L. 루테리 ATCC PTA 6475 사용에 대한 지침을 통해 여기에 설명된 방법의 기초를 제공한 J.P. van Pijkeren 교수(University of Wisconsin-Madison)의 귀중한 조언에 깊은 감사를 드립니다.

1. L. 루테리 DSM20016 전기적격 전지 준비
참고: 이것은 Berthier et al.17의 프로토콜을 기반으로 하며 원심분리 속도는 Rattanachaikunsopon et al.에서 알려줍니다.18.
<ol><li>50mL 원심분리기 튜브에서 글리세롤 스톡의 L. 루테리 를 6mL의 deMan Rogosa Sharpe(MRS) 브로스에 접종합니다. 정적 인큐베이터에서 37°C에서 하룻밤 동안 호기적으로 배양합니다.</li>
	<li>다음날 아침, 하룻밤 배양액 4mL를 MRS 브로스 200mL에 접종합니다(1:50 희석).</li>
	<li>600nm 광학 밀도 값(OD600)이 0.5-0.85에 도달할 때까지 정적 37°C 인큐베이터에서 호기성으로 성장하도록 합니다. 대략 2-3시간이 소요됩니다.</li>
	<li>적절한 OD600 값에 도달하면 매체를 50mL 원심분리기 튜브에 디캔팅하고 튜브의 균형을 맞추면서 얼음 위에 놓습니다.</li>
	<li>미리 냉각된 4°C 원심분리기에서 5,000 x g 에서 5분 동안 원심분리합니다.</li>
	<li>상청액을 버리고, 각각의 펠릿을 50 mL의 예비냉각된(0°C 내지 4°C)ddH2O에 재현탁하고, 이전 단계와 동일한 설정으로 다시 원심분리한다. 세포를 가능한 한 얼음 위에 보관하십시오.</li>
	<li>1.6단계를 반복합니다.</li>
	<li>각각의 펠릿을 25 mL의ddH2O:0.5 M 수크로오스, 10% 글리세롤에 재현탁시킨다. 4°C에서 5,000 x g 에서 10분 동안 원심분리합니다. 상층액을 버리고 세포를 다시 얼음 위에 놓습니다.</li>
	<li>모든 펠릿을 동일한 2 mL의ddH2O:0.5 M 수크로오스, 10% 글리세롤로 재현탁시킨다.</li>
	<li>50 μL 내지 100 μL 분취액을 미리 냉각된 미세원심분리 튜브에 넣는 단계; 나중에 사용할 수 있도록 -80 °C에서 보관하십시오.</li>
</ol>2. L. 루테리 의 전기천공법
참고: 다음 단계에서 가능한 한 피펫팅을 피하십시오. 플라스미드가 추가되지 않은 대조군 전기천공을 포함하는 것은 항생제 선택이 적절한지 확인하는 것이 좋습니다.
<ol><li>전기 능력이 있는 L. 루테리 분취량을 통째로 취하여 얼음 위에서 해동합니다.</li>
	<li>5 μL에서 10 μL의 플라스미드(최종 플라스미드 농도 >6 nM)를 해동된 분취량에 부드럽게 혼합하여 피펫팅을 최대한 피합니다.</li>
	<li>얼음으로 식힌 1mm 간격의 전기천공 큐벳으로 옮깁니다.</li>
	<li>1.25kV, 400 Ω 및 25μF에서 전기증착.</li>
	<li>실온(RT) MRS 육수 1mL를 넣고 큐벳을 한두 번 뒤집어 섞습니다.</li>
	<li>큐벳을 37°C의 정적 인큐베이터에 2.5-3시간 동안 넣어 회복을 허용합니다.</li>
	<li>적절한 선택으로 전체 양을 여러 MRS 한천 플레이트에 플레이트합니다.</li>
	<li>작은 불이 켜진 양초("티라이트")와 혐기성 대기 생성 향 주머니가 있는 완전히 밀폐된 용기 안에 접시를 넣습니다.</li>
	<li>37 °C에서 2-3일 동안 또는 눈에 보이는 집락이 나타날 때까지 성장시킵니다.</li>
</ol>3. 내산성 형광 리포터 단백질 mCherry2의 측정
<ol><li>측정에 필요한 콜로니를 선택하고 웰당 1.5mL의 필터 멸균(비오토클레이브) MRS 브로스와 적절한 선택 항생제가 포함된 96웰 보관 마이크로플레이트에 접종합니다.</li>
	<li>흔들리지 않고 37°C에서 하룻밤 동안 24시간 동안 호기적으로 배양합니다. 참고: 이 보관 마이크로플레이트는 섹션 4(콜로니 PCR)에서 사용하기 위해 보관해야 합니다.</li>
	<li>L. reuteri 는 정지 단계에 있을 때 배지 밖으로 침전됩니다. 피펫팅을 통해 하룻밤 배양을 다시 중단합니다.</li>
	<li>200 μL를 평평하고 깨끗한 바닥의 96 웰 플레이트에 옮기고, 플레이트를 플레이트 리더로 옮기고, mCherry2 (여기 [Ex] : 589 nm; 방출 [Em] : 610 nm) 또는 기타 관련 리포터의 OD 및 형광을 측정합니다.</li>
