We acknowledge Dou Liu, Dongliang Xu, and Pinpin Hou from the core facility of the Shanghai Immune Therapy Institute for their support in utilizing the instruments. This work was supported by National Natural Science Foundation of China Grants 31930038, U21A20199, 32100718, and 32350007(to Linrong Lu); 32100718 (to Xuexiao Jin); Innovative research team of high-level local universities in Shanghai SHSMU-ZLCX 20211600 (to Linrong Lu); Internal Incubation Program RJTJ24-QN-076(to Zejin Cui).&#160;Figure 2&#160;was prepared with Figdraw.

&#8203;All procedures were approved by the Experimental Animal Welfare Ethics Committee, Renji Hospital, Shanghai Jiao Tong University School of Medicine and are in compliance with institutional guidelines.
1. Retroviral production
<ol>
	<li>&#160;Preparation of retroviral construct
	<ol>
		<li>Use the CRISPick tool (https://portals.broadinstitute.org/gppx/crispick/public) to design the sgRNA for ROR&#947;t knockout8. Specify the reference genome as Mouse GRCm38, and choose the PAM sequence as NGG (for SpyoCas9, Hsu (2013) tracrRNA) based on CRISPRko guide system. Validate the target gene&#39;s name or other target gene formats and submit the valid input to obtain sgRNA candidates. Setting other parameters to default values, set sgRNA target to ROR&#947;t (Rorc, Gene ID: 19885) to disturb the differentiation of Th17 and select non-targeting sgRNA (abbr. sgNT, sequence: GCGAGGTATTCGGCTCCGCG) from the mouse GeCKO v2 libraries. 
		NOTE: This tool offers a range of clickable options for designing guide RNAs, allowing for convenient customization to meet specific requirements.
		<ol>
			<li>Enter the target gene name in the search box under the Quick Gene Lookup column. The system will display the gene ID and the full name of the target gene to ensure accurate selection. 
			NOTE: Additional options are available for validating different target gene formats.</li>
		</ol>
		</li>
		<li>Choose one sgRNA targeted on Rorc (abbr. sgRorc) sequence according to the high combined rank and pick order to avoid off-target matches and increase on-target efficacy (sgRorc sequence: GTCATCTGGGATCCACTACG). Synthesize two oligonucleotides for sgRorc and sgNT: for the forward oligo, append the sequence &#34;gttttagagctagaaatagcaagttaaaat&#34; to the 5&#39; end of each guide sequence; for the reverse oligo, append the sequence &#34;tttcgtcctttccacaagatatataaagc&#34; to the 3&#39; end of each guide sequence. 
		NOTE: Typically, multiple options exist for sgRNA sequences. It is essential to select 2 or 3 sgRNA sequences targeting the same genotype to assess their knockout efficiency. In our preliminary experiments, two gRNAs target to Rorc were selected for comparison (sgRNA sequence1: GTCATCTGGGATCCACTACG; sgRNA sequence2: CTTGAGTATAGTCCAGAACG). Experimental results indicated that the gRNA presented in the current method (sgRNA sequence1) exhibits higher knockout efficiency between the two.</li>
		<li>Amplify the sgRorc and sgNT coding sequences using DNA polymerase in PCR with the above primers and clone them into pMX-U6-MCS vector (between the regions of U6 promoter and the gRNA scaffold) in frame with mCherry fluorescent protein, respectively9. Set up the reaction system (50 &#181;L) as Table 1. Those primers consist of sgRNA sequence (3&#39;), which can insert the sgRNA into the vector, and a segment of vector sequence (5&#39;), which can amplify the full-length vector fragment. Additionally, design the forward and reverse primers with an overlap of approximately 18 bp within the sgRNA region (but not fully overlapping), facilitating the assembly of the linearized cloning vector during the ligation process. 
		NOTE: A linearized vector fragment at the site of sgRNA sequence with primers by PCR of approximately 5,551 kd should be obtained.</li>
		<li>Purify the construct using a gel extraction kit and circularize it using a cloning kit. Use the recombination products for transformation assays.</li>
		<li>Pick the single clones from plates and verify sgRorc or sgNT-coding sequences via first-generation sequencing, using U6 promoter primer (sequence: ATGGACTATCATATGCTTACCGTA).</li>
		<li>Select the desired single clone for amplification in the LB broth. Extract high-quality plasmid DNA from bacterial cells by using an endotoxin-free plasmid kit. 
		NOTE: Make sure that plasmid solution has a high quality. We recommend that the concentration of plasmid solution should be at least 1 &#181;g/&#181;L.</li>
	</ol>
	</li>
	<li>Preparation of packaging cells
	<ol>
		<li>Prepare Platinum-E (Plat-E) cells using the following procedure: culture Plat-E cells with Dulbecco&#39;s Modified Eagle&#39;s Medium (DMEM medium) containing 10% fetal bovine serum (FBS), 100 units/mL penicillin, and 0.1 mg/mL streptomycin in a 10 cm culture dish. It will be referred to as the cell culture medium in the following. 
		NOTE: To obtain the proper transfection efficiency, we recommend using cells in the logarithmic growth phase with less than 15 passage numbers.</li>
