The authors sincerely thank Prof. Sarah M. Fortune for kindly sharing M. smegmatis mc2155 stock. They also acknowledge Servier Medical Art (smart.servier.com) for providing some basic elements for Figure 1. They sincerely acknowledge the support of the rest of the lab members for their patient adjustments during the long use of the incubator shakers, centrifuges, and ultracentrifuges for mEV enrichment. They also acknowledge Mr. Surjeet Yadav, the laboratory assistant, for always making sure the necessary glassware and consumables were always available and handy. Lastly, they acknowledge the administrative, the purchase, and the finance teams of THSTI for their constant support and help in the seamless execution of the project.

All authors declare that this research work was conducted in the absence of any commercial or financial relationships/interests that could be construed as a potential conflict of interest.

Since developing a novel TB vaccine that is superior to and can replace BCG remains a formidable challenge, as an alternative, several groups are pursuing the discovery of different subunit TB vaccines that can boost BCG&#39;s potency and extend its protective duration48,49. Given the increasing attention to bacterial EVs (bEVs) as potential subunits and as natural adjuvants50,51, consistent enrichment of sufficient quantities of mEVs for their downstream testing/analysis has become an important step. It is in consideration of these research questions that this protocol aims to enrich mEVs from axenic cultures and their recombinant versions.
During detailed mass spectrometric proteome analyses of Msm EVs, Prados-Rosales et al. identified the 10 most abundant proteins30. We further hypothesized that upon sufficient molecular engineering, one among them should be sufficient to carry a foreign protein of interest into mEVs. Interestingly, Cfp-29 stood out as the best possible option because of its various features39,40,41,42. Our data indeed show that it is sufficient enough to carry mCherry and EsxA (albeit EsxA required a small tag at its C-terminus to be more stable) and accumulate them in the mEVs. Recently, in 2021, Tang et al. demonstrated that Cfp-29 is an encapsulin with the capability to carry dye-decolorizing peroxidase (DyP)-type peroxidases40. Perhaps, Cfp-29 can carry other foreign proteins too.
We explored EsxA because it is a prominent Mtb immunogen37,38,39, can be protective as a subunit vaccine in animal model37,38,39, is small in size; and its ortholog (MSMEG_0066) is interestingly absent in Msm EVs. Although we do not discuss this here, we have successfully generated R-mEVs for a few other Mtb proteins (uniquely present in Mtb and not encoded by Msm), including Antigen 85B (Rv 1886c). At the same time, interestingly, we also failed to generate R-mEVs for a few others, including full-length Rv2660c and Rv0288, possibly because the proteins are toxic to Msm. We conclude so because, despite cloning the correct nucleotide sequences and performing repeated transformations, no tranformants of Msm emerged. Since EsxA required a 3XFLAG tag at its C-terminus end for better accumulation in mEVs, we added a 3XFLAG tag to all other Mtb-encoded proteins that we evaluated. Despite the tag, Msm did not survive, indicating some Mtb proteins remain toxic despite the tag fusion. We speculate that in these cases, cloning just the predicted epitope regions or stitching several epitopes together may pay off (currently under evaluation in our laboratory). We used a small five amino acid (four Glycine and one Serine) linker between Cfp-29 and mCherry/EsxA to minimize the negative influence on the folding of the protein of interest44,45. We predict that without this linker, the protein of interest folding would be strongly influenced by Cfp-29 folding.
This enrichment protocol is easily extendable to the enrichment of Mtb-generated EVs. We also speculate that enriching mEVs from environmental mycobacteria should be also feasible with this protocol. Despite the protocol being simple and straightforward, it still requires 7-8 days to enrich Msm-generated EVs and R-mEVs. In contrast, it requires 15-20 days for the enrichment of Mtb-generated EVs. Concentrating EVs to a smaller volume is time-consuming and expensive and we are currently exploring tangential flow filtration and other approaches to solve the &#39;time&#39; issue.
Lastly, we use Sauton&#39;s and not 7H9 to enrich mEVs because the &#39;ADC&#39; supplement contains high amounts of bovine serum albumin that may interfere with any downstream uses of mEVs. This protocol may be easily extendable to any other specific media (e.g., low-iron media) that has to be used to evaluate the mEVs composition. Alternatively, for certain applications, at the last step (i.e. protocol step 2.7.5), instead of HEPES buffer, one could use sterile saline when injecting the same into mice or guinea pigs for various in vivo-based analyses.

An erratum was issued for:&#160;<a href="https://www.jove.com/t/65138">Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria</a>. The Authors section was updated from:
Praapti Jayaswal1 
Mohd Ilyas1 
Kuljit Singh1,2 
Saurabh Kumar1,3 
Lovely Sisodiya1 
Sapna Jain1 
Rahul Mahlawat1 
Nishant Sharma1 
Vishal Gupta1 
Krishnamohan Atmakuri1 
1Bacterial Pathogenesis Laboratory, Infectious Diseases and Immunology Group, Translational Health Science and Technology Institute, NCR Biotech Science Cluster 
2Clinical Microbiology Division, CSIR-Indian Institute of Integrative Medicine 
3ICAR-Research Complex for Eastern Region 
4Public Health Research Institute, Rutgers University
to:
Praapti Jayaswal1 
Mohd Ilyas1 
Kuljit Singh1,2 
Saurabh Kumar1,3 
Lovely Sisodiya1 
Sapna Jain1 
Rahul Mahlawat1 
Nishant Sharma1,4 
Vishal Gupta1 
Krishnamohan Atmakuri1 
1Bacterial Pathogenesis Laboratory, Infectious Diseases and Immunology Group, Translational Health Science and Technology Institute, NCR Biotech Science Cluster 
2Clinical Microbiology Division, CSIR-Indian Institute of Integrative Medicine 
3ICAR-Research Complex for Eastern Region 
4Public Health Research Institute, Rutgers University

An erratum was issued for:&#160;<a href="https://www.jove.com/t/65138">Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria</a>. The Authors section was updated.