</ol>4. 콜로니 PCR을 통한 플라스미드 흡수 확인
<ol><li>섹션 3의 96웰 보관 마이크로플레이트에서 5μL를 PCR 튜브로 옮깁니다. 알림: >5분이 경과하면 L. 루테리 를 두 번째로 다시 중단해야 할 수도 있습니다.</li>
	<li>휴대용 탁상용 미세 원심분리기에서 펠릿이 보일 때까지 회전하고(2,000 x g에서 약 2분), 상층액을 버리고, 펠릿을 20mM NaOH 20μL에 재현탁합니다.</li>
	<li>95°C에서 5분간 끓이다가 소용돌이치고 두 번 끓인다.</li>
	<li>즉시 샘플을 식히십시오. 주형 분해 및 PCR 억제 가능성을 낮추기 위해 다음 단계에서 샘플을 가능한 한 얼음에 보관하십시오.</li>
	<li>세포 파편이 펠릿화될 때까지 2,000 x g 의 휴대용 벤치탑 미세 원심분리기에서 2분 동안 스핀다운한 다음 상층액 1μL를 취하여 얼음처럼 차가운 DNase 및 RNase가 없는 ddH2O99μL로 희석합니다(100x 희석).</li>
	<li>플라스미드 특이적 프라이머를 사용하는 표준 PCR 반응에서 100x 희석액을 주형 DNA로 사용합니다. 양성 대조군을 E. coli mini-prep 유래의 플라스미드로 포함시킨다.</li>
	<li>샘플을 얼음 위에 놓고 1x 농도로 적절한 로딩 염료를 추가합니다.</li>
	<li>TAE 완충액(트리스-아세테이트-에틸렌디아민테트라아세트산[EDTA])의 1% 아가로스 겔에서 110V에서 30분 동안 실행합니다. 필요한 경우 이미지.</li>
</ol>5. L. 루테리 에 대한 미니 프렙 프로토콜, 플라스미드 존재를 확인하기 위한 PCR이 뒤따랐습니다.
알림: 재료 표에 나열된 미니 준비 키트와 함께 사용하기 위한 프로토콜입니다.
<ol><li>적절한 항생제가 들어 있는 MRS 브로스 10mL에 L. 루테리 를 접종하고 정적 배양기에서 37°C에서 하룻밤 동안 호기적으로 배양합니다.</li>
	<li>미리 냉각된 4°C 원심분리기에서 10분 동안 5,000 x g 로 원심분리합니다.</li>
	<li>이후 단계를 방해할 수 있는 산도를 무효화하기 위해 표준 P1 완충액 2mL(키트에 포함)로 펠릿을 세척하고, 이전에 설명한 것과 동일한 설정으로 원심분리하고, 상층액을 버립니다.</li>
	<li>박테리아 세포를 용해하기 위해 10mg/mL 리소자임과 100U/mL 뮤타놀리신을 포함하는 변형된 P250 완충액 250μL에 펠릿을 재현탁합니다. 37°C에서 1-2시간 동안 배양합니다.</li>
	<li>250 μL의 완충액 P2를 첨가하고, 4-6회 반전하여 혼합하고, 5분 이상 RT에서 배양한다.</li>
	<li>350 μL의 완충액 N3(키트에 포함)를 넣고 즉시 4-6회 부드럽게 뒤집어 혼합합니다.</li>
	<li>10,000 x g 에서 10분 동안 원심분리기.</li>
	<li>가능한 한 많은 상청액을 스핀 컬럼으로 옮기고 10,000 x g 에서 60초 동안 원심분리합니다. 흐름을 버립니다.</li>
	<li>스핀 컬럼을 500μL의 완충액 PB(키트에 포함)로 세척하고 10,000 x g 에서 60초 동안 원심분리기를 사용합니다. 흐름을 버립니다.</li>
	<li>750μL의 완충액 PE(키트에 포함)로 스핀 컬럼을 세척하고 10,000 x g 에서 60초 동안 원심분리합니다. 흐름을 버리고 60초 동안 원심분리하여 잔류 버퍼를 제거합니다.</li>
	<li>스핀 컬럼을 1.5mL 미세 원심분리기 튜브에 넣습니다. 20-30 μL의 DNAse- 및 RNAse-freeddH2O를 스핀 컬럼의 필터에 적용하고 1-2분 동안 방치한 후 10,000 x g 에서 60초 동안 원심분리합니다.</li>
	<li>플라스미드 특이적 프라이머(pTRKH3_pTUSeq_F: CACCCGTTCTCGGAGCA, pTRKH3_pTUSeq_R: CTACGAGTTGCATGATAAAGACA)를 사용하여 표준 PCR 반응을 수행하고, 주형 DNA를 제공하는 용출액을 사용합니다. 양성 대조군을 E. coli mini-prep 유래의 플라스미드로 포함시킨다. 참고: 이 연구에 사용된 PCR 설정은 다음과 같습니다: 98°C에서 5분, (98°C에서 30초, 55°C에서 30초, 72°C에서 45초) 30주기, 72°C에서 2분, 4°C 유지. 매개변수는 사용된 중합효소, 단편 길이 및 이 프로토콜을 사용하는 모든 사람이 사용하는 정확한 프라이머에 크게 의존합니다.</li>
</ol>