		<li>Split a full plate of 10 cm Plat-E cells (~2.6 &#215; 107 cells) at a proper ratio into a new 10 cm dish 1 day before transfection to achieve a cell confluency of approximately 80% the next day, which is the optimal condition for transfection. Perform cell passaging for a new 10 cm dish at a 1:3 ratio (seed ~8 &#215; 106 cells in a new 10 cm dish the day before transfection). 
		NOTE: The split ratio is contingent upon the growth condition of the cells, with higher transfection efficiency achievable in cells exhibiting robust growth. We perform cell passaging for a 10 cm dish at a 1:3 ratio. For different cell culture dishes, such as a 6 cm dish, we recommend that 1.5 &#215; 106 Plat-E cells should be seeded the day before transfection.</li>
	</ol>
	</li>
	<li>Transfection
	<ol>
		<li>One hour before transfection, substitute the cell culture medium with 8 mL of reduced serum medium without phenol red with 5% FBS, but without penicillin-streptomycin, as it may interfere with the transfection reagent. Warm the reduced serum medium to 37 &#176;C&#160;before use.</li>
		<li>Prepare the transfection mixture containing mix 1 and mix 2: mix 1 includes 18 &#181;g of plasmid DNA (pMXs-U6-MCS-sgNT-mCherry/pMXs-U6-MCS-sgRorc-mCherry) and 6 &#181;g of pCL-Ecotropic Retroviral Vector (pCL-Eco) in 1,000 &#181;L of reduced serum medium. Mix 2 contains 48 &#181;L of transfection reagent in 1,000 &#181;L of reduced serum medium. Add mix 2 drop by drop into mix 1 and mix gently and thoroughly. Incubate the complex for 15-20 min at 20-25 &#176;C.</li>
		<li>Carefully drip the mixture into the Plat-E cells, swirling the plate gently to ensure even distribution. Incubate the cells at 37 &#176;C&#160;under 5% CO2 for 6-12 h.</li>
		<li>Replace the medium with 10 mL of fresh cell culture medium and continue incubating the cells at 37 &#176;C, 5% CO2 for 48 h.</li>
		<li>Assess the transfection efficiency in Plat-E cells by detecting the retroviral vector tag, serving as a proxy, via fluorescence microscopy or flow cytometry. 
		NOTE: A strong mCherry fluorescence (the fluorescence positive exceeds 80%) signal was detected in a considerable proportion of Plat-E cells transfected with the pMX-U6-MCS vector, indicating successful transfection.</li>
		<li>Harvest the virus-containing culture supernatant and centrifuge at 1,500 &#215; g for 10 min to remove cell fragments. Aliquot the virus supernatant 1 mL per vial and store at -80 &#176;C. 
		NOTE: Filtration is an alternative method for removing cell debris. We recommend using a syringe filter with a 0.45 &#181;m pore size and a polyethersulfone (PES) membrane to minimize the retention of viral particles on the filter membrane.</li>
	</ol>
	</li>
</ol>
2. Retroviral infection of activated CD4 + T cells and Th17 differentiation
<ol>
	<li>Prepare and activate primary na&#239;ve CD4+ T cells
	<ol>
		<li>Coat each well of a 24-well cell culture plate with 2 &#181;g/mL of anti-CD3e and 4 &#181;g/mL of anti-CD28 in sterile 500 &#181;L PBS, wrap the plate in parafilm to prevent evaporation and contamination, and then incubate plate at 4 &#176;C overnight (or 37 &#176;C&#160;for 1-2 hours before plating CD4+ T cells) at the day before isolating na&#239;ve CD4+ T cells. 
		NOTE: This step is needed to perform plate-bound stimulation for the mouse T cells before performing viral transduction.</li>
		<li>On the next day, euthanize 6-8-week-old Cas9-expressing mice (R26-CAG-Cas9 mice) by CO2 asphyxiation and sterilize them with 70% ethanol.</li>
		<li>Harvest the mouse spleen and place it in PBS with 2% FBS and 100 &#181;M EDTA (FACS buffer).</li>
		<li>Grind the spleen with sterilized ground glass (matte side) in the FACS buffer, homogenize the tissue into a single-cell suspension, and filter the cell suspension through a 70 &#181;m cell strainer into a 50 mL tube. 
		NOTE: Be sure to grind the tissue gently and consistently to keep the tissue moist. Violently grinding the tissue can affect cell survival dramatically.</li>
		<li>Spin the splenic cell suspension at 800 &#215; g for 5 min. Remove the supernatant and resuspend the cell pellet in 2 mL of red cell lysis buffer. Let it sit at room temperature for 5 min, then add FACS buffer to reach a total volume of 15 mL. Centrifuge the splenocytes at 800 &#215; g for 5 min.</li>
		<li>Resuspend the splenocytes and filter them through a 40 &#181;m cell strainer. Adjust the final volume to 1 mL for the CD4+ T cell isolation.</li>
		<li>Isolate CD4+ T cells using commercial reagent kits by following the instructions in the manual.</li>
		<li>Label the CD4+ T cells with fluorescent antibodies mixture (CD4, CD25, CD44, and CD62L) at 4 &#176;C for 30 min, wash the cells with FACS buffer, and isolate the na&#239;ve CD4+ T cells using a flow cell sorter. This will result in obtaining CD4+CD25-CD62LhighCD44low na&#239;ve T cells.</li>
		<li>Remove the plate-bound stimulation supernatant from the 24-well cell culture plate (prepared in step 2.1.1) and rinse each well twice with 500 &#181;L of PBS. Plate 1 x&#160;106 na&#239;ve CD4+ T cells in 1 mL of lymphocyte culture medium in a well of the 24-well cell culture plate. Incubate the cells in the cell incubator. 
		NOTE: Lymphocyte culture medium contains 10% FBS, 100 units/mL penicillin, and 0.1 mg/mL streptomycin, 1 mM sodium pyruvate, 10 mM HEPES, and 50 &#181;M &#946;-ME in RPMI 1640 medium.</li>