Erratum: Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria

Despite the development and administration of a wide range of vaccines against infectious diseases, even to this day, ~30% of all human deaths still occur from communicable diseases1. Before the advent of the Tuberculosis (TB) vaccine - Bacillus Calmette Guerin (BCG) - TB was the number one killer (~10,000 to 15,000/100,000 population)2. With the administration of BCG and easy access to first and second-line anti-TB drugs, by 2022, TB-related deaths have dramatically dropped to ~1 million/year by 2022 (i.e., ~15-20/100,000 population1). However, in TB endemic populations of the world, TB-related deaths continue to stand at ~100-550/100,000 population1. While experts recognize several reasons leading to these skewed numbers, BCG-mediated protection not lasting for even the first decade of life appears to be the prominent reason3,4,5,6,7. Consequently, given the renewed &#39;Sustainable Development Goals&#39; of the UN and the &#39;End TB Strategy&#39;, of WHO, there is a concerted global effort to develop a much superior vaccine alternative to BCG that perhaps provides lifelong protection from TB.

Towards that objective, several groups are currently evaluating modified/recombinant BCG strains, non-pathogenic and attenuated mycobacterial species other than BCG, and subunit candidates8,9,10,11,12,13,14,15,16,17,18. Typically, subunit vaccines are liposomes selectively loaded with few purified (~1-6) full-length or truncated immunogenic proteins of the pathogen. However, because of their spurious folding into non-native conformations and/or random non-functional interactions between the loaded proteins, subunits often lack native and germane epitopes and hence, fail to sufficiently prime the immune system14,19,20.

Consequently, extracellular vesicles (EVs) of bacteria have picked up pace as a promising alternative21,22,23,24,25,26. Typically, bacterial EVs (bEVs) contain a subset of their cellular components, including some portions of nucleic acids, lipids, and hundreds of metabolites and proteins27,28. Unlike liposomes where a few purified proteins are artificially loaded, bEVs contain hundreds of naturally-loaded, natively-folded proteins with a better propensity to prime the immune system, especially without the boost/aid of adjuvants and Toll-like receptor (TLR) agonists27,28,29. It is in this line of research that we and others have explored the utility of mycobacterial EVs as potential subunit boosters to BCG30. Despite concerns that bEVs lack uniform antigen loads, EVs from attenuated Neisseria meningitidis have successfully protected humans against serogroup B meningococcus31,32.
At least theoretically, the best EVs that could boost BCG well are the EVs enriched from pathogenic bacteria. However, enriching EVs generated by pathogenic mycobacterium is expensive, time-consuming, and risky. Additionally, pathogen-generated EVs may be more virulent than protective. Given the potential risks, here, we report a well-tested protocol for the enrichment of EVs generated by axenically grown Msm, an avirulent mycobacterium.
However, despite encoding several pathogen protein orthologs, avirulent mycobacteria lack several vaccine antigens/pathogenic protein epitopes necessary to sufficiently prime the immune system towards protection33. Therefore, we also explored constructing and enriching recombinant EVs of Msm through molecular engineering, such that a significant portion of any pathogenic protein of interest expressed and translated in Msm, must reach its EVs. We hypothesized that one or more of the top 10 abundant proteins of Msm EVs when fused to the protein of interest will aid in such translocation.
While we were beginning to standardize the enrichment of mycobacterial EVs (mEVs) in our laboratory, in 2011, Prados-Rosales et al. first reported the visualization and enrichment of mEVs in vitro30. Later, in 2014, the same group published a modified version of their 2011 method34. In 2015, Lee et al. also reported an independently standardized method for mEV enrichment again from axenic cultures of mycobacteria35. Combining both protocols34,35 and incorporating a few of our modifications after thorough standardization, we describe here a protocol that helps routinely enrich mEVs from axenic cultures of mycobacteria36.
Here, we particularly detail the enrichment of Msm-specific EVs, which is an extension of a published protocol36 for the enrichment of mycobacterial EVs in general. We also detail how to construct recombinant mEVs (R-mEVs) that contain the mCherry protein (as a red fluorescent reporter) and EsxA (Esat-6)37,38,39 a predominant immunogen and a potential subunit vaccinogen of Mycobacterium tuberculosis. The protocol for enriching the R-mEVs remains identical to the one we have described for enriching native EVs from Msm.