Limosilactobacillus reuteri DSM20016의 리포터 단백질 측정

<ol>
	<li>Makarova, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+genomics+of+the+lactic+acid+bacteria.">Comparative genomics of the lactic acid bacteria.</a> Proceedings of the National Academy of Sciences. 103 (42), 15611-15616 (2006).</li><li>Zheng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+taxonomic+note+on+the+genus+Lactobacillus:+Description+of+23+novel+genera,+emended+description+of+the+genus+Lactobacillus+beijerinck+1901,+and+union+of+Lactobacillaceae+and+Leuconostocaceae.">A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae.</a> International Journal of Systematic and Evolutionary Microbiology. 70 (4), 2782-2858 (2020).</li><li>Adams, M. R., Marteau, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+safety+of+lactic+acid+bacteria+from+food.">On the safety of lactic acid bacteria from food.</a> International Journal of Food Microbiology. 27 (2-3), 263-264 (1995).</li><li>Urba&#324;ska, M., Gieruszczak-Bia&#322;ek, D., Szajewska, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+review+with+meta-analysis:+Lactobacillus+reuteri+DSM+17938+for+diarrhoeal+diseases+in+children.">Systematic review with meta-analysis: Lactobacillus reuteri DSM 17938 for diarrhoeal diseases in children.</a> Alimentary Pharmacology and Therapeutics. 43 (10), 1025-1034 (2016).</li><li>Jansson, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probiotic+treatment+using+a+mix+of+three+Lactobacillus+strains+for+lumbar+spine+bone+loss+in+postmenopausal+women:+a+randomised,+double-blind,+placebo-controlled,+multicentre+trial.">Probiotic treatment using a mix of three Lactobacillus strains for lumbar spine bone loss in postmenopausal women: a randomised, double-blind, placebo-controlled, multicentre trial.</a> The Lancet Rheumatology. 1 (3), e154-e162 (2019).</li><li>Yang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+non-viable+Lactobacillus+reuteri+combining+with+14-day+standard+triple+therapy+on+Helicobacterpylori+eradication:+A+randomized+double-blind+placebo-controlled+trial.">Effects of non-viable Lactobacillus reuteri combining with 14-day standard triple therapy on Helicobacterpylori eradication: A randomized double-blind placebo-controlled trial.</a> Helicobacter. 26 (6), 12856 (2021).</li><li>Nikawa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lactobacillus+reuteri+in+bovine+milk+fermented+decreases+the+oral+carriage+of+mutans+streptococci.">Lactobacillus reuteri in bovine milk fermented decreases the oral carriage of mutans streptococci.</a> International Journal of Food Microbiology. 95 (2), 219-223 (2004).</li><li>Reuter, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Lactobacillus+and+Bifidobacterium+microflora+of+the+human+intestine:+Composition+and+succession.">The Lactobacillus and Bifidobacterium microflora of the human intestine: Composition and succession.</a> Current Issues in Intestinal Microbiology. 2 (2), 43-53 (2001).</li><li>Aukrust, T. W., Brurberg, M. B., Nes, I. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Lactobacillus+by+electroporation.">Transformation of Lactobacillus by electroporation.</a> Methods in Molecular Biology. 47, 201-208 (1995).</li><li>Lubkowicz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+probiotic+Lactobacillus+reuteri+as+a+biosensor+for+Staphylococcus+aureus+derived+AIP-I+detection.">Reprogramming probiotic Lactobacillus reuteri as a biosensor for Staphylococcus aureus derived AIP-I detection.</a> ACS Synthetic Biology. 7 (5), 1229-1237 (2018).</li><li>Walter, J., Britton, R. A., Roos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-microbial+symbiosis+in+the+vertebrate+gastrointestinal+tract+and+the+Lactobacillus+reuteri+paradigm.">Host-microbial symbiosis in the vertebrate gastrointestinal tract and the Lactobacillus reuteri paradigm.</a> Proceedings of the National Academy of Sciences. 108, 4645-4652 (2011).</li><li>Ahmad, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+bimodal+molecular+weight+levan+by+a+Lactobacillus+reuteri+isolate+from+fish+gut.">Production of bimodal molecular weight levan by a Lactobacillus reuteri isolate from fish gut.</a> Folia Microbiologica. 67 (1), 21-31 (2022).</li><li>MacKenzie, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain-specific+diversity+of+mucus-binding+proteins+in+the+adhesion+and+aggregation+properties+of+Lactobacillus+reuteri.">Strain-specific diversity of mucus-binding proteins in the adhesion and aggregation properties of Lactobacillus reuteri.</a> Microbiology. 156 (11), 3368-3378 (2010).</li><li>Oh, J. H., van Pijkeren, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9-assisted+recombineering+in+Lactobacillus+reuteri.">CRISPR-Cas9-assisted recombineering in Lactobacillus reuteri.</a> Nucleic Acids Research. 42 (17), 131 (2014).</li><li>Song, X., Huang, H., Xiong, Z., Ai, L., Yang, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9D10A+nickase-assisted+genome+editing+in+Lactobacillus+casei.">CRISPR-Cas9D10A nickase-assisted genome editing in Lactobacillus casei.</a> Applied and Environmental Microbiology. 83 (22), e01259 (2017).</li><li>Goh, Y. J., Barrangoua, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Portable+CRISPR-Cas9N+system+for+flexible+genome+engineering+in+Lactobacillus+acidophilus,+Lactobacillus+gasseri,+and+Lactobacillus+paracasei.">Portable CRISPR-Cas9N system for flexible genome engineering in Lactobacillus acidophilus, Lactobacillus gasseri, and Lactobacillus paracasei.</a> Applied and Environmental Microbiology. 87 (6), e02669 (2021).</li><li>Berthier, F., Zagorec, M., Champomier-Verg, M., Ehrlich, S. D., Morel-Devillel, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+Lactobacillus+sake+by+electroporation.">Efficient transformation of Lactobacillus sake by electroporation.</a> Microbiology. 142 (5), 1273-1279 (1996).</li><li>Rattanachaikunsopon, P., Phumkhachorn, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glass+bead+transformation+method+for+gram-positive+bacteria.">Glass bead transformation method for gram-positive bacteria.</a> Brazilian Journal of Microbiology. 40 (4), 923 (2009).</li><li>Pfl&#252;gl, S., Marx, H., Mattanovich, D., Sauer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+Lactobacillus+diolivorans.">Genetic engineering of Lactobacillus diolivorans.</a> FEMS Microbiology Letters. 344 (2), 152-158 (2013).</li><li>Spath, K., Heinl, S., Grabherr, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+cloning+in+Lactobacillus+plantarum:+Electroporation+with+non-methylated+plasmid+DNA+enhances+transformation+efficiency+and+makes+shuttle+vectors+obsolete.">Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete.</a> Microbial Cell Factories. 11, 141 (2012).</li><li>Ortiz-Velez, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+alterations+associated+with+improved+transformation+efficiency+in+Lactobacillus+reuteri.">Genome alterations associated with improved transformation efficiency in Lactobacillus reuteri.</a> Microbial Cell Factories. 17 (1), 138 (2018).</li><li>O'Sullivan, D. J., Klaenhammer, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+mini-prep+isolation+of+high-quality+plasmid+DNA+from+Lactococcus+and+Lactobacillus+spp.">Rapid mini-prep isolation of high-quality plasmid DNA from Lactococcus and Lactobacillus spp.</a> Applied and Environmental Microbiology. 59 (8), 2730-2733 (1993).</li><li>Lizier, M., Sarra, P. G., Cauda, R., Lucchini, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+expression+vectors+in+Lactobacillus+reuteri+strains.">Comparison of expression vectors in Lactobacillus reuteri strains.</a> FEMS Microbiology Letters. 308 (1), 8-15 (2010).</li><li>Roberts, R. J., Vincze, T., Posfai, J., Macelis, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=REBASE-a+database+for+DNA+restriction+and+modification:+Enzymes,+genes+and+genomes.">REBASE-a database for DNA restriction and modification: Enzymes, genes and genomes.</a> Nucleic Acids Research. 43, D298-D299 (2015).</li><li>Ahrne, S., Molin, G., Axelsson, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Lactobacillus+reuteri+with+electroporation:+Studies+on+the+erythromycin+resistance+plasmid+pLUL631.">Transformation of Lactobacillus reuteri with electroporation: Studies on the erythromycin resistance plasmid pLUL631.</a> Current Microbiology. 24, 199-205 (1992).</li></ol>

