gastrointestinal tract8 and their public acceptance combine to position Lactobacillaceae strains as strong candidates as chassis organisms for ingestible medicinal, therapeutic, or diagnostic applications.
The wide range of characteristics present within the Lactobacillaceae family has led to a situation in which there is no de facto model-organism strain; research groups have tended to select species with the properties most relevant to their particular aims. (For example, dairy fermentation labs could choose L. lactis; studies of vegetable fermentation might select L. plantarum; research on probiotics might focus on L. acidophilus; and so on.)
This same wide range of characteristics across species has led to an accumulation of protocols and procedures that may work well for one subset of the Lactobacillaceae family, but require optimization to work efficiently (or perhaps to function at all) in others9. This need for optimization between family members and even within members of the same species can frustrate the efforts of unfamiliar researchers. Protocols published in the methods sections of papers can also include their own modifications10, leading to fragmented, decentralized protocol collections.
L. reuteri is considered a widely vertebrate commensal, found consistently in mammalian, avian11 and fish12 gastrointestinal (GI) tracts. L. reuteri sub-strains are often genetically specialized, via mucus adhesion protein adaptation, to more permanently colonize specific native hosts8,11,13. GI tract Limosilactobacillus species can be isolated in hosts outside their native host, but tend more toward a transient nature8.
Due to human-host specialization, L. reuteri DSM20016 positions itself very well as a chassis for diagnostic or therapeutic applications at any point in the human GI tract, and the strain DSM20016 could provide a longer-lasting window of effect for interventions when compared to more transitory strains.
In this paper, we outline a series of protocols with demonstrated effectiveness in Limosilactobacillus reuteri (strain designation: F275; other collection numbers: DSM20016, ATCC23272, CIP109823), along with centralized information on the strain from other sources to aid in molecular and systems biology applications. Procedures laid out herein should enable a researcher with no prior experience to culture L. reuteri, create electrocompetent stocks, select transformed colonies, confirm transformation via colony polymerase chain reaction (PCR), and measure designed system response via fluorescent reporter proteins.
We note that related protocols have covered CRISPR-Cas9 assisted ssDNA genome recombineering in L. reuteri (strain: ATCC-PTA-6475)14, and CRSIPR-Cas9 nickase-assisted genome editing in multiple non-L. reuteri, Lactobacillaceae family stains15,16; these do not, however, address the L. reuteri DSM20016 strain that is our focus here.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1 kb Plus DNA Ladder</td>
			<td>NEB</td>
			<td>N3200L</td>
			<td></td>
		</tr>
		<tr>
			<td>1mL Spectrophotometer cuvettes</td>
			<td>Thomas Scientific</td>
			<td>1145J12</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose&#160;</td>
			<td>BioShop</td>
			<td>AGR001</td>
			<td></td>
		</tr>
		<tr>
			<td>Allegra X-15R (refrigerated centrifuge)</td>
			<td>Beckman Allegra&#160;</td>
			<td>N/A</td>
			<td>No longer in production</td>
		</tr>
		<tr>
			<td>AnaeroGen 2.5 L Sachet</td>
			<td>Thermo Scientific</td>
			<td>OXAN0025A</td>
			<td></td>
		</tr>
		<tr>
			<td>BTX, ECM 399 electroporation system</td>
			<td>VWR</td>
			<td>58017-984</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge tubes (50 mL)</td>
			<td>FroggaBio</td>
			<td>TB50-500</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA gel x6 loading dye</td>
			<td>NEB</td>
			<td>B7024S</td>
			<td></td>
		</tr>
		<tr>
			<td>Electroporation cuvette</td>
			<td>Fisherbrand</td>
			<td>FB101</td>
			<td></td>
		</tr>
		<tr>
			<td>Erythromycin</td>
			<td>Millipore Sigma</td>
			<td>E5389-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel electroporation bath/dock</td>
			<td>VWR</td>
			<td>76314-748</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>BioShop</td>
			<td>GLY001</td>
			<td></td>
		</tr>
		<tr>
			<td>Limosilactobacillus reuteri</td>
			<td>Leibniz Institute DSMZ</td>
			<td>DSM20016</td>
			<td>Strain designation F275</td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>BioShop</td>
			<td>LYS702.5</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes (1.7 mL)</td>
			<td>FroggaBio</td>
			<td>LMCT1.7B</td>
			<td></td>
		</tr>
		<tr>
			<td>Miniprep kit (Qiagen)</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>slpGFP replaced with constitutive, codon optimised, mCherry2 reporter protein&#160;</td>
		</tr>
		<tr>
			<td>MRS Broth (Dehydrated)</td>
			<td>Thermo Scientific</td>
			<td>CM0359B</td>
			<td></td>
		</tr>
		<tr>
			<td>Mutanolysin</td>
			<td>Millipore Sigma</td>
			<td>M9901-5KU</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH&#160;</td>
			<td>Millipore Sigma</td>
			<td>1064691000</td>
			<td></td>
		</tr>
		<tr>
			<td>P100 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000047</td>
			<td></td>
		</tr>
		<tr>
			<td>P1000 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000063</td>
			<td></td>
		</tr>
		<tr>
			<td>P2.5 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000012</td>
			<td></td>
		</tr>
		<tr>
			<td>P20 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000039</td>
			<td></td>
		</tr>
		<tr>
			<td>P200 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000055</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR tubes</td>
			<td>FroggaBio</td>
			<td>STF-A120S</td>
			<td></td>
		</tr>
		<tr>
			<td>Personal benchtop microcentrifuge</td>
			<td>Genlantis</td>
			<td>E200100</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td></td>
		</tr>
		<tr>
			<td>PTC-150 Thermal Cycler</td>
			<td>MJ Research</td>
			<td>N/A</td>
			<td>No longer in production</td>
		</tr>
		<tr>
			<td>pTRKH3_slpGFP (modified)</td>
			<td>Addgene</td>
			<td>27168</td>
			<td></td>
		</tr>
		<tr>
			<td>SPECTRONIC 200 Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>840-281700</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage microplate</td>
			<td>Fisher Scientific</td>
			<td>14-222-225</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>BioShop</td>
			<td>SUC507</td>
			<td></td>
		</tr>
		<tr>
			<td>TAE Buffer 50x</td>
			<td>Thermo Scientific</td>
			<td>B49</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>VWR</td>
			<td>58816-121</td>
			<td>No longer in production</td>
		</tr>
		<tr>
			<td>VWR 1500E incubator</td>
			<td>VWR</td>
			<td>N/A</td>
			<td>No longer in production</td>
		</tr>
	</tbody>
</table>