	</ol>
	</li>
	<li>Retroviral infection
	<ol>
		<li>After 18-24 h, collect each well of activated cells into the 1.5 mL tube. Centrifuge at 800 &#215; g for 5 min, and discard the supernatant.</li>
		<li>Resuspend the cell pellet in 1 mL of infection mixture (10 &#181;g/mL hexadimethrine bromide, 10 mM HEPES in virus supernatant) and add 1 mL of the mixture to a new well of a 48-well cell culture plate. In the meanwhile, save enough cells as negative (un-transduced) control. 
		NOTE: It is feasible to have fewer than 1 x&#160;106 activated na&#239;ve CD4+ T cells per well, but it is not recommended to use less than 0.5 x&#160;106 cells per well. Additionally, no cells should be seeded in the peripheral wells of the 48-well culture plate.</li>
		<li>Wrap the plate with parafilm, and centrifuge at 800 x&#160;g for 90 min at 32 &#176;C. Set accelerate and decelerate at 3. After centrifugation, remove the parafilm, incubate the cells in the incubator for 4 h, and proceed with the differentiation steps.</li>
	</ol>
	</li>
	<li>Differentiation of infected cells into Th17 cells
	<ol>
		<li>Prepare the antigen-presenting cells (APC) during retroviral infection. First, obtain splenocytes from wild-type mice following the instructions from steps 2.1.2 to 2.1.4. Resuspend the splenocytes with 1 mL of lymphocyte culture medium with 50 &#181;g/mL mitomycin in a 15 mL tube. Incubate the splenocytes at 37 &#176;C&#160;under 5% CO2 for 1 h.</li>
		<li>One hour later, add PBS up to the 15 mL mark to wash the splenocytes, centrifuge at 800 x&#160;g for 5 min, discard the supernatant, resuspend the splenocytes with 1 mL of lymphocyte culture medium, and count the cell number. APC cells have been successfully prepared.</li>
		<li>After the 4 h of cell incubation (as in step 2.2.3), collect transduced CD4+ T cells in 1.5 mL tubes and centrifuge at 800 x&#160;g for 5 min. Discard the supernatant and resuspend infected cells in 600 &#181;L of PBS to wash. Centrifuge at 800 x&#160;g for 5 min and discard the supernatant.</li>
		<li>Place 0.5 &#215; 106 transduced CD4+ T cells in 1 mL of lymphocyte culture medium with 1.5 x&#160;106 APC cells in a well of a 24-well cell culture plate. Supplement with 2 &#181;g/mL of anti-CD3e, 2 &#181;g/mL of anti-CD28, and Th17 cell differentiation cocktail, which contains 10 &#181;g/mL anti-IFN&#947;, 10 &#181;g/mL anti-IL-12/IL23 p40, 10 &#181;g/mL anti-IL4, 2.5-3 ng/mL hTGF-&#946;, and 20-30 ng/mL IL-6. Culture cells for 2 days.</li>
		<li>Collect each well of cells into the 1.5 mL tubes, centrifuge at 800 x&#160;g for 5 min, and discard the supernatant. Refresh new 1 mL of the lymphocyte culture medium only with 3 ng/mL TGF-&#946; and 30 ng/mL IL-6. Place the cells in a new well of 24-well cell culture plate for an extended culture period. Analyze the cells 2 days after the medium change.</li>
	</ol>
	</li>
</ol>
3. Evaluation of transduction efficiency and differentiation results
<ol>
	<li>After two days of medium change, collect cells and centrifuge at 800 &#215; g for 5 min and discard the supernatant. Treat differentiated cells with 50 ng/mL phorbol 12-myristate 13-acetate (PMA), 500 ng/mL ionomycin and 5 &#181;g/mL brefeldin A in 500 &#181;L of lymphocyte culture medium in a new well of 24-well cell culture plate at 37 &#176;C incubator for 4 h. Harvest half of the cells for flow cytometry analysis and lyse the other half of the cells with RNA extraction buffer for qPCR analysis.</li>
	<li>For flow cytometry analysis
	<ol>
		<li>Collect the cells into 1.5 mL tubes. Add 1 mL of FACS buffer into tubes and centrifuge at 800 &#215; g for 5 min to wash the cells.</li>
		<li>Resuspend the cell pellet with fluorescent antibodies mixture (CD4 and Fixable Viability Dye in 100 &#181;L of PBS) and stain the cells at 4 &#176;C for 30 min.</li>
		<li>Wash the cells with 300 &#181;L of PBS and fix them with 300 &#181;L of 2% phosphate-buffered formaldehyde (FA) at 4 &#176;C for at least 60 min.</li>
		<li>One hour later, wash the cells with PBS, resuspend them with 600 &#181;L of 1x permeabilization buffer, and centrifuge at 800 &#215; g for 5 min.</li>
		<li>Discard the supernatant and stain with anti-IL-17A in 100 &#181;L of 1x permeabilization buffer for 60 min at room temperature or 4 &#176;C overnight.</li>
		<li>The next day, wash the cells with 1x permeabilization buffer and resuspend them in 200 &#181;L of PBS. Analyze the cells by flow cytometry10. See the Representative Results section.</li>
	</ol>
	</li>
	<li>For qPCR analysis, extract RNA following the instructions of the RNA extraction kit. Reverse-transcribe the RNA into cDNA for storage or subsequent qPCR analysis. The design of these primers should adhere to general qPCR primer design principles while also specifically targeting the region spanning the expected indel site, where gRNA-mediated cleavage has occurred. Any reduction in amplification efficiency or loss of signal at this site may serve as an indicator of successful knockout. The qPCR primers are as follows: 
	Rorc F: TCCACTACGGGGTTATCACCT; R: AGTAGGCCACATTACACTGCT. 
	IL17a F: TCAGCGTGTCCAAACACTGAG; R: CGCCAAGGGAGTTAAAGACTT.</li>
</ol>