<table><tbody><tr><td>A2 type Biosafety Cabinet</td><td>Thermo Fisher Scientific, USA</td><td></td><td>1300 series</td></tr><tr><td>Bench top Centrifuge</td><td>Eppendorf, USA</td><td></td><td>5810 R</td></tr><tr><td>BstB1, HindIII, HpaI</td><td>NEB, USA</td><td></td><td>NEB</td></tr><tr><td>Cell densitometer</td><td>GE Healthcare, USA</td><td></td><td>Ultraspec 10</td></tr><tr><td>Citric Acid</td><td>Sigma-Aldrich, Merck, USA</td><td></td><td>Sigma Aldrich</td></tr><tr><td>Dibasic Potassium Phosphate</td><td>Sigma-Aldrich, Merck, USA</td><td></td><td>Sigma Aldrich</td></tr><tr><td>Double Distilled Water</td><td>Merck, USA</td><td></td><td>~18.2 MW/cm @ 25 &lt;sup&gt;o&lt;/sup&gt;C</td></tr><tr><td>Electroporation cuvettes</td><td>Bio-Rad, USA</td><td></td><td>2 mm</td></tr><tr><td>Electroporator</td><td>Bio-Rad, USA</td><td></td><td>Electroporator</td></tr><tr><td>EsxA-specific Ab</td><td>Abcam, UK</td><td></td><td>Rabbit polyclonal</td></tr><tr><td>Ferric Ammonium Citrate</td><td>Sigma-Aldrich, Merck, USA</td><td></td><td>Sigma Aldrich</td></tr><tr><td>Floor model centrifuge</td><td>Thermo Fisher Scientific, USA</td><td></td><td>Sorvall RC6 plus</td></tr><tr><td>Glassware</td><td>Borosil, INDIA</td><td></td><td>1 L Erlenmeyer flasks</td></tr><tr><td>Glycerol</td><td>Sigma-Aldrich, Merck, USA</td><td></td><td>Sigma Aldrich</td></tr><tr><td>HEPES and Sodium Chloride</td><td>Sigma-Aldrich, Merck, USA</td><td></td><td>Sigma Aldrich</td></tr><tr><td>Incubator shakers</td><td>Thermo Fisher Scientific, USA</td><td></td><td>MaxQ 6000 &amp;amp; 8000</td></tr><tr><td>L-Asparagine</td><td>Sigma-Aldrich, Merck, USA</td><td></td><td>Sigma Aldrich</td></tr><tr><td>Luria Bertani Broth and Agar, Miller</td><td>Hi Media, INDIA</td><td></td><td>Hi Media</td></tr><tr><td>Magnesium Sulfate Heptahydrate</td><td>Sigma-Aldrich, Merck, USA</td><td></td><td>Sigma Aldrich</td></tr><tr><td>Magnetic stirrer</td><td>Tarsons, INDIA</td><td></td><td>Tarsons</td></tr><tr><td>mCherry-specific Ab</td><td>Abcam, UK</td><td></td><td>Rabbit monoclonal</td></tr><tr><td>Microwave</td><td>LG, INDIA</td><td></td><td>MC3286BLT</td></tr><tr><td>Middlebrook 7H9 Broth</td><td>BD, USA</td><td></td><td>Difco Middlebrook 7H9 Broth</td></tr><tr><td>Middlebrook ADC enrichment</td><td>BD, USA</td><td></td><td>BBL Middlebrook ADC enrichment</td></tr><tr><td>Nanodrop</td><td>Thermo Fisher Scientific, USA</td><td></td><td>Spectronic 200 UV-Vis</td></tr><tr><td>NEB5a</td><td>NEB, USA</td><td></td><td>a derivative of DH5a</td></tr><tr><td>Optiprep (Iodixanol)</td><td>Merck, USA</td><td></td><td>Available as 60% stock solution (in water)</td></tr><tr><td>PCR purification kit</td><td>Hi Media, INDIA</td><td></td><td>Hi Media</td></tr><tr><td>pH Meter</td><td>Mettler Toledo, USA</td><td></td><td>Mettler Toledo</td></tr><tr><td>Plasmid DNA mini kit</td><td>Hi Media, INDIA</td><td></td><td>Hi Media</td></tr><tr><td>Plate incubator</td><td>Thermo Fisher Scientific, USA</td><td></td><td>New Series</td></tr><tr><td>Plasmid pMV261</td><td>Addgene, USA *&lt;br/&gt; *The&amp;nbsp;&amp;nbsp; plasmid&amp;nbsp;&amp;nbsp; is&amp;nbsp;&amp;nbsp; no&amp;nbsp;&amp;nbsp; more available in this plasmid bank</td><td></td><td>Shuttle vector</td></tr><tr><td>Proof-reading DNA Polymerase</td><td>Thermo Fisher Scientific, USA</td><td></td><td>Phusion DNA Plus Polymerase</td></tr><tr><td>Q5 Proof-reading DNA Polymerase</td><td>NEB, USA</td><td></td><td>NEB</td></tr><tr><td>Refrigerated circulating water bath</td><td>Thermo Fisher Scientific, USA</td><td></td><td>R20</td></tr><tr><td>Middlebrock 7H11 Agar base</td><td>BD, USA</td><td></td><td>BBL Seven H11 Agar base</td></tr><tr><td>SOC broth</td><td>Hi Media, INDIA</td><td></td><td>Hi Media</td></tr><tr><td>Sodium Hydroxide</td><td>Sigma-Aldrich, Merck, USA</td><td></td><td>Sigma Aldrich</td></tr><tr><td>T4 DNA Ligase</td><td>NEB, USA</td><td></td><td>NEB</td></tr><tr><td>Tween-80</td><td>Sigma-Aldrich, Merck, USA</td><td></td><td>Sigma Aldrich</td></tr><tr><td>Ultracentrifuge</td><td>Beckman Coulter, USA</td><td></td><td>Optima L100K</td></tr><tr><td>Ultracentrifuge tubes - 14 mL</td><td>Beckman Coulter, USA</td><td></td><td>Polyallomer type &amp;ndash; ultra clear type in SW40Ti rotor</td></tr><tr><td>Ultracentrifuge tubes - 38 mL</td><td>Beckman Coulter, USA</td><td></td><td>Polypropylene type&amp;ndash; cloudy type for SW28 rotor</td></tr><tr><td>Ultrasonics cleaning waterbath sonicator</td><td>Thermo Fisher Scientific, USA</td><td></td><td>Sonicator - bench top model</td></tr><tr><td>0.22 &amp;micro;m Disposable filters</td><td>Thermo Fisher Scientific, USA</td><td></td><td>Nunc-Nalgene</td></tr><tr><td>30-kDa Centricon concentrators</td><td>Merck, USA</td><td></td><td>Amicon Ultra centrifugal filters - Millipore</td></tr><tr><td>3X FLAG antibody</td><td>Sigma-Aldrich, Merck, USA</td><td></td><td>Sigma Aldrich</td></tr><tr><td>400 mL Centrifuge bottles</td><td>Thermo Fisher Scientific, USA</td><td></td><td>Nunc-Nalgene</td></tr><tr><td>50 mL Centrifuge tubes</td><td>Corning, USA</td><td></td><td>Sterile, pre-packed</td></tr><tr><td>&lt;strong&gt;Bacteria&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Strain&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;em&gt;Escherichia coli&lt;/em&gt;</td><td>NEB, USA</td><td></td><td>NEB 5-alpha (a derivative of DH5&amp;alpha;).</td></tr><tr><td>Msm expressing cfp29::mCherry</td><td>This study</td><td></td><td>MC2&amp;nbsp;155</td></tr><tr><td>Msm expressing cfp29::esxA</td><td>This study</td><td></td><td>MC2&amp;nbsp;155</td></tr><tr><td>Msm expressing &lt;em&gt;cfp29::esxA::3X FLAG&lt;/em&gt;</td><td>This study</td><td></td><td>MC2&amp;nbsp;155</td></tr><tr><td>&lt;em&gt;Mycobacterium smegmatis &lt;/em&gt;(Msm)</td><td>Prof. Sarah M. Fortune, Harvard Univ, USA</td><td></td><td>&amp;nbsp;MC&lt;sup&gt;2&lt;/sup&gt;&amp;nbsp;155</td></tr></tbody></table>