이해 상충이 존재하지 않습니다.

L. 루테리 DSM20016의 형질전환을 위한 가장 중요한 단계는 형질전환이 도금된 후 혐기성 성장 조건의 생성입니다. 호기성 조건에서 얻은 콜로니는 매우 가끔씩만 발생하며 일반적으로 MRS 국물에 접종하면 성장하지 않습니다. 콜로니 성장 가능성을 최대화하기 위해 전체 회수량을 도금하는 것도 연습해야 합니다. 이 두 가지 중요한 단계에도 불구하고, 형질전환 효율은 여전히 실험의 한계이?...

락토바실러스(Lactobacillus) 속은 역사적으로 그람 양성, 막대 모양, 포자 형성이 없는 통성 혐기성 세균 또는 주로 젖산1을 생성하기 위해 당을 분해하는 미세호기성 미생물로 분류되었습니다. 이러한 느슨한 기준으로 인해 락토바실러스는 표현형적으로나 유전형적으로 매우 다양한 속이 되었습니다. 이러한 광범위한 분류로 인해 속이 재분류되어 2020년에 23개의 새로운 속이 도입되었습니다2.
오래되고 더 넓은 속(genus)에는 일반적으로 섭취하기에 안전한 것으로 간주되는(GRAS) 주요 공생 및 프로바이오틱 종(probiotic species)이 포함되었다3. 락토바실라과(Lactobacillaceae)는 다양한 균주 4,5,6,7의 섭취를 통해 제공되는 많은 보고된 건강상의 이점으로 인해 '좋은 박테리아'라는 대중의 인식을 유지하고 있습니다. 위장관을 쉽게 탐색할 수 있는 방법8과 대중의 인정은 락토바실라과(Lactobacillaceae) 균주를 섭취 가능한 의약, 치료 또는 진단 응용 분야를 위한 섀시 유기체와 같은 강력한 후보로 포지셔닝합니다.
Lactobacillaceae 계통에 존재하는 광범위한 특성으로 인해 사실상의 모델-유기체 균주가 없는 상황이 발생했습니다. 연구 그룹은 특정 목표와 가장 관련이있는 특성을 가진 종을 선택하는 경향이 있습니다. (예를 들어, 유제품 발효 실험실은 L. lactis를 선택할 수 있고, 식물성 발효 연구는 L. plantarum을 선택할 수 있으며, 프로바이오틱스에 대한 연구는 L. acidophilus에 초점을 맞출 수 있습니다.)
종에 걸친 이와 같은 광범위한 특성으로 인해 락토바실라과(Lactobacillaceae ) 계열의 한 하위 집합에서는 잘 작동할 수 있지만 다른 부분집합에서는 효율적으로 작동하기 위해(또는 전혀 기능하지 않는) 최적화가 필요한 프로토콜과 절차가 축적되었습니다9. 가족 구성원 간, 심지어 같은 종의 구성원 내에서도 최적화에 대한 이러한 필요성은 익숙하지 않은 연구자의 노력을 좌절시킬 수 있습니다. 논문의 방법 섹션에 발표된 프로토콜은 또한 그들 자신의 수정(10)을 포함할 수 있으며, 이는 단편화되고 분산된 프로토콜 모음으로 이어진다.
L. 루테리(L. reuteri)는 포유류, 조류11 및 어류12 위장관(GI)에서 일관되게 발견되는 널리 척추동물 공생동물로 여겨진다. L. 루테리 하위 균주는 종종 점액 접착 단백질 적응을 통해 유전적으로 특수화되어 특정 토착 숙주를 보다 영구적으로 식민지화합니다 8,11,13. 위장관 리모실락토바실러스(Limosilactobacillus) 종은 본래 숙주 외부의 숙주에서 분리될 수 있지만, 일시적인 성질을 띠는 경향이 있다8.
인간-숙주 전문화로 인해 L. 루테리 DSM20016는 인간 위장관의 어느 지점에서든 진단 또는 치료 적용을 위한 섀시로 매우 잘 자리 잡았으며, 균주 DSM20016은 더 일시적인 균주와 비교할 때 중재에 더 오래 지속되는 효과 창을 제공할 수 있습니다.
이 논문에서는 분자 및 시스템 생물학 응용 분야에 도움이 되는 다른 출처의 균주에 대한 중앙 집중식 정보와 함께 Limosilactobacillus reuteri( 균주 명칭: F275, 기타 수집 번호: DSM20016, ATCC23272, CIP109823)에서 효과가 입증된 일련의 프로토콜을 간략하게 설명합니다. 여기에 제시된 절차는 L. reuteri를 배양하고, 전기적격 스톡을 생성하고, 형질전환된 콜로니를 선택하고, 콜로니 중합효소 연쇄 반응(PCR) 을 통해 형질을 확인하고, 형광 리포터 단백질을 통해 설계된 시스템 반응을 측정할 수 있도록 해야 합니다.
관련 프로토콜은 L. 루테리(L. reuteri, 균주: ATCC-PTA-6475)14에서 CRISPR-Cas9 보조 ssDNA 게놈 재조합 및 여러 non-L에서 CRSIPR-Cas9 nickase-assisted genome editing을 다루었습니다. 루테리, 락토바실라과(Lactobacillaceae) 계열 염색15,16; 그러나 이것들은 여기서 우리가 초점을 맞추는 L. reuteri DSM20016 균주를 다루지 않습니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1 kb Plus DNA Ladder</td>
			<td>NEB</td>
			<td>N3200L</td>
			<td></td>
		</tr>
		<tr>
			<td>1mL Spectrophotometer cuvettes</td>
			<td>Thomas Scientific</td>
			<td>1145J12</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose&#160;</td>
			<td>BioShop</td>
			<td>AGR001</td>
			<td></td>
		</tr>
		<tr>
			<td>Allegra X-15R (refrigerated centrifuge)</td>
			<td>Beckman Allegra&#160;</td>
			<td>N/A</td>
			<td>No longer in production</td>
		</tr>
		<tr>
			<td>AnaeroGen 2.5 L Sachet</td>
			<td>Thermo Scientific</td>
			<td>OXAN0025A</td>
			<td></td>
		</tr>
		<tr>
			<td>BTX, ECM 399 electroporation system</td>
			<td>VWR</td>
			<td>58017-984</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge tubes (50 mL)</td>
			<td>FroggaBio</td>
			<td>TB50-500</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA gel x6 loading dye</td>