Retroviral Transduction of Guide RNA for Gene Editing in Th17 Differentiation

<ol>
	<li>Wu, B., Wan, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+control+of+pathogenic+th17+cells+in+autoimmune+diseases.">Molecular control of pathogenic th17 cells in autoimmune diseases.</a> Int Immunopharmacol. 80, 106187 (2020).</li><li>Dong, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Th+17+cells+in+development::+An+updated+view+of+their+molecular+identity+and+genetic+programming.">Th 17 cells in development:: An updated view of their molecular identity and genetic programming.</a> Nat Rev Immunol. 8 (5), 337-348 (2008).</li><li>Patel, D. D., Kuchroo, V. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Th17+cell+pathway+in+human+immunity:+Lessons+from+genetics+and+therapeutic+interventions.">Th17 cell pathway in human immunity: Lessons from genetics and therapeutic interventions.</a> Immunity. 43 (6), 1040-1051 (2015).</li><li>Ghoreschi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+pathogenic+Th17+cells+in+the+absence+of+TGF-&#946;+signalling.">Generation of pathogenic Th17 cells in the absence of TGF-&#946; signalling.</a> Nature. 467 (7318), 967-U144 (2010).</li><li>Lee, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+and+molecular+signature+of+pathogenic+th17+cells.">Induction and molecular signature of pathogenic th17 cells.</a> Nat Immunol. 13 (10), 991-999 (2012).</li><li>Yang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+reporter+and+conditional+alleles+by+CRISPR/Cas-mediated+genome+engineering.">One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering.</a> Cell. 154 (6), 1370-1379 (2013).</li><li>Yang, H., Wang, H., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generating+genetically+modified+mice+using+CRISPR/Cas-mediated+genome+engineering.">Generating genetically modified mice using CRISPR/Cas-mediated genome engineering.</a> Nat Protoc. 9 (8), 1956-1968 (2014).</li><li>Doench, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+sgrna+design+to+maximize+activity+and+minimize+off-target+effects+of+crispr-cas9.">Optimized sgrna design to maximize activity and minimize off-target effects of crispr-cas9.</a> Nat Biotechnol. 34 (2), 184-191 (2016).</li><li>Holst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+t-cell+receptor+retrogenic+mice.">Generation of t-cell receptor retrogenic mice.</a> Nat Protoc. 1 (1), 406-417 (2006).</li><li>Ordonez, P., Bishop, K. N., Stoye, J. P., Groom, H. C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+SAMHD1+restriction+by+flow+cytometry+in+human+myeloid+U937+cells.">Analysis of SAMHD1 restriction by flow cytometry in human myeloid U937 cells.</a> J Vis Exp. (172), (2021).</li><li>Akcakaya, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+CRISPR+editing+with+no+detectable+genome-wide+off-target+mutations.">In vivo CRISPR editing with no detectable genome-wide off-target mutations.</a> Nature. 561 (7723), 416-419 (2018).</li><li>Bae, S., Park, J., Kim, J. -. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas-OFFinder:+A+fast+and+versatile+algorithm+that+searches+for+potential+off-target+sites+of+cas9+rna-guided+endonucleases.">Cas-OFFinder: A fast and versatile algorithm that searches for potential off-target sites of cas9 rna-guided endonucleases.</a> Bioinformatics. 30 (10), 1473-1475 (2014).</li><li>Singh, Y., Garden, O. A., Lang, F., Cobb, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+transduction+of+helper+T+cells+as+a+genetic+approach+to+study+mechanisms+controlling+their+differentiation+and+function.">Retroviral transduction of helper T cells as a genetic approach to study mechanisms controlling their differentiation and function.</a> J Vis Exp. (117), e54698 (2016).</li><li>Naviaux, R. K., Costanzi, E., Haas, M., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pCL+vector+system:+Rapid+production+of+helper-free,+high-titer,+recombinant+retroviruses.">The pCL vector system: Rapid production of helper-free, high-titer, recombinant retroviruses.</a> J Virol. 70 (8), 5701-5705 (1996).</li><li>Cante-Barrett, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+gene+transfer+into+human+and+murine+hematopoietic+stem+cells:+Size+matters.">Lentiviral gene transfer into human and murine hematopoietic stem cells: Size matters.</a> BMC Res Notes. 9, 312-312 (2016).</li><li>Zhong, S., Malecek, K., Perez-Garcia, A., Krogsgaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+transduction+of+T-cell+receptors+in+mouse+T-cells.">Retroviral transduction of T-cell receptors in mouse T-cells.</a> J Vis Exp. (44), 2307 (2010).</li></ol>

The authors state that there are no conflicts of interest.

CRISPR/Cas9 genome editing via retroviral delivery is a robust method for exploring the roles of helper T cells. This protocol offers a rapid and effective approach to examining specific genes involved in Th17 differentiation and function. Several critical steps must be carefully followed to achieve optimal results. First, for enhanced gene knockout efficiency, gRNAs should be carefully selected. Given the risk of off-target effects in CRISPR/Cas9 gene editing, it is prudent to choose 2-3 gRNAs with high scores, as ident...