enrichment of native and recombinant extracellular vesicles of mycobacteria

Most bacteria, including mycobacteria, generate extracellular vesicles (EVs). Since bacterial EVs (bEVs) contain a subset of cellular components, including metabolites, lipids, proteins, and nucleic acids, several groups have evaluated either the native or recombinant versions of bEVs for their protective potency as subunit vaccine candidates. Unlike native EVs, recombinant EVs are molecularly engineered to contain one or more immunogens of interest. Over the last decade, different groups have explored diverse approaches for generating recombinant bEVs. However, here, we report the design, construction, and enrichment of recombinant mycobacterial EVs (mEVs) in mycobacteria. Towards that, we use Mycobacterium smegmatis (Msm), an avirulent soil mycobacterium as the model system. We first describe the generation and enrichment of native EVs of Msm. Then, we describe the design and construction of recombinant mEVs that contain either mCherry, a red fluorescent reporter protein, or EsxA (Esat-6), a prominent immunogen of Mycobacterium tuberculosis. We achieve this by separately fusing mCherry and EsxA N-termini with the C-terminus of a small Msm protein Cfp-29. Cfp-29 is one of the few abundantly present proteins of MsmEVs. The protocol to generate and enrich recombinant mEVs from Msm remains identical to the generation and enrichment of native EVs of Msm.