methods for electroporation and transformation confirmation in limosilactobacillus reuteri dsm20016

Lactobacillus were an incredibly large, diverse genus of bacteria comprising 261 species, several of which were commensal strains with the potential for use as a chassis for synthetic biological endeavors within the gastrointestinal tract. The wide phenotypic and genotypic variation observed within the genus led to a recent reclassification and the introduction of 23 novel genera.
Due to the breadth of variations within the old genera, protocols demonstrated in one member may not work as advertised with other members. A lack of centralized information on how exactly to manipulate specific strains has led to a range of ad hoc approaches, often adapted from other bacterial families. This can complicate matters for researchers starting in the field, who may not know which information does or does not apply to their chosen strain.
In this paper, we aim to centralize a set of protocols with demonstrated success, specifically in&#160;the Limosilactobacillus reuteri strain designation F275 (other collection numbers: DSM20016, ATCC23272, CIP109823), along with troubleshooting advice and common issues one may encounter. These protocols should enable a researcher with little to no experience working with L. reuteri DSM20016 to transform a plasmid, confirm transformation, and measure system feedback in a plate reader via a reporter protein.

Transformation efficiencies 
L. reuteri does not require a dcm-/dam- non-methylated plasmid, as observed for other Lactobacillaceae19,20 (see Figure 1). Electroporation of L. reuteri DSM20016 with 10 &#181;L of the 8.5 kb plasmid pTRKH3_mCherry2 (pAM&#946;1 theta origin of replication) should give transformation efficiencies of roughly 80 colony forming units (CFU...

Watch this Scientific Journal Video about Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016 at JoVE.com

Author Spotlight: Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016  

Here, we present protocols for working with Limosilactobacillus reuteri DSM20016, detailing growth, plasmid transformation, colony PCR, fluorescent reporter protein measurement, and limited plasmid mini-prep, as well as common issues and troubleshooting. These protocols allow the measurement of reporter proteins in DSM20016, or confirmation via colony PCR if no reporter is involved.

Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016

Lactobacillus were an incredibly large, diverse genus of bacteria comprising 261 species, several of which were commensal strains with the potential for ...

methods-for-electroporation-transformation-confirmation

Research

JoVE Journal

Bioengineering

3.0K Views.  University of Toronto Mississauga. Here, we present protocols for working with Limosilactobacillus reuteri DSM20016, detailing growth, plasmid transformation, colony PCR, fluorescent reporter protein measurement, and limited plasmid mini-prep, as well as common issues and troubleshooting. These protocols allow the measurement of reporter proteins in DSM20016, or confirmation via colony PCR if no reporter is involved. 

Video: Author Spotlight: Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016  

Decellularization and Recellularization of Whole Livers

The liver is a complex organ which requires constant perfusion for delivery of nutrients and oxygen and removal of waste in order to survive1. Efforts to recreate or mimic the liver microstructure with grounds up approach using tissue engineering and microfabrication techniques have not been successful so far due to this design challenge. In addition, synthetic biomaterials used to create scaffolds for liver tissue engineering applications have been limited in inducing tissue regeneration and repair in large part due to the lack of specific cell binding motifs that would induce the proper cell functions2. Decellularized native tissues such blood vessels3and skin4on the other hand have found many applications in tissue engineering, and have provided a practical solution to some of the challenges. The advantage of decellularized native matrix is that it retains, to an extent, the original composition, and the microstructure, hence enhancing cell attachment and reorganization5.
In this work we describe the methods to perform perfusion-decellularization of the liver, such that an intact liver bioscaffold that retains the structure of major blood vessels is obtained. Further, we describe methods to recellularize these bioscaffolds with adult primary hepatocytes, creating a liver graft that is functional in vitro, and has the vessel access necessary for transplantation in vivo.

Perfusion decellularization is a novel technique to produce whole liver scaffolds that retains the organ's extracellular matrix composition and microarchitecture. Herein, the method of preparing whole organ scaffolds using perfusion decellularization and subsequent repopulation with hepatocytes is described. Functional and transplantable liver grafts can be generated using this technique.

The liver is a complex organ which requires constant perfusion for delivery of nutrients and oxygen and removal of waste in order to survive1. Efforts to ...

Methods Development for Blood Borne Macrophage Carriage of Nanoformulated Antiretroviral Drugs

Nanoformulated drugs can improve pharmacodynamics and bioavailability while serving also to reduce drug toxicities for antiretroviral (ART) medicines. To this end, our laboratory has applied the principles of nanomedicine to simplify ART regimens and as such reduce toxicities while improving compliance and drug pharmacokinetics. Simple and reliable methods for manufacturing nanoformulated ART (nanoART) are shown. Particles of pure drug are encapsulated by a thin layer of surfactant lipid coating and produced by fractionating larger drug crystals into smaller ones by either wet milling or high-pressure homogenization. In an alternative method free drug is suspended in a droplet of a polymer. Herein, drug is dissolved within a polymer then agitated by ultrasonication until individual nanosized droplets are formed. Dynamic light scattering and microscopic examination characterize the physical properties of the particles (particle size, charge and shape). Their biologic properties (cell uptake and retention, cytotoxicity and antiretroviral efficacy) are determined with human monocyte-derived macrophages (MDM). MDM are derived from human peripheral blood monocytes isolated from leukopacks using centrifugal elutriation for purification. Such blood-borne macrophages may be used as cellular transporters for nanoART distribution to human immunodeficiency virus (HIV) infected organs. We posit that the repackaging of clinically available antiretroviral medications into nanoparticles for HIV-1 treatments may improve compliance and positively affect disease outcomes.

Nanoparticles of indinavir, ritonavir, efavirenz and atazanavir were manufactured using wet milling, homogenization and ultrasonication. These nanoformulations, collectively termed nanoformulated antiretroviral therapy (nanoART), assessed macrophage-based drug delivery. Monocyte-derived macrophage nanoART uptake, retention and sustained release were determined. These preliminary studies suggest the potential of nanoART for clinical use.

Nanoformulated drugs can improve pharmacodynamics and bioavailability while serving also to reduce drug toxicities for antiretroviral (ART) medicines. To ...