Th17 cells, a unique subset of CD4+ T helper cells, are vital for eradicating extracellular bacteria and fungi and play a significant role in various autoimmune diseases1,2,3. Emerging evidence suggests that Th17 cells exhibit heterogeneity, functioning in both pathogenic and non-pathogenic conditions, influenced by environmental and genetic factors. Elucidating the regulatory processes that control the differentiation of Th17 cells, plasticity, and heterogeneity is crucial for the advancement of more effective immunotherapeutic strategies.
Genetically modified animals have been widely used to unveil the key regulators of Th17 cell differentiation and functions. Using genetically modified animals involves complete manipulation in vivo, providing authenticity and systematic study of its role in physiological conditions or disease models. Nevertheless, high-throughput screening with this approach is largely impractical. In vitro polarization assays provide an alternative for studying Th17 cell differentiation. Interleukin 6 (IL-6) in combination with transforming growth factor &#946;1 (TGF&#946;1) has been shown to promote the development of non-pathogenic Th17 cells, while IL-6, IL-1&#946;, and IL-23 are implicated in driving the differentiation of pathogenic Th17 cells (pTh17)4,5.
The emergence of CRISPR/Cas9 technology has facilitated precise genome editing at specific bases. When combined with retroviral transduction, this approach provides a potent, efficient, and economical genetic method for screening and functionally studying potential regulators in Th17 cells6,7. In this study, we improved the procedure for retroviral transduction within Th17 polarization system. Using a retroviral system, we infected pre-established Cas9-expressing activated na&#239;ve T cells from mice. The cells were transduced with guide RNA (gRNA) constructs driven by the U6 promoter, along with genes encoding fluorescent reporter proteins under the control of the EF1a promoter to facilitate the knockout of the target gene. Then, the transduced T cells were cultured under specific cytokine conditions to induce differentiation into Th17 cells. Notably, knocking out RoR&#947;t significantly reduced IL-17A production compared to the control group. The effectiveness of this system depends on optimized retrovirus production and transduction conditions for activated primary T cells, providing a rapid and practical approach for studying specific genes in Th17 differentiation and function.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5 M EDTA (pH 8.0)</td>
			<td>Solarbio</td>
			<td>E1170</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mm cell and tissue Culture Dish</td>
			<td>BIOFIL</td>
			<td>TCD010100</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M Hepes (Free Acid, sterile)</td>
			<td>Solarbio</td>
			<td>H1090</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well cell and tissue culture plate</td>
			<td>NEST</td>
			<td>702002</td>
			<td></td>
		</tr>
		<tr>
			<td>48-well cell and tissue culture plate</td>
			<td>NEST</td>
			<td>748002</td>
			<td></td>
		</tr>
		<tr>
			<td>Brefeldin A Solution (1,000x)</td>
			<td>BioLegend</td>
			<td>420601</td>
			<td></td>
		</tr>
		<tr>
			<td>Brilliant Violet 650 anti-mouse CD4 Antibody (RM4-5)</td>
			<td>BioLegend</td>
			<td>100546</td>
			<td></td>
		</tr>
		<tr>
			<td>CD3e Monoclonal Antibody (145-2C11), Functional Grade, eBioscience</td>
			<td>Invitrogen</td>
			<td>16-0031-82</td>
			<td></td>
		</tr>
		<tr>
			<td>CD44 Monoclonal Antibody (IM7), PE, eBioscience</td>
			<td>Invitrogen</td>
			<td>12-0441-83</td>
			<td></td>
		</tr>
		<tr>
			<td>CD62L (L-Selectin) Monoclonal Antibody (MEL-14), APC, eBioscience</td>
			<td>Invitrogen</td>
			<td>17-0621-82&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell counter</td>
			<td>Nexcelom Bioscience</td>
			<td>Cellometer Auto 2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Strainer (40 &#956;m)</td>
			<td>biosharp</td>
			<td>BS-40-CS</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Strainer (70 &#956;m)</td>
			<td><a name="RANGE!B14">biosharp</a></td>
			<td>BS-70-CS</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge&#160;</td>
			<td>eppendorf</td>
			<td>5425&#160;R</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge&#160;</td>
			<td>eppendorf</td>
			<td>5810 R</td>
			<td></td>
		</tr>
		<tr>
			<td>ChamQ SYBR Color qPCR Master Mix</td>
			<td>Vazyme</td>
			<td>Q411-02</td>
			<td></td>
		</tr>
		<tr>
			<td>ClonExpress II One Step Cloning Kit</td>
			<td>Vazyme</td>
			<td>C112</td>
			<td></td>
		</tr>
		<tr>
			<td>DH5&#945; Competent Cells</td>
			<td>Sangon Biotech</td>
			<td>B528413</td>
			<td></td>
		</tr>
		<tr>
			<td>Direct-zol RNA Miniprep</td>
			<td>ZYMO RESEARCH</td>
			<td>R2050</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM Medium</td>
			<td>BasalMedia</td>
			<td>L110KJ</td>
			<td></td>
		</tr>
		<tr>
			<td>EasySep Mouse CD4+ T Cell Isolation Kit</td>
			<td>STEMCELL</td>
			<td>19852</td>
			<td></td>
		</tr>
		<tr>
			<td>eBioscience Fixable Viability Dye eFluor 660</td>
			<td>Invitrogen</td>
			<td>65-0864-18</td>
			<td></td>
		</tr>
		<tr>
			<td>EndoFree Mini Plasmid Kit II</td>
			<td>TIANGEN</td>
			<td>DP118-02</td>
			<td></td>
		</tr>
		<tr>
			<td>ExFect Transfection Reagent</td>
			<td>Vazyme</td>
			<td>T101-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum, Premium Plus</td>
			<td>Gibco</td>
			<td>A5669701</td>
			<td></td>
		</tr>
		<tr>
			<td>FITC anti-mouse IL-17A Antibody (TC11-18H10.1)</td>
			<td>BioLegend</td>
			<td>506907</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde solution</td>
			<td>Macklin</td>
			<td>F864792</td>
			<td></td>
		</tr>
		<tr>
			<td>HiScript IV RT SuperMix for qPCR&#65288;+gDNA wiper&#65289;</td>
			<td>Vazyme</td>
			<td>R423-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Ionomycin</td>
			<td>Beyotime</td>
			<td>S1672</td>
			<td></td>
		</tr>
		<tr>
			<td>Mitomycin C</td>
			<td>Maokang Biotechnology</td>
			<td>7/7/1950</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse GRCm38</td>
			<td>NCBI</td>
			<td>RefSeq v.108.20200622</td>
			<td></td>
		</tr>
		<tr>
			<td>OPTI-MEM Reduced Serum Medium</td>
			<td>Gibco</td>
			<td>31985070</td>
			<td>reduced serum medium</td>
		</tr>
		<tr>
			<td>Pacific Blue anti-mouse CD4 Antibody (RM4-5)</td>
			<td>BioLegend</td>
			<td>100531</td>
			<td></td>
		</tr>
		<tr>
			<td>PE/Cyanine7 anti-mouse CD25 Antibody (PC61)</td>
			<td>BioLegend</td>
			<td>102015</td>
			<td></td>
		</tr>
		<tr>
			<td>PE/Cyanine7 anti-mouse CD4 Antibody (GK1.5)</td>
			<td>BioLegend</td>
			<td>100422</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (10,000 U/mL)</td>
			<td>Gibco</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>PMA/TPA&#160;</td>
			<td>Beyotime</td>
			<td>S1819</td>
			<td></td>
		</tr>
		<tr>
			<td>R26-CAG-Cas9 mice&#160;</td>
			<td>Shanghai Model Organisms Center</td>
			<td>Cat. NO. NM-KI-00120</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant Human TGF-beta 1 (CHO-Expressed) Protein, CF</td>
			<td>R&#38;D Systems</td>
			<td>11409-BH</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant Murine IL-6</td>
			<td>PeproTech</td>
			<td>216-16</td>
			<td></td>
		</tr>
		<tr>
			<td>Research Cell Analyzer</td>
			<td>BD Biosciences</td>
			<td>BD LSRFortessa</td>
			<td></td>
		</tr>
		<tr>
			<td>Research Cell Sorter</td>
			<td>SONY</td>
			<td>MA900</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 Medium</td>
			<td>BasalMedia</td>
			<td>L210KJ</td>
			<td></td>
		</tr>
		<tr>
			<td>SimpliAmp Thermal Cycler PCR System</td>
			<td>Applied Biosystems</td>
			<td>A24811</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium pyruvate solution (100 mM)</td>
			<td>Sigma-Aldrich</td>
			<td>S8636</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-LEAF Purified anti-mouse CD28 Antibody (37.51)</td>
			<td>BioLegend</td>
			<td>102121</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-LEAF Purified anti-mouse IFN-&#947; Antibody (XMG1.2)</td>
			<td>BioLegend</td>
			<td>505847</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-LEAF Purified anti-mouse IL-4 Antibody (11B11)</td>
			<td>BioLegend</td>
			<td>504135</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-LEAF Purified anti-mouse IL-12/IL-23 p40 Antibody (C17.8)</td>
			<td>BioLegend</td>
			<td>505309</td>
			<td></td>
		</tr>
		<tr>
			<td>&#946;-Mercaptoethanol (50 mM)</td>
			<td>Solarbio</td>
			<td>M8211</td>
			<td></td>
		</tr>
	</tbody>
</table>