We use M. smegmatis (Msm) as the model mycobacterium to demonstrate the enrichment of both native and recombinant mEVs (R-mEVs). This schematically summarized mEVs enrichment protocol (Figure 1) also works for the enrichment of R-mEVs of Msm and native EVs of Mtb (with minor modifications as in protocol notes of 1.2). Visualization of the enriched mEVs requires negatively staining them under a transmission electron microscope36 (Figure 2A). Typically, Msm-specific EVs separate out in the 4th-6th 1 mL fractions of the 13 mL 6-60% density gradient (Figure 2B). Approximately 80-100 &#181;g protein equivalent of EVs are routinely obtained from 2 L of mid-logarithmic axenic cultures of Msm. Their diameters typically range between 20 nm and 250 nm (Figure 2C).
One long-term goal of our laboratory is to evaluate if mEVs of different mycobacteria could potentially act as a subunit booster to the existing vaccine, BCG. Since enriching mEVs generated by pathogenic bacteria is time-consuming, risky, and expensive, exploiting native and recombinant EVs from avirulent mycobacteria may work as a suitable alternative. Hence, we aim to not only standardize the protocol to enrich the mEVs of Msm but also to construct and enrich its R-mEVs.
To construct R-mEVs, we first selected the top 10 abundant proteins of Msm EVs (Table 1; we identified them from detailed mass spectrometry analyses of the Msm EVs)30. We hypothesized that if a foreign protein of interest is translationally fused to any of them, it should be able to localize into mEVs. Then, we shortlisted Cfp-29 among the 10 because it is the smallest among them (~29 kDa), is membrane-localized, and is a culture filtrate protein with a relatively simple secondary structure40,41,42,43. We translationally fused mCherry&#39;s (fluorescent protein) N-terminal end to the C-terminal end of Cfp-29 and evaluated its loading/delivery into mEVs. A portion of the enriched mEVs of Msm turned pink (Figure 3), indicating Cfp-29&#39;s ability to carry a foreign protein of interest into Msm EVs.
Given this ability of Cfp-29 (Figure 3), we then evaluated EsxA (Esat-6), a major immunogenic protein37,38,39 delivery into Msm EVs. Again, we generated two independent translational fusions to the C-terminus of Cfp-29-only EsxA and EsxA + 3X FLAG tag (3X FLAG fused to the C-terminus of EsxA. As expected, we observed Mtb&#39;s EsxA in Msm EVs (lanes 5, 6, and 10, Figure 4A,B), albeit in low quantities. Interestingly, Cfp-29::EsxA::3XFLAG was much more stable (lanes 3 and 4 plus 8 and 9; Figure 4A) and accumulated at higher levels in mEVs (lanes 3 and 4 plus 8 and 9; Figure 4B). In summary, we demonstrate the design, construction, and enrichment of R-mEVs that contain a foreign protein of interest (Figure 3 and Figure 4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65138/65138fig01.jpg" /> 
Figure 1: Schematic representation of mycobacterial extracellular vesicle enrichment. &#39;Days&#39; (in red font, top of the figure) refers to the days necessary to enrich the mEVs from Msm (specifically for protocol steps 1 and 2). &#34;Steps&#34; (in black font, bottom of the figure) refer to the protocol steps as described in the protocol section. For enriching mEVs from Mtb, although all steps are similar, it takes at least 10 days for the different steps of culturing (step 1) to the first step of centrifugation (step 2). Subsequent steps require identical duration (as indicated in red font). Before the density gradient, the mEVs pellet + extracellular complexes look colorless when enriching both native mEVs and R-mEVs. However, it would appear pinkish to blue (see Figure 3) when enriching mEVs containing mCherry. Post the density gradient, the mEVs would appear white (native and R-mEVs) or pink (if containing mCherry) in the density gradient tube. The colors of mEVs in the figure are only for indicating clarity and do not represent the exact colors. See Figure 3 for more clarity. Abbreviations: Msm = M. smegmatis; Mtb = M. tuberculosis; 0.45 and 0.22 &#181;m = pore size of disposal filter units. <a href="https://www.jove.com/files/ftp_upload/65138/65138fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65138/65138fig02.jpg" /> 
Figure 2: Mycobacterial EVs are circular, concentrate with density gradients, and vary in dimensions. (A) A representative image of Msm EVs upon their visualization with negative staining and viewing under a transmission electron microscope. Scale bar = 200 nm. (B) A representative image of how mEVs appear in the ultracentrifuge tube upon performing a 6-60% density gradient. If the 6-60% gradient is not accurately layered, the positioning of the major (top open arrow) and minor (bottom open arrow) bands of mEVs can significantly alter, thus altering the 1 mL fraction number. (C) A representative image upon nanotracking analysis of enriched mEVs of Msm. Nanotracking analyses reveal the proportions and concentrations of different-sized mEVs and the total number of mEVs within the preparation. On average, with the protocol detailed here, ~1-3 &#215; 1010 EVs are enriched from 2 L of Msm and Mtb. <a href="https://www.jove.com/files/ftp_upload/65138/65138fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65138/65138fig03.jpg" /> 
Figure 3: Different steps indicative of enrichment of mEVs expressing mCherry. (A) Representative image showing Msm axenic culture expressing Cfp-29::mCherry. (B) Representative image of the bacterial pellet post centrifugation of Msm axenic culture expressing Cfp-29::mCherry. (C) Representative image of culture filtrate concentrate obtained post concentrating the spent media of Msm axenic culture expressing Cfp-29::mCherry through centricon concentrators. (D) Representative image of mEVs + extracellular complexes pellet post ultracentrifugation of culture filtrate concentrate obtained from Msm axenic culture expressing Cfp-29::mCherry. The pellet would, however, remain colorless if the mEVs were to be either native or recombinant (upon fusion to Cfp-29) for any foreign protein(s) except mCherry. (E) Representative images of mCherry containing mEVs. Note that not all mEVs are pink, indicating that not all mEVs contain Cfp-29. Good: A representative image indicating different bands of mEVs typically obtained after enriching for Cfp-29::mCherry EVs. Since mCherry-containing EVs are denser, they separate into later fractions. Poor: A representative image indicating poor separation (the white mEVs separate out in the first/second fraction and the mCherry-containing mEVs separate out in the 10th fraction (possibly because of poor resuspension of mEVs pellet, i.e., protocol step 2.3.2). <a href="https://www.jove.com/files/ftp_upload/65138/65138fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/65138/65138fig04.jpg" /> 
Figure 4: Recombinant mEVs containing EsxA (ESAT-6), an Mtb-encoded immunogen in Msm total cell lysate and Msm generated EVs. (A)&#160;Coomassie gel and (B) western analysis (detected with ESAT6-specific polyclonal antibody) images showing the accumulation of fused ExsA in both Msm total cell lysate and mEVs expressing either cfp-29::esxA::3XFLAG (+ 3XFLAG, lanes 3 and 4 (total lysate) and lanes 8 and 9 (mEVs)) or cfp-29::esxA (- 3XFLAG, lanes 5 and 6 (total lysate) and lane 10 (mEVs)). Open and filled arrows indicate accumulated Cfp-29::ExsA::3XFLAG and Cfp-29::ExsA, respectively. <a href="https://www.jove.com/files/ftp_upload/65138/65138fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="11">Primers:</td>
		</tr>
		<tr>
			<td>Sl #</td>
			<td>Gene</td>
			<td>Primer</td>
			<td colspan="5">Sequence (5&#39; to 3&#39;)</td>
			<td colspan="2">Source</td>
			<td>To clone into</td>
		</tr>
		<tr>
			<td>1</td>
			<td>cfp-29</td>
			<td>Forward</td>
			<td colspan="5">CAGTTCGAA(BstBI)ATGAACAACCTCTATCGC</td>
			<td colspan="2">Msm genomic DNA</td>
			<td>pMV261</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Reverse</td>
			<td colspan="5">GAAAAGCTT(HindIII)GGGGGTCAGCGCGACAG</td>
			<td colspan="2">Msm genomic DNA</td>
			<td>pMV261</td>
		</tr>
		<tr>
			<td>2</td>
			<td>mCherry</td>
			<td>Forward</td>
			<td colspan="5">GAAAAGCTT(HindIII) ggcggcggtggctcg (G4S linker)ATGGTGAGCAAGGGCGAGGAGG</td>
			<td colspan="2">Lab collection</td>
			<td>pMV261</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Reverse</td>
			<td colspan="5">TGTGTTAAC(HpaI)CTACTTGTACAGCTCGTCC</td>
			<td colspan="2">Lab collection</td>
			<td>pMV261</td>
		</tr>
		<tr>
			<td>3</td>
			<td>esxA</td>
			<td>Forward</td>
			<td colspan="5">GAAAAGCTT(HindIII)ggcggcggtggctcg (G4S linker) ATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAG</td>
			<td colspan="2">Mtb genomic DNA</td>
			<td>pMV261</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Reverse</td>
			<td colspan="5">TGTGTTAAC(HpaI)TCATGCGAACA 
			TCCCAGTGACGTTGCCTTCGGTCG</td>
			<td colspan="2">Mtb genomic DNA</td>
			<td>pMV261</td>
		</tr>
		<tr>
			<td>4</td>
			<td>exsA-3X FLAG</td>
			<td>Forward</td>
			<td colspan="5">GAAAAGCTT(HindIII)ggcggcggtggctcg (G4S linker) ATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAG</td>
			<td colspan="2">Mtb genomic DNA</td>
			<td>pMV261</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Reverse</td>
			<td colspan="5">TGTGTTAAC(HpaI)TCA 
			cttgtcgtcgtcgtccttgtagtcgatgtcgtg 
			gtccttgtagtcaccgtcgtggtccttgtagtc (3XFLAG) TGCGAACATCCCAGTGACGTTG 
			CCTTCGGTCGAAGCCATTGCCTGACC</td>
			<td colspan="2">Mtb genomic DNA</td>
			<td>pMV261</td>
		</tr>
	</tbody>
</table>
Table 1: Primer sequences. Forward and Reverse primers for amplifying cfp-29, mCherry, esxA, and esxA::3X FLAG and cloning into shuttle vector pMV261 are listed.
Supplementary File 1: A: pMV261, its circular map, main features, and complete nucleotide sequence. Yellow highlight-hsp60 promoter nucleotide sequence; Green and cyan highlight-restriction sites into which mCherry, esxA, and esxA::3X FLAG amplicons were cloned. B, C, and D: Nucleotide sequences of cfp-29, mCherry, and esxA, respectively. Green highlight-stop codon of cfp-29, mCherry, and esxA. <a href="https://www.jove.com/files/ftp_upload/65138/Supplementary Data_Jayaswal et al_R_mEVs.docx" target="_blank">Please click here to download this File.</a>