			<td>NEB</td>
			<td>B7024S</td>
			<td></td>
		</tr>
		<tr>
			<td>Electroporation cuvette</td>
			<td>Fisherbrand</td>
			<td>FB101</td>
			<td></td>
		</tr>
		<tr>
			<td>Erythromycin</td>
			<td>Millipore Sigma</td>
			<td>E5389-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel electroporation bath/dock</td>
			<td>VWR</td>
			<td>76314-748</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>BioShop</td>
			<td>GLY001</td>
			<td></td>
		</tr>
		<tr>
			<td>Limosilactobacillus reuteri</td>
			<td>Leibniz Institute DSMZ</td>
			<td>DSM20016</td>
			<td>Strain designation F275</td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>BioShop</td>
			<td>LYS702.5</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes (1.7 mL)</td>
			<td>FroggaBio</td>
			<td>LMCT1.7B</td>
			<td></td>
		</tr>
		<tr>
			<td>Miniprep kit (Qiagen)</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>slpGFP replaced with constitutive, codon optimised, mCherry2 reporter protein&#160;</td>
		</tr>
		<tr>
			<td>MRS Broth (Dehydrated)</td>
			<td>Thermo Scientific</td>
			<td>CM0359B</td>
			<td></td>
		</tr>
		<tr>
			<td>Mutanolysin</td>
			<td>Millipore Sigma</td>
			<td>M9901-5KU</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH&#160;</td>
			<td>Millipore Sigma</td>
			<td>1064691000</td>
			<td></td>
		</tr>
		<tr>
			<td>P100 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000047</td>
			<td></td>
		</tr>
		<tr>
			<td>P1000 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000063</td>
			<td></td>
		</tr>
		<tr>
			<td>P2.5 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000012</td>
			<td></td>
		</tr>
		<tr>
			<td>P20 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000039</td>
			<td></td>
		</tr>
		<tr>
			<td>P200 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000055</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR tubes</td>
			<td>FroggaBio</td>
			<td>STF-A120S</td>
			<td></td>
		</tr>
		<tr>
			<td>Personal benchtop microcentrifuge</td>
			<td>Genlantis</td>
			<td>E200100</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td></td>
		</tr>
		<tr>
			<td>PTC-150 Thermal Cycler</td>
			<td>MJ Research</td>
			<td>N/A</td>
			<td>No longer in production</td>
		</tr>
		<tr>
			<td>pTRKH3_slpGFP (modified)</td>
			<td>Addgene</td>
			<td>27168</td>
			<td></td>
		</tr>
		<tr>
			<td>SPECTRONIC 200 Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>840-281700</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage microplate</td>
			<td>Fisher Scientific</td>
			<td>14-222-225</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>BioShop</td>
			<td>SUC507</td>
			<td></td>
		</tr>
		<tr>
			<td>TAE Buffer 50x</td>
			<td>Thermo Scientific</td>
			<td>B49</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>VWR</td>
			<td>58816-121</td>
			<td>No longer in production</td>
		</tr>
		<tr>
			<td>VWR 1500E incubator</td>
			<td>VWR</td>
			<td>N/A</td>
			<td>No longer in production</td>
		</tr>
	</tbody>
</table>

methods for electroporation and transformation confirmation in limosilactobacillus reuteri dsm20016