Creating Two-Dimensional Patterned Substrates for Protein and Cell Confinement

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1 While microcontact printing can be employed to directly print a large number of molecules, including proteins,2 DNA,3 and silanes,4 the formation of self-assembled monolayers (SAMs) from long chain alkane thiols on gold provides a simple way to confine proteins and cells to specific patterns containing adhesive and resistant regions. This confinement can be used to control cell morphology and is useful for examining a variety of questions in protein and cell biology. Here, we describe a general method for the creation of well-defined protein patterns for cellular studies.5 This process involves three steps: the production of a patterned master using photolithography, the creation of a PDMS stamp, and microcontact printing of a gold-coated substrate. Once patterned, these cell culture substrates are capable of confining proteins and/or cells (primary cells or cell lines) to the pattern.
The use of self-assembled monolayer chemistry allows for precise control over the patterned protein/cell adhesive regions and non-adhesive regions; this cannot be achieved using direct protein stamping. Hexadecanethiol, the long chain alkane thiol used in the microcontact printing step, produces a hydrophobic surface that readily adsorbs protein from solution. The glycol-terminated thiol, used for backfilling the non-printed regions of the substrate, creates a monolayer that is resistant to protein adsorption and therefore cell growth.6 These thiol monomers produce highly structured monolayers that precisely define regions of the substrate that can support protein adsorption and cell growth. As a result, these substrates are useful for a wide variety of applications from the study of intercellular behavior7 to the creation of microelectronics.8
While other types of monolayer chemistry have been used for cell culture studies, including work from our group using trichlorosilanes to create patterns directly on glass substrates,9 patterned monolayers formed from alkane thiols on gold are straight-forward to prepare. Moreover, the monomers used for monolayer preparation are commercially available, stable, and do not require storage or handling under inert atmosphere. Patterned substrates prepared from alkane thiols can also be recycled and reused several times, maintaining cell confinement.10

Self-assembled monolayers (SAMs) formed from long chain alkane thiols on gold provide well-defined substrates for the formation of protein patterns and cell confinement. Microcontact printing of hexadecanethiol using a polydimethylsiloxane (PDMS) stamp followed by backfilling with a glycol-terminated alkane thiol monomer produces a pattern where protein and cells adsorb only to the stamped hexadecanethiol region.

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1  While microcontact printing ...

Fluorescence detection methods for microfluidic droplet platforms

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that accompany system miniaturisation. Advantages include the ability to efficiently process nano- to femoto- liter volumes of sample, facile integration of functional components, an intrinsic predisposition towards large-scale multiplexing, enhanced analytical throughput, improved control and reduced instrumental footprints.1
In recent years much interest has focussed on the development of droplet-based (or segmented flow) microfluidic systems and their potential as platforms in high-throughput experimentation.2-4 Here water-in-oil emulsions are made to spontaneously form in microfluidic channels as a result of capillary instabilities between the two immiscible phases. Importantly, microdroplets of precisely defined volumes and compositions can be generated at frequencies of several kHz. Furthermore, by encapsulating reagents of interest within isolated compartments separated by a continuous immiscible phase, both sample cross-talk and dispersion (diffusion- and Taylor-based) can be eliminated, which leads to minimal cross-contamination and the ability to time analytical processes with great accuracy. Additionally, since there is no contact between the contents of the droplets and the channel walls (which are wetted by the continuous phase) absorption and loss of reagents on the channel walls is prevented.
Once droplets of this kind have been generated and processed, it is necessary to extract the required analytical information. In this respect the detection method of choice should be rapid, provide high-sensitivity and low limits of detection, be applicable to a range of molecular species, be non-destructive and be able to be integrated with microfluidic devices in a facile manner. To address this need we have developed a suite of experimental tools and protocols that enable the extraction of large amounts of photophysical information from small-volume environments, and are applicable to the analysis of a wide range of physical, chemical and biological parameters. Herein two examples of these methods are presented and applied to the detection of single cells and the mapping of mixing processes inside picoliter-volume droplets. We report the entire experimental process including microfluidic chip fabrication, the optical setup and the process of droplet generation and detection.

Droplet-based microfluidic platforms are promising candidates for high throughput experimentation since they are able to generate picoliter, self-compartmentalized vessels inexpensively at kHz rates. Through integration with fast, sensitive and high resolution fluorescence spectroscopic methods, the large amounts of information generated within these systems can be efficiently extracted, harnessed and utilized.