Watch this Scientific Journal Video about Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria at JoVE.com

Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria

This protocol details the enrichment of native mycobacterial extracellular vesicles (mEVs) from axenic cultures of Mycobacterium smegmatis (Msm) and how mCherry (a red fluorescent reporter)-containing recombinant MsmEVs can be designed and enriched. Lastly, it verifies the novel approach with the enrichment of MsmEVs containing the EsxA protein of Mycobacterium tuberculosis.

Most bacteria, including mycobacteria, generate extracellular vesicles (EVs). Since bacterial EVs (bEVs) contain a subset of cellular components, ...

enrichment-native-recombinant-extracellular-vesicles

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

846 Views.  NCR Biotech Science Cluster. This protocol details the enrichment of native mycobacterial extracellular vesicles (mEVs) from axenic cultures of Mycobacterium smegmatis (Msm) and how mCherry (a red fluorescent reporter)-containing recombinant MsmEVs can be designed and enriched. Lastly, it verifies the novel approach with the enrichment of MsmEVs containing the EsxA protein of Mycobacterium tuberculosis.

Video: Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Recombinant Retroviral Production and Infection of B Cells

The transgenic expression of genes in eukaryotic cells is a powerful reverse genetic approach in which a gene of interest is expressed under the control of a heterologous expression system to facilitate the analysis of the resulting phenotype. This approach can be used to express a gene that is not normally found in the organism, to express a mutant form of a gene product, or to over-express a dominant-negative form of the gene product. It is particularly useful in the study of the hematopoetic system, where transcriptional regulation is a major control mechanism in the development and differentiation of B cells 1, reviewed in 2-4.
Mouse genetics is a powerful tool for the study of human genes and diseases. A comparative analysis of the mouse and human genome reveals conservation of synteny in over 90% of the genome 5. Also, much of the technology used in mouse models is applicable to the study of human genes, for example, gene disruptions and allelic replacement 6. However, the creation of a transgenic mouse requires a great deal of resources of both a financial and technical nature. Several projects have begun to compile libraries of knock out mouse strains (KOMP, EUCOMM, NorCOMM) or mutagenesis induced strains (RIKEN), which require large-scale efforts and collaboration 7. Therefore, it is desirable to first study the phenotype of a desired gene in a cell culture model of primary cells before progressing to a mouse model. 
Retroviral DNA integrates into the host DNA, preferably within or near transcription units or CpG islands, resulting in stable and heritable expression of the packaged gene of interest while avoiding transcriptional silencing 8 9. The genes are then transcribed under the control of a high efficiency retroviral promoter, resulting in a high efficiency of transcription and protein production. Therefore, retroviral expression can be used with cells that are difficult to transfect, provided the cells are in an active state during mitosis. Because the structural genes of the virus are contained within the packaging cell line, the expression vectors used to clone the gene of interest contain no structural genes of the virus, which both eliminates the possibility of viral revertants and increases the safety of working with viral supernatants as no infectious virions are produced 10. 
Here we present a protocol for recombinant retroviral production and subsequent infection of splenic B cells. After isolation, the cultured splenic cells are stimulated with Th derived lymphokines and anti-CD40, which induces a burst of B cell proliferation and differentiation 11. This protocol is ideal for the study of events occurring late in B cell development and differentiation, as B cells are isolated from the spleen following initial hematopoetic events but prior to antigenic stimulation to induce plasmacytic differentiation.