락토바실러스 는 261종으로 구성된 믿을 수 없을 정도로 크고 다양한 박테리아 속으로, 그 중 일부는 위장관 내에서 합성 생물학적 노력을 위한 섀시로 사용할 수 있는 공생 균주였습니다. 속 내에서 관찰된 광범위한 표현형 및 유전형 변이로 인해 최근 재분류와 23개의 새로운 속이 도입되었습니다.
이전 속의 다양한 변형으로 인해 한 구성원에서 입증된 프로토콜이 다른 구성원과 함께 광고된 대로 작동하지 않을 수 있습니다. 특정 균주를 정확히 조작하는 방법에 대한 중앙 집중식 정보가 부족하여 종종 다른 박테리아 계열에서 채택된 다양한 임시 접근 방식이 도입되었습니다. 이것은 현장에서 시작하는 연구자들에게 문제를 복잡하게 만들 수 있으며, 어떤 정보가 자신이 선택한 균주에 적용되는지 또는 적용되지 않는지 모를 수 있습니다.
이 백서에서는 특히 리모실락토바실러스 루테리 균주 명칭 F275(기타 수집 번호: DSM20016, ATCC23272, CIP109823)에서 입증된 성공 프로토콜 세트와 함께 문제 해결 조언 및 발생할 수 있는 일반적인 문제를 중앙 집중화하는 것을 목표로 합니다. 이러한 프로토콜은 L. 루테리 DSM20016 사용한 경험이 거의 또는 전혀 없는 연구자가 플라스미드를 형질전환하고, 형질전환을 확인하고, 리포터 단백질을 통해 플레이트 판독기에서 시스템 피드백을 측정할 수 있도록 해야 합니다.

The genus Lactobacillus were historically classified as gram-positive, rod-shaped, non-spore-forming, either facultative anaerobes or microaerophiles that break sugars down to primarily produce lactic acid1. These loose criteria led to Lactobacillus being, phenotypically and genotypically, an extremely diverse genus. This broad categorization resulted in the genus being reclassified, introducing 23 novel genera in 20202.
The old, broader genus included major commensal and probiotic species generally regarded as safe (GRAS) for consumption3. The Lactobacillaceae family maintains a public perception of being &#39;good bacteria&#39; due to many reported health benefits bestowed via the consumption of various strains4,5,6,7. The ease with which they can navigate the gastrointestinal tract8 and their public acceptance combine to position Lactobacillaceae strains as strong candidates as chassis organisms for ingestible medicinal, therapeutic, or diagnostic applications.
The wide range of characteristics present within the Lactobacillaceae family has led to a situation in which there is no de facto model-organism strain; research groups have tended to select species with the properties most relevant to their particular aims. (For example, dairy fermentation labs could choose L. lactis; studies of vegetable fermentation might select L. plantarum; research on probiotics might focus on L. acidophilus; and so on.)
This same wide range of characteristics across species has led to an accumulation of protocols and procedures that may work well for one subset of the Lactobacillaceae family, but require optimization to work efficiently (or perhaps to function at all) in others9. This need for optimization between family members and even within members of the same species can frustrate the efforts of unfamiliar researchers. Protocols published in the methods sections of papers can also include their own modifications10, leading to fragmented, decentralized protocol collections.
L. reuteri is considered a widely vertebrate commensal, found consistently in mammalian, avian11 and fish12 gastrointestinal (GI) tracts. L. reuteri sub-strains are often genetically specialized, via mucus adhesion protein adaptation, to more permanently colonize specific native hosts8,11,13. GI tract Limosilactobacillus species can be isolated in hosts outside their native host, but tend more toward a transient nature8.
Due to human-host specialization, L. reuteri DSM20016 positions itself very well as a chassis for diagnostic or therapeutic applications at any point in the human GI tract, and the strain DSM20016 could provide a longer-lasting window of effect for interventions when compared to more transitory strains.
In this paper, we outline a series of protocols with demonstrated effectiveness in Limosilactobacillus reuteri (strain designation: F275; other collection numbers: DSM20016, ATCC23272, CIP109823), along with centralized information on the strain from other sources to aid in molecular and systems biology applications. Procedures laid out herein should enable a researcher with no prior experience to culture L. reuteri, create electrocompetent stocks, select transformed colonies, confirm transformation via colony polymerase chain reaction (PCR), and measure designed system response via fluorescent reporter proteins.
We note that related protocols have covered CRISPR-Cas9 assisted ssDNA genome recombineering in L. reuteri (strain: ATCC-PTA-6475)14, and CRSIPR-Cas9 nickase-assisted genome editing in multiple non-L. reuteri, Lactobacillaceae family stains15,16; these do not, however, address the L. reuteri DSM20016 strain that is our focus here.

저자 스포트라이트: Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016  

Limosilactobacillus reuteri DSM20016의 전기천공 및 변형 확인 방법

L.Reuteri, and specifically the strain, DSM20016 is a robust, natural human gut commensal, with great promise for therapeutic delivery and disease detection throughout the gastrointestinal tract. This work will help position DSM20016 as a synthetic biology chassis for those kinds of applications. Lactobacillales have no specific model organism.Preferred species do exist, but they're usually chosen with a bias towards particular research aims. The variation within the bacterial family has led to fragmented protocols, some with iterations of modifications going back through publications. It is very difficult for people starting out to filter exactly what is and is not useful.One paper for the transformation of DSM20016 does exist, but it's not modern. Modern protocols for other Lactobacillales family members exist, but they are not DSM20016. Here we strive to provide an easy to use, centralized, modernized, complete set of protocols for DSM20016 electroporation.This protocol set offers substantial modernization over previous DSM20016 exploration protocol, and elucidates some hanging threads, as well as emphasizing parts that were previously less clear. The protocol set is also complete, and specifically for DSM20016, a strain for which other non-DSM20016 protocols are not totally compatible. One of our main goals is using microbes as inexpensive sensors and delivery systems.We're working with intestinal disease experts to use DSM20016 to sense the conditions in the gastrointestinal tract and deliver therapeutics as required.

혁신 효율성 L. 루테리는 다른 락토바실라과(Lactobacillaceae) 19,20에서 관찰된 바와 같이 dcm-/dam- 비메틸화 플라스미드를 필요로 하지 않습니다(그림 1 참조). 8.5kb 플라스미드 pTRKH3_mCherry2(pAMβ1 세타 복제 기점) 10μL를 사용한 L. 루테리 DSM20016의 전기천공법은 플라스미드 메틸화 조건에...