retroviral crispr/cas9-mediated gene targeting for the study of th17 differentiation in vitro

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells can be stimulated with antigens and well-defined cytokine cocktails in vitro to mimic Th17 cell differentiation in vivo. Research has been conducted extensively on the Th17 differentiation regulation mechanisms using the in vitro Th17 polarization assay.
Conventional Th17 polarization methods typically involve obtaining na&#239;ve CD4 T cells from genetically modified mice to study the effects of specific genes on Th17 differentiation and function. These methods can be time-consuming and costly and may be influenced by cell-extrinsic factors from the knockout animals. Thus, a protocol using retroviral transduction of guide RNA to introduce gene knockout in CRISPR/Cas9 knockin primary mouse T cells serves as a very useful alternative approach. This paper presents a protocol to differentiate na&#239;ve primary T cells into Th17 cells following retroviral-mediated gene targeting, as well as the subsequent flow cytometry analysis methods for assaying infection and differentiation efficiency.

In the study, we cloned the sgRNA target to Rorc and sgRNA-non-targeting coding sequences into pMX-U6-MCS vector with mCherry fluorescent protein (Figure 1A,B). Retrovirus production was carried out according to the protocol outlined in Figure 2. The transfection was initiated on day 0, and the retroviral harvest occurred on day 2. Transfection efficiency can be tested by the mCherry fluorescence intensi...

Retroviral CRISPR/Cas9-Mediated Gene Targeting for the Study of Th17 Differentiation in Vitro

We present a protocol for retroviral transduction of guide RNA into primary T cells from Cas9 transgenic mice, providing an efficient alternative for gene editing in studying Th17 differentiation.

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells ...

retroviral-crisprcas9-mediated-gene-targeting-for-study-th17

Research

JoVE Journal

Immunology and Infection

319 Views.  Renji Hospital, Shanghai Jiao Tong University School of Medicine. We present a protocol for retroviral transduction of guide RNA into primary T cells from Cas9 transgenic mice, providing an efficient alternative for gene editing in studying Th17 differentiation.