An efficient system of structure and function analysis of a gene in an ex vivo culture of splenic B-lymphocytes is described. This method takes advantage of recombinant retroviral production in a helper free, ecotrophic packaging cell line. Stable, heritable expression of a gene of interest within primary lymphocytes is achieved leading to generation of surface antibodies on B cells undergoing class switch recombination.

The transgenic expression of genes in eukaryotic cells is a powerful reverse genetic approach in which a gene of interest is expressed under the control ...

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

Tuberculosis (TB) is a serious infectious disease and the only available vaccine M. bovis bacillus Calmette-Gu&#233;rin (BCG) is safe and effective for protection against children&#39;s severe TB meningitis and some forms of disseminated TB, but fails to protect against pulmonary TB, which is the most prevalent form of the disease. Promising strategies to improve BCG currently rely either on its transformation with genes encoding immunodominant M. tuberculosis (Mtb)-specific antigens and/or complementation with genes encoding co-factors that would stimulate antigen presenting cells. Major limitations to these approaches include low efficiency, low stability, and the uncertain level of safety of expression vectors. In this study, we present an alternative approach to vaccine improvement, which consists of BCG complementation with exogenous proteins of interest on the surface of bacteria, rather than transformation with plasmids encoding corresponding genes. First, proteins of interest are expressed in fusion with monomeric avidin in standard E. coli expression systems and then used to decorate the surface of biotinylated BCG. Animal experiments using BCG surface decorated with surrogate ovalbumin antigen demonstrate that the modified bacterium is fully immunogenic and capable of inducing specific T cell responses. Altogether, the data presented here strongly support a novel and efficient method for reshaping the current BCG vaccine that replaces the laborious conventional approach of complementation with exogenous nucleic acids.

Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

A novel technique for rapid antigen display on a bacterial surface is presented, which involves surface biotinylation followed by exposure to proteins of interest in fusion with monomeric avidin. Loading BCG with selected antigens successfully improves its immunogenicity, suggesting that surface decoration can replace traditional genetic approaches.

Tuberculosis (TB) is a serious infectious disease and the only available vaccine M. bovis bacillus Calmette-Gu&#233;rin (BCG) is safe and effective for ...

Isolation and Characterization of Extracellular Vesicles Produced by Iron-limited Mycobacteria

Mycobacteria, including Mycobacterium tuberculosis (Mtb), the causative agent of human tuberculosis, naturally release extracellular vesicles (EVs) containing immunologically active molecules. Knowledge regarding the molecular mechanisms of vesicle biogenesis, the content of the vesicles, and their functions at the pathogen-host interface is very limited. Addressing these questions requires rigorous procedures for isolation, purification, and validation of EVs. Previously, vesicle production was found to be enhanced when M. tuberculosis was exposed to iron restriction, a condition encountered by Mtb in the host environment. Presented here is a complete and detailed protocol to isolate and purify EVs from iron-deficient mycobacteria. Quantitative and qualitative methods are applied to validate purified EVs.

Mycobacterium tuberculosis shows increased production and release of extracellular vesicles in response to low iron conditions. This work details a protocol for generating low iron conditions and methods for the purification and characterization of mycobacterial extracellular vesicles released in response to iron deficiency.

Mycobacteria, including Mycobacterium tuberculosis (Mtb), the causative agent of human tuberculosis, naturally release extracellular vesicles (EVs) ...

Mycobacterium tuberculosis Extracellular Vesicle Enrichment through Size Exclusion Chromatography

The role of extracellular vesicles (EVs) in the context of bacterial infection has emerged as a new avenue for understanding microbial physiology. Specifically, Mycobacterium tuberculosis (Mtb) EVs play a role in the host-pathogen interaction and response to environmental stress. Mtb EVs are also highly antigenic and show potential as vaccine components. The most common method for purifying Mtb EVs is density gradient ultracentrifugation. This process has several limitations, including low throughput, low yield, reliance on expensive equipment, technical challenges, and it can negatively impact the resulting preparation. Size exclusion chromatography (SEC) is a gentler alternative method that combats many of the limitations of ultracentrifugation. This protocol demonstrates that SEC is effective for Mtb EV enrichment and produces high-quality Mtb EV preparations of increased yield in a rapid and scalable manner. Additionally, a comparison to density gradient ultracentrifugation by quantification and qualification procedures demonstrates the benefits of SEC. While the evaluation of EV quantity (nanoparticle tracking analysis), phenotype (transmission electron microscopy), and content (Western blotting) is tailored to Mtb EVs, the workflow provided can be applied to other mycobacteria.

Mycobacterium tuberculosis Extracellular Vesicle Enrichment through Size Exclusion Chromatography

This protocol describes size exclusion chromatography, a facile and reproducible technique for enriching Mycobacterium tuberculosis extracellular vesicles from culture supernatants.

The role of extracellular vesicles (EVs) in the context of bacterial infection has emerged as a new avenue for understanding microbial physiology. ...