Watch this Scientific Journal Video about Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016 at JoVE.com

여기에서는 리 모실락토바실러스 루테리 DSM20016 작업을 위한 프로토콜, 성장, 플라스미드 형질전환, 콜로니 PCR, 형광 리포터 단백질 측정, 제한된 플라스미드 미니 프렙, 일반적인 문제 및 문제 해결을 자세히 설명합니다. 이러한 프로토콜을 통해 DSM20016에서 리포터 단백질을 측정하거나 리포터가 관여하지 않는 경우 콜로니 PCR을 통해 확인할 수 있습니다.

Lactobacillus were an incredibly large, diverse genus of bacteria comprising 261 species, several of which were commensal strains with the potential for ...

L.루테리, 특히 이 균주, DSM20016는 튼튼하고 자연적인 인간 장 공생제로, 위장관 전반에 걸쳐 치료 전달 및 질병 감지에 대한 큰 가능성을 가지고 있습니다. 이 작업은 DSM20016 이러한 종류의 응용 분야를 위한 합성 생물학 섀시로 포지셔닝하는 데 도움이 될 것입니다. 락토바실란에는 특정 모델 유기체가 없습니다.선호하는 종은 존재하지만 일반적으로 특정 연구 목표에 대한 편견으로 선택됩니다. 박테리아 계열 내의 변이로 인해 프로토콜이 단편화되었으며 일부는 출판물을 통해 반복되는 수정이 반복되었습니다. 시작하는 사람들이 유용한 것과 유용하지 않은 것을 정확히 필터링하는 것은 매우 어렵습니다.DSM20016의 변화를 위한 하나의 논문이 존재하지만 현대적이지는 않습니다. 다른 락토바실랄 계열 구성원을 위한 현대적인 프로토콜이 존재하지만 DSM20016 않습니다. 여기서 우리는 DSM20016 electroporation을 위한 사용하기 쉽고, 중앙 집중화되고, 현대화되고, 완전한 프로토콜 세트를 제공하기 위해 노력합니다.이 프로토콜 세트는 이전 DSM20016 탐사 프로토콜에 비해 상당한 현대화를 제공하며 일부 매달린 스레드를 설명하고 이전에는 명확하지 않았던 부분을 강조합니다. 프로토콜 세트도 완전하며, 특히 DSM20016의 경우 다른 비DSM20016 프로토콜이 완전히 호환되지 않는 변형입니다. 우리의 주요 목표 중 하나는 미생물을 저렴한 센서 및 전달 시스템으로 사용하는 것입니다.우리는 장 질환 전문가와 협력하여 DSM20016 사용하여 위장관의 상태를 감지하고 필요에 따라 치료제를 제공하고 있습니다.

methods-for-electroporation-transformation-confirmation

Research

JoVE Journal

Bioengineering

Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016

1.9K 조회수.  University of Toronto Mississauga. L.루테리, 특히 이 균주, DSM20016는 튼튼하고 자연적인 인간 장 공생제로, 위장관 전반에 걸쳐 치료 전달 및 질병 감지에 대한 큰 가능성을 가지고 있습니다. 이 작업은 DSM20016 이러한 종류의 응용 분야를 위한 합성 생물학 섀시로 포지셔닝하는 데 도움이 될 것입니다. 락토바실란에는 특정 모델 유기체가 없습니다.선호하는 종은 존재하지만 일반적으로 특정 연구 목표에 ?...

비디오: 저자 스포트라이트: Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016  

Lactobacillus were an incredibly large, diverse genus of bacteria comprising 261 species, several of which were commensal strains with the potential for use as a chassis for synthetic biological endeavors within the gastrointestinal tract. The wide phenotypic and genotypic variation observed within the genus led to a recent reclassification and the introduction of 23 novel genera.
Due to the breadth of variations within the old genera, protocols demonstrated in one member may not work as advertised with other members. A lack of centralized information on how exactly to manipulate specific strains has led to a range of ad hoc approaches, often adapted from other bacterial families. This can complicate matters for researchers starting in the field, who may not know which information does or does not apply to their chosen strain.
In this paper, we aim to centralize a set of protocols with demonstrated success, specifically in&#160;the Limosilactobacillus reuteri strain designation F275 (other collection numbers: DSM20016, ATCC23272, CIP109823), along with troubleshooting advice and common issues one may encounter. These protocols should enable a researcher with little to no experience working with L. reuteri DSM20016 to transform a plasmid, confirm transformation, and measure system feedback in a plate reader via a reporter protein.

Here, we present protocols for working with Limosilactobacillus reuteri DSM20016, detailing growth, plasmid transformation, colony PCR, fluorescent reporter protein measurement, and limited plasmid mini-prep, as well as common issues and troubleshooting. These protocols allow the measurement of reporter proteins in DSM20016, or confirmation via colony PCR if no reporter is involved.

연구

생체공학

Preparing Limosilactobacillus reuteri DSM20016 Electrocompetent Cells for Electroporation

Preparing Limosilactobacillus reuteri DSM20016 Electrocompetent Cells for Electroporation  