Video: Retroviral CRISPR/Cas9-Mediated Gene Targeting for the Study of Th17 Differentiation in Vitro

Retroviral Transduction of T-cell Receptors in Mouse T-cells

T-cell receptors (TCRs) play a central role in the immune system. TCRs on T-cell surfaces can specifically recognize peptide antigens presented by antigen presenting cells (APCs)1. This recognition leads to the activation of T-cells and a series of functional outcomes (e.g. cytokine production, killing of the target cells). Understanding the functional role of TCRs is critical to harness the power of the immune system to treat a variety of immunology related diseases (e.g. cancer or autoimmunity).
It is convenient to study TCRs in mouse models, which can be accomplished in several ways. Making TCR transgenic mouse models is costly and time-consuming and currently there are only a limited number of them available2-4. Alternatively, mice with antigen-specific T-cells can be generated by bone marrow chimera. This method also takes several weeks and requires expertise5. Retroviral transduction of TCRs into in vitro activated mouse T-cells is a quick and relatively easy method to obtain T-cells of desired peptide-MHC specificity. Antigen-specific T-cells can be generated in one week and used in any downstream applications. Studying transduced T-cells also has direct application to human immunotherapy, as adoptive transfer of human T-cells transduced with antigen-specific TCRs is an emerging strategy for cancer treatment6.
Here we present a protocol to retrovirally transduce TCRs into in vitro activated mouse T-cells. Both human and mouse TCR genes can be used. Retroviruses carrying specific TCR genes are generated and used to infect mouse T-cells activated with anti-CD3 and anti-CD28 antibodies. After in vitro expansion, transduced T-cells are analyzed by flow cytometry.

We present a protocol to produce antigen-specific mouse T-cells using retroviral transduction

T-cell receptors (TCRs) play a central role in the immune system. TCRs on T-cell surfaces can specifically recognize peptide antigens presented by antigen ...

An In vitro Model to Study Heterogeneity of Human Macrophage Differentiation and Polarization

Monocyte-derived macrophages represent an important cell type of the innate immune system. Mouse models studying macrophage biology suffer from the phenotypic and functional differences between murine and human monocyte-derived macrophages. Therefore, we here describe an in vitro model to generate and study primary human macrophages. Briefly, after density gradient centrifugation of peripheral blood drawn from a forearm vein, monocytes are isolated from peripheral blood mononuclear cells using negative magnetic bead isolation. These monocytes are then cultured for six days under specific conditions to induce different types of macrophage differentiation or polarization. The model is easy to use and circumvents the problems caused by species-specific differences between mouse and man. Furthermore, it is closer to the in vivo conditions than the use of immortalized cell lines. In conclusion, the model described here is suitable to study macrophage biology, identify disease mechanisms and novel therapeutic targets. Even though not fully replacing experiments with animals or human tissues obtained post mortem, the model described here allows identification and validation of disease mechanisms and therapeutic targets that may be highly relevant to various human diseases.

An In vitro Model to Study Heterogeneity of Human Macrophage Differentiation and Polarization

Monocyte-derived macrophages are important cells of the innate immune system. Here, we describe an easy to use in vitro model to generate these cells. Using gradient centrifugation, negative bead isolation and specific cell culture conditions, monocyte-derived macrophages can be generated for phenotypic and functional studies.

Monocyte-derived macrophages represent an important cell type of the innate immune system. Mouse models studying macrophage biology suffer from the ...

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&amp;#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Retroviral Transduction of Helper T Cells as a Genetic Approach to Study Mechanisms Controlling their Differentiation and Function

Helper T cell development and function must be tightly regulated to induce an appropriate immune response that eliminates specific pathogens yet prevents autoimmunity. Many approaches involving different model organisms have been utilized to understand the mechanisms controlling helper T cell development and function. However, studies using mouse models have proven to be highly informative due to the availability of genetic, cellular, and biochemical systems. One genetic approach in mice used by many labs involves retroviral transduction of primary helper T cells. This is a powerful approach due to its relative ease, making it accessible to almost any laboratory with basic skills in molecular biology and immunology. Therefore, multiple genes in wild type or mutant forms can readily be tested for function in helper T cells to understand their importance and mechanisms of action. We have optimized this approach and describe here the protocols for production of high titer retroviruses, isolation of primary murine helper T cells, and their transduction by retroviruses and differentiation toward the different helper subsets. Finally, the use of this approach is described in uncovering mechanisms utilized by microRNAs (miRNAs) to regulate pathways controlling helper T cell development and function.

Many experimental systems have been utilized to understand the mechanisms regulating T cell development and function in an immune response. Here a genetic approach using retroviral transduction is described, which is economic, time efficient, and most importantly, highly informative in identifying regulatory pathways.

Helper T cell development and function must be tightly regulated to induce an appropriate immune response that eliminates specific pathogens yet prevents ...

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to antibiotics. Genomic studies reveal that S. aureus carries many virulence and resistance genes located in mobile genetic elements, suggesting that horizontal gene transfer (HGT) plays a critical role in S. aureus evolution. However, a full and detailed description of the methodology used to study HGT in S. aureus is still lacking, especially regarding natural transformation, which has been recently reported in this bacterium. This work describes three protocols that are useful for the in vitro investigation of HGT in S. aureus: conjugation, phage transduction, and natural transformation. To this aim, the cfr gene (chloramphenicol/florfenicol resistance), which confers the Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A (PhLOPSA)-resistance phenotype, was used. Understanding the mechanisms through which S. aureus transfers genetic materials to other strains is essential to comprehending the rapid acquisition of resistance and helps to clarify the modes of dissemination reported in surveillance programs or to further predict the spreading mode in the future.