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Models and Methods to Evaluate Transport of Drug Delivery Systems Across Cellular Barriers

Sub-micrometer carriers (nanocarriers; NCs) enhance efficacy of drugs by improving solubility, stability, circulation time, targeting, and release. Additionally, traversing cellular barriers in the body is crucial for both oral delivery of therapeutic NCs into the circulation and transport from the blood into tissues, where intervention is needed. NC transport across cellular barriers is achieved by: (i) the paracellular route, via transient disruption of the junctions that interlock adjacent cells, or (ii) the transcellular route, where materials are internalized by endocytosis, transported across the cell body, and secreted at the opposite cell surface (transyctosis). Delivery across cellular barriers can be facilitated by coupling therapeutics or their carriers with targeting agents that bind specifically to cell-surface markers involved in transport. Here, we provide methods to measure the extent and mechanism of NC transport across a model cell barrier, which consists of a monolayer of gastrointestinal (GI) epithelial cells grown on a porous membrane located in a transwell insert. Formation of a permeability barrier is confirmed by measuring transepithelial electrical resistance (TEER), transepithelial transport of a control substance, and immunostaining of tight junctions. As an example, ~200&#160;nm polymer NCs are used, which carry a therapeutic cargo and are coated with an antibody that targets a cell-surface determinant. The antibody or therapeutic cargo is labeled with 125I for radioisotope tracing and labeled NCs are added to the upper chamber over the cell monolayer for varying periods of time. NCs associated to the cells and/or transported to the underlying chamber can be detected. Measurement of free 125I allows subtraction of the degraded fraction. The paracellular route is assessed by determining potential changes caused by NC transport to the barrier parameters described above. Transcellular transport is determined by addressing the effect of modulating endocytosis and transcytosis pathways.

Many therapeutic applications require safe and efficient transport of drug carriers and their cargoes across cellular barriers in the body. This article describes an adaptation of established methods to evaluate the rate and mechanism of transport of drug nanocarriers (NCs) across cellular barriers, such as the gastrointestinal (GI) epithelium.

Sub-micrometer carriers (nanocarriers; NCs) enhance efficacy of drugs by improving solubility, stability, circulation time, targeting, and release. ...

Methods for Characterizing the Co-development of Biofilm and Habitat Heterogeneity

Biofilms are surface-attached microbial communities that have complex structures and produce significant spatial heterogeneities. Biofilm development is strongly regulated by the surrounding flow and nutritional environment. Biofilm growth also increases the heterogeneity of the local microenvironment by generating complex flow fields and solute transport patterns. To investigate the development of heterogeneity in biofilms and interactions between biofilms and their local micro-habitat, we grew mono-species biofilms of Pseudomonas aeruginosa and dual-species biofilms of P. aeruginosa and Escherichia coli under nutritional gradients in a microfluidic flow cell. We provide detailed protocols for creating nutrient gradients within the flow cell and for growing and visualizing biofilm development under these conditions. We also present protocols for a series of optical methods to quantify spatial patterns in biofilm structure, flow distributions over biofilms, and mass transport around and within biofilm colonies. These methods support comprehensive investigations of the co-development of biofilm and habitat heterogeneity.

Biofilms have complex interactions with their surrounding environment. To comprehensively investigate biofilm-environment interactions, we present here a series of methods to create heterogeneous chemical environment for biofilm development, to quantify local flow velocity, and to analyze mass transport in and around biofilm colonies.

Biofilms are surface-attached microbial communities that have complex structures and produce significant spatial heterogeneities. Biofilm development is ...

Two Methods for Decellularization of Plant Tissues for Tissue Engineering Applications

The autologous, synthetic, and animal-derived grafts currently used as scaffolds for tissue replacement have limitations due to low availability, poor biocompatibility, and cost. Plant tissues have favorable characteristics that make them uniquely suited for use as scaffolds, such as high surface area, excellent water transport and retention, interconnected porosity, preexisting vascular networks, and a wide range of mechanical properties. Two successful methods of plant decellularization for tissue engineering applications are described here. The first method is based on detergent baths to remove cellular matter, which is similar to previously established methods used to clear mammalian tissues. The second is a detergent-free method adapted from a protocol that isolates leaf vasculature and involves the use of a heated bleach and salt bath to clear the leaves and stems. Both methods yield scaffolds with comparable mechanical properties and low cellular metabolic impact, thus allowing the user to select the protocol which better suits their intended application.

Here we present, and contrast two protocols used to decellularize plant tissues: a detergent-based approach and a detergent-free approach. Both methods leave behind the extracellular matrix of the plant tissues used, which can then be utilized as scaffolds for tissue engineering applications.

The autologous, synthetic, and animal-derived grafts currently used as scaffolds for tissue replacement have limitations due to low availability, poor ...