To begin, inoculate Limosilactobacillus reuteri DSM20016 from glycerol stock into six milliliters of De Man, Rogosa, Sharpe, or MRS broth, in a 50 milliliter tube. Incubate the culture aerobically overnight at 37 degrees Celsius in a static incubator. The next day, inoculate four milliliters of the overnight culture into 200 milliliters of MRS broth.Allow the culture to grow aerobically in a static 37 degrees Celsius incubator until the optical density at 600 nanometers reaches 0.5 to 0.85. Next, decant the culture into 50 milliliter centrifuge tubes and place them on ice while balancing the tubes. Centrifuge the culture in a pre chilled centrifuge and discard the supernatant.Before resuspending the pellet in 50 milliliters of prechilled double distilled water, repeat the centrifugation two times. After the last centrifugation, resuspend the pellet in 25 milliliters of double distilled water, 0.5 molar sucrose, and 10%glycerol. Centrifuge the cell suspension, discard the supernatant, and resuspend the pellet in two milliliters of double distilled water, 0.5 molar sucrose, and 10%glycerol on ice.Aliquot the suspension into 50 to 100 microliter portions in prechilled microcentrifuge tubes and store the tubes at minus 80 degrees Celsius for later use. Next, for electroporation, thaw an aliquot of electrocompetent cells on ice. Mix five to 10 microliters of the plasmid into the thawed aliquot avoiding pipetting as much as possible.Transfer the mixture to an ice chilled one milliliter gap electroporation cuvette and electroporate at 1.25 kilovolts, 400 ohms, and 25 microfarads. After electroporation, add one milliliter of MRS broth and mix by inverting the cuvette once or twice. Place the cuvettes into a static 37 degree Celsius incubator for 2.5 to three hours for recovery.Next, plate the entire suspension onto multiple MRS auger plates with appropriate selection. Place the plates inside an airtight container with a small lit candle in an anaerobic atmosphere generating sachet. Grow at 37 degrees Celsius for two to three days or until visible colonies appear.Electroporation of L.reuteri with constitutive mCherry2 producing pTRKH3 plasmid gives transformation efficiencies of roughly five to eight colonies per 200 microliters plated regardless of the plasmid methylation condition. Transformation with pNZ123 carrying no exogenous constitutive reporter protein yielded transformation efficiencies of three times 10 to the four CFU per microgram of DNA.

Limosilactobacillus reuteri DSM20016 Electroporation을 위한 Electrocompetent Cells 준비

Measurement of the Acid-Resistant Fluorescent Reporter Protein mCherry2

Pick any colony from the MRS agar plate containing electroporated L.reuteri cells and inoculate into a 96 well microplate containing filter sterilized MRS broth per well and an appropriate selection antibiotic. Incubate aerobically for 24 hours at 37 degrees Celsius without shaking. The next day, L.reuteri will precipitate out of the media in the stationary phase.Resuspend the culture by pipetting. Add 200 microliters of culture into a flat, clear, bottom 96 well plate. Transfer the plate to a plate reader and measure the optical density and fluorescence of M cherry two and other relevant reporters.Colony morphology noticeably changes in the presence of oxygen. Under low oxygen conditions colonies appear white, opaque, smooth and round. Under partial or leaky conditions, colonies appear undulate, and umbanet.Whereas under atmospheric oxygen levels colonies always appear low bait, round and dry. In wild Type L.rueteri, growth and reporter protein expression vary between colonies making accurate deductions difficult. Plasmid curing, and re-transformation can result in more stable expression but it is an uncommon and unique occurrence reliant on more stable mutant phenotypes spontaneously occurring.

내산성 형광 리포터 단백질 mCherry2의 측정

Confirmation of Plasmid Uptake via Colony PCR

Transfer five microliters of electroporated overnight growth L rotary culture from a 96 well plate to a PCR tube. Spin down the cells and discard the supernatant before resuspending the pellet in 20 microliters of 20 millimolar sodium hydroxide. Boil the samples at 95 degrees Celsius for five minutes.Vortex, and repeat the boiling once before placing the samples on ice. Spin down the cells then take one microliter of the supra natant and dilute into 99 microliters of ice cold DNAs and RNAs free double distilled water. Use the 100 times dilution as the template DNA in a standard PCR reaction, using plasmid specific primers and include a positive control with a plasmid derived from the E coli mini prep.After PCR, place the samples on ice and add an appropriate loading dye at one X concentration. Run the samples in 1%Agorase gell in TAE buffer at 110 volts for 30 minutes. Colony PCR of transformed L Rotary varying the preparation temperature resulted in differing rates of PCR success.Samples prepared on ice showed a higher percentage of success rate than that prepared at room temperature or prepared at room temperature, and then incubated at 37 degrees Celsius for 30 minutes before PCR.

Colony PCR을 통한 플라스미드 흡수 확인

Mini-Prep Protocol for Limosilactobacillus reuteri and Confirmation of Plasmid Presence by PCR

Mini-Prep Protocol for Limosilactobacillus reuteri and Confirmation of Plasmid Presence by PCR  

Inoculate L.reuteri into 10 milliliters of MRS broth containing an appropriate antibiotic and incubate overnight aerobically at 37 degrees Celsius. The next day, centrifuge the culture in a pre-chilled centrifuge Discard the supernatant and wash the pellet in two milliliters of standard P1 buffer Centrifuge again and discard the supernatant before resuspending the pellet in 250 microliters of modified P1 buffer. Incubate for one to two hours at 37 degrees Celsius.Next, add 250 microliters of buffer P2 and mix by inverting four to six times. After five minutes, add 350 microliters of buffer N3 and mix by inverting the tube. Centrifuge at 10, 000 G for 10 minutes and transfer as much supernatant as possible to a spin column.Centrifuge again for 60 seconds and discard the flow-through. Wash the spin column with 500 microliters of buffer PB and centrifuge, discarding the flow-through. Wash the spin column with 750 microliters of buffer PE and centrifuge at 10, 000 G for 60 seconds.Discard the flow-through and centrifuge again for 60 seconds to remove any residual buffer. Place the spin column in a 1.5-milliliter microcentrifuge tube. Add 20 to 30 microliters of Dnase-and RNase-free double-distilled water to the spin column filter and leave for one to two minutes before centrifuging at 10, 000 G for 60 seconds.Perform a standard PCR reaction using plasmid-specific primers with eluate providing the template DNA, including a positive control with a plasmid-derived from the E.coli mini-prep. Running the mini-prep eluate through an agarose gel results in a smear, rather than observable bands. However, subsequent PCR using the eluate as a DNA template produces expected band sizes.