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

We describe here three different protocols for the in vitro investigation of conjugation, transduction, and natural transformation in Staphylococcus aureus.

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to ...

Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs

Although, several methods for sequencing of paired T cell receptor (TCR) alpha and beta chains from single T cells have been developed, none so far have been conducive to downstream in vivo functional analysis of TCR heterodimers. We have developed an improved protocol based on a two-step multiplex-nested PCR, which results in a PCR product that spans entire variable regions of a human TCR alpha and beta chains. By identifying unique restriction sites and incorporating them into the PCR primers, we have made the PCR product compatible with direct sub-cloning into the template retroviral vector. The resulting retroviral construct encodes a chimeric human/mouse TCR with a mouse intracellular domain, which is functional in mouse cells or in in vivo mouse models. Overall, the protocol described here combines human single cell paired TCR alpha and beta chain identification with streamlined generation of retroviral vectors readily adaptable for in vitro and in vivo TCR expression. The video and the accompanying material are designed to give a highly detailed description of the single cell PCR, so that the critical steps can be followed and potential pitfalls avoided. Additionally, we provide a detailed description of the cloning steps necessary to generate the expression vector. Once mastered, the whole procedure from single cell sorting to TCR expression could be performed in a short two-week period.

Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs

The current protocol combines single cell paired human TCR alpha and beta chain sequencing with streamlined generation of retroviral vectors compatible with in vitro and in vivo TCR expression.

Although, several methods for sequencing of paired T cell receptor (TCR) alpha and beta chains from single T cells have been developed, none so far have ...

Targeting Cysteine Thiols for in Vitro Site-specific Glycosylation of Recombinant Proteins

Stromal interaction molecule-1 (STIM1) is a type-I transmembrane protein located on the endoplasmic reticulum (ER) and plasma membranes (PM). ER-resident STIM1 regulates the activity of PM Orai1 channels in a process known as store operated calcium (Ca2+) entry which is the principal Ca2+ signaling process that drives the immune response. STIM1 undergoes post-translational N-glycosylation at two luminal Asn sites within the Ca2+ sensing domain of the molecule. However, the biochemical, biophysical, and structure biological effects of N-glycosylated STIM1 were poorly understood until recently due to an inability to readily obtain high levels of homogeneous N-glycosylated protein. Here, we describe the implementation of an in vitro chemical approach which attaches glucose moieties to specific protein sites applicable to understanding the underlying effects of N-glycosylation on protein structure and mechanism. Using solution nuclear magnetic resonance spectroscopy we assess both efficiency of the modification as well as the structural consequences of the glucose attachment with a single sample. This approach can readily be adapted to study the myriad glycosylated proteins found in nature.

Targeting Cysteine Thiols for in Vitro Site-specific Glycosylation of Recombinant Proteins

Biochemical and structural analyses of glycosylated proteins require relatively large amounts of homogeneous samples. Here, we present an efficient chemical method for site-specific glycosylation of recombinant proteins purified from bacteria by targeting reactive Cys thiols.

Stromal interaction molecule-1 (STIM1) is a type-I transmembrane protein located on the endoplasmic reticulum (ER) and plasma membranes (PM). ER-resident ...

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Analysis of SAMHD1 Restriction by Flow Cytometry in Human Myeloid U937 Cells

Sterile &#945;-motif/histidine-aspartate domain-containing protein 1 (SAMHD1) inhibits replication of HIV-1 in quiescent myeloid cells. U937 cells are widely used as a convenient cell system for analyzing SAMHD1 activity due to a low level of SAMHD1 RNA expression, leading to undetectable endogenous protein expression. Based on similar assays developed in the Stoye laboratory to characterize other retroviral restriction factors, the Bishop lab developed a two-color restriction assay to analyze SAMHD1 in U937 cells. Murine Leukaemia Virus-like particles expressing SAMHD1, alongside YFP expressed from an IRES, are used to transduce U937 cells. Cells are then treated with phorbol myristate acetate to induce differentiation to a quiescent phenotype. Following differentiation, cells are infected with HIV-1 virus-like particles expressing a fluorescent reporter. After 48 h, cells are harvested and analyzed by flow cytometry. The proportion of HIV-infected cells in the SAMHD1-expressing population is compared to that in internal control cells lacking SAMHD1. This comparison reveals a restriction ratio. SAMHD1 expression leads to a five-fold reduction in HIV infection, corresponding to a restriction ratio of 0.2. Our recent substitution of RFP for the original GFP as the reporter gene for HIV infection has facilitated flow cytometry analysis.
This assay has been successfully used to characterize the effect of amino acid substitutions on SAMHD1 restriction by transducing with viruses encoding altered SAMHD1 proteins, derived from site-directed mutagenesis of the expression vector. For example, the catalytic site substitutions HD206-7AA show a restriction phenotype of 1, indicating a loss of restriction activity. Equally, the susceptibility of different tester viruses can be determined. The assay can be further adapted to incorporate the effect of differentiation status, metabolic status, and SAMHD1 modifiers to better understand the relationship between SAMHD1, cell metabolic state, and viral restriction.

Described here is an established method to determine the extent of HIV-1 restriction by the cellular inhibitory protein SAMHD1. Human myeloid lineage U937 cells are transduced with a SAMHD1 expression vector co-expressing YFP, differentiated and then challenged with HIV-RFP. The level of restriction is determined by flow cytometry analysis.

Sterile &#945;-motif/histidine-aspartate domain-containing protein 1 (SAMHD1) inhibits replication of HIV-1 in quiescent myeloid cells. U937 cells are ...