Scalable Isolation and Purification of Extracellular Vesicles from Escherichia coli and Other Bacteria

Diverse bacterial species secrete ~20-300 nm extracellular vesicles (EVs), comprised of lipids, proteins, nucleic acids, glycans, and other molecules derived from the parental cells. EVs function as intra- and inter-species communication vectors while also contributing to the interaction between bacteria and host organisms in the context of infection and colonization. Given the multitude of functions attributed to EVs in health and disease, there is a growing interest in isolating EVs for in vitro and in vivo studies. It was hypothesized that the separation of EVs based on physical properties, namely size, would facilitate the isolation of vesicles from diverse bacterial cultures. 
The isolation workflow consists of centrifugation, filtration, ultrafiltration, and size-exclusion chromatography (SEC) for the isolation of EVs from bacterial cultures. A pump-driven tangential flow filtration (TFF) step was incorporated to enhance scalability, enabling the isolation of material from liters of starting cell culture. Escherichia coli was used as a model system expressing EV-associated nanoluciferase and non-EV-associated mCherry as reporter proteins. The nanoluciferase was targeted to the EVs by fusing its N-terminus with cytolysin A. Early chromatography fractions containing 20-100 nm EVs with associated cytolysin A - nanoLuc were distinct from the later fractions containing the free proteins. The presence of EV-associated nanoluciferase was confirmed by immunogold labeling and transmission electron microscopy. This EV isolation workflow is applicable to other human gut-associated gram-negative and gram-positive bacterial species. In conclusion, combining centrifugation, filtration, ultrafiltration/TFF, and SEC enables scalable isolation of EVs from diverse bacterial species. Employing a standardized isolation workflow will facilitate comparative studies of microbial EVs across species.

Scalable Isolation and Purification of Extracellular Vesicles from Escherichia coli and Other Bacteria

Bacteria secrete nanometer-sized extracellular vesicles (EVs) carrying bioactive biological molecules. EV research focuses on understanding their biogenesis, role in microbe-microbe and host-microbe interactions and disease, as well as their potential therapeutic applications. A workflow for scalable isolation of EVs from various bacteria is presented to facilitate standardization of EV research.

Diverse bacterial species secrete ~20-300 nm extracellular vesicles (EVs), comprised of lipids, proteins, nucleic acids, glycans, and other molecules ...

Biology

Production and Imaging of Recombinant Protein-Filled Vesicles from E. coli

Optimized Production and Analysis of Recombinant Protein-Filled Vesicles from E. coli

This innovative system, using a short peptide tag, that exports multiple recombinant proteins in membrane bound vesicles from E. coli, provides an effective solution to a range of problems associated with bacterial recombinant protein expression. These recombinant vesicles compartmentalise proteins within a micro-environment that facilitates the production of otherwise challenging, toxic, insoluble, or disulfide-bond containing proteins from bacteria. Protein yield is increased considerably when compared to typical bacterial expression in the absence of the vesicle-nucleating peptide tag. The release of vesicle-packaged proteins supports isolation from the culture medium&#160;and permits long-term active protein storage. This technology gives rise to increased yields of vesicle-packaged, functional proteins for simplified downstream processing for a diverse range of applications from applied biotechnology to discovery science and medicine. In the present article and the associated video, a detailed protocol of the method is provided, which highlights key steps in the methodology to maximize recombinant protein-filled vesicle production.

Author Spotlight: The Production of Recombinant Proteins 

The present protocol describes a detailed method for the bacterial production of recombinant proteins, including typically insoluble or disulfide-bond containing proteins, packaged inside extracellular membrane-bound vesicles. This has the potential to be applied to versatile areas of scientific research, including applied biotechnology and medicine.

This innovative system, using a short peptide tag, that exports multiple recombinant proteins in membrane bound vesicles from E. coli, provides an ...

Bacterial Culture Filtrate Protein Concentration using an Ultrafiltration Device

Source: Ryan, J. M., et al. <a href="https://app.jove.com/v/63895">Mycobacterium tuberculosis</a><a href="https://app.jove.com/v/63895"> Extracellular Vesicle Enrichment through Size Exclusion Chromatography.</a> J. Vis. Exp. (183) (2022)
This video demonstrates the isolation and concentration of bacterial culture filtrate proteins, which include bacterial extracellular vesicles, using ultrafiltration. The concentrated extracellular vesicles serve as diagnostic markers for disease detection.

1. Preparation of crude Mycobacterium tuberculosis (Mtb) extracellular vesicle (EV) concentrate
NOTE: For detailed procedures on the cultivation of Mtb ...

JoVE Encyclopedia of Experiments

Immunology

Immunodiagnostics

In Vitro and In Vivo Models

A Size Exclusion Chromatography Technique to Purify Mycobacterial Extracellular Vesicles

Source: Ryan, J. M., et al. <a href="https://app.jove.com/v/63895">Mycobacterium tuberculosis Extracellular Vesicle Enrichment through Size Exclusion Chromatography.</a> J. Vis. Exp. (2022).
This video demonstrates the size exclusion chromatography (SEC) technique for purifying bacterial extracellular vesicles (EVs) from the culture filtrate of Mycobacterium tuberculosis (Mtb). The technique utilizes a porous resin-packed column to obtain purified fractions of EVs. The porous particles selectively allow smaller proteins to enter the pores, resulting in slower elution. At the same time, EVs are excluded from entering the pores due to their larger size and are eluted first.

1. Preparation of crude Mtb EV concentrate
NOTE: For detailed procedures on the cultivation of Mtb and preparation of culture filtrate protein (CFP), see ...

Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria

Summary

Explore More Videos

Chapters in this video

Generation of Recombinant Influenza Virus from Plasmid DNA

Recombinant Retroviral Production and Infection of B Cells

Production and Titering of Recombinant Adeno-associated Viral Vectors

Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

Isolation and Characterization of Extracellular Vesicles Produced by Iron-limited Mycobacteria

Mycobacterium tuberculosis Extracellular Vesicle Enrichment through Size Exclusion Chromatography

Scalable Isolation and Purification of Extracellular Vesicles from Escherichia coli and Other Bacteria

Optimized Production and Analysis of Recombinant Protein-Filled Vesicles from E. coli

Bacterial Culture Filtrate Protein Concentration using an Ultrafiltration Device

A Size Exclusion Chromatography Technique to Purify Mycobacterial Extracellular Vesicles