Methods for In Vivo Biomechanical Testing on Brachial Plexus in Neonatal Piglets

Neonatal brachial plexus palsy (NBPP) is a stretch injury that occurs during the birthing process in nerve complexes located in the neck and shoulder regions, collectively referred to as the brachial plexus (BP). Despite recent advances in obstetrical care, the problem of NBPP continues to be a global health burden with an incidence of 1.5 cases per 1,000 live births. More severe types of this injury can cause permanent paralysis of the arm from the shoulder down. Prevention and treatment of NBPP warrants an understanding of the biomechanical and physiological responses of newborn BP nerves when subjected to stretch. Current knowledge of the newborn BP is extrapolated from adult animal or cadaveric BP tissue instead of in vivo neonatal BP tissue. This study describes an in vivo mechanical testing device and procedure to conduct in vivo biomechanical testing in neonatal piglets. The device consists of a clamp, actuator, load cell, and camera system that apply and monitor in vivo strains and loads until failure. The camera system also allows monitoring of the failure location during rupture. Overall, the presented method allows for a detailed biomechanical characterization of neonatal BP when subjected to stretch.

Methods for In Vivo Biomechanical Testing on Brachial Plexus in Neonatal Piglets

Presented here are methods to perform in vivo biomechanical testing on brachial plexus in a neonatal piglet model.

Neonatal brachial plexus palsy (NBPP) is a stretch injury that occurs during the birthing process in nerve complexes located in the neck and shoulder ...

Electric and Magnetic Field Devices for Stimulation of Biological Tissues

Electric fields (EFs) and magnetic fields (MFs) have been widely used by tissue engineering to improve cell dynamics such as proliferation, migration, differentiation, morphology, and molecular synthesis. However, variables such stimuli strength and stimulation times need to be considered when stimulating either cells, tissues or scaffolds. Given that EFs and MFs vary according to cellular response, it remains unclear how to build devices that generate adequate biophysical stimuli to stimulate biological samples. In fact, there is a lack of evidence regarding the calculation and distribution when biophysical stimuli are applied. This protocol is focused on the design and manufacture of devices to generate EFs and MFs and implementation of a computational methodology to predict biophysical stimuli distribution inside and outside of biological samples. The EF device was composed of two parallel stainless-steel electrodes located at the top and bottom of biological cultures. Electrodes were connected to an oscillator to generate voltages (50, 100, 150 and 200 Vp-p) at 60 kHz. The MF device was composed of a coil, which was energized with a transformer to generate a current (1 A) and voltage (6 V) at 60 Hz. A polymethyl methacrylate support was built to locate the biological cultures in the middle of the coil. The computational simulation elucidated the homogeneous distribution of EFs and MFs inside and outside of biological tissues. This computational model is a promising tool that can modify parameters such as voltages, frequencies, tissue morphologies, well plate types, electrodes and coil size to estimate the EFs and MFs to achieve a cellular response.

This protocol describes the step-by-step process to build both electrical and magnetic stimulators used to stimulate biological tissues. The protocol includes a guideline to simulate computationally electric and magnetic fields and manufacture of stimulator devices.

Electric fields (EFs) and magnetic fields (MFs) have been widely used by tissue engineering to improve cell dynamics such as proliferation, migration, ...

Rapid, Enzymatic Methods for Amplification of Minimal, Linear Templates for Protein Prototyping using Cell-Free Systems

This protocol describes the design of a minimal DNA template and the steps for enzymatic amplification, enabling rapid prototyping of assayable proteins in less than 24 h using cell-free expression. After receiving DNA from a vendor, the gene fragment is PCR-amplified, cut, circularized, and cryo-banked. A small amount of the banked DNA is then diluted and amplified significantly (up to 106x) using isothermal rolling circle amplification (RCA). RCA can yield microgram quantities of the minimal expression template from picogram levels of starting material (mg levels if all starting synthetic fragment is used). In this work, a starting amount of 20 pg resulted in 4 &#181;g of the final product. The resulting RCA product (concatemer of the minimal template) can be added directly to a cell-free reaction with no purification steps. Due to this method being entirely PCR-based, it may enable future high-throughput screening efforts when coupled with automated liquid handling systems.

The study describes a protocol for creating large (&#181;g-mg) quantities of DNA for protein screening campaigns from synthetic gene fragments without cloning or using living cells. The minimal template is enzymatically digested and circularized and then amplified using isothermal rolling circle amplification. Cell-free expression reactions could be performed with the unpurified product.

This protocol describes the design of a minimal DNA template and the steps for enzymatic amplification, enabling rapid prototyping of assayable proteins ...