C.R. acknowledges funding from the Forschungsinitiative Rheinland-Pfalz and ReALity (project MORE), the BMBF Cluster4Future CurATime (project MicrobAIome; 03ZU1202CA), the Wilhelm Sander-Stiftung (Nr. 2022.131.1), and the Deutsche Zentren der Gesundheitsforschung (DZG) Innovation Fund &#34;Microbiome&#34; (81X2210129). C.R. is a scientist at the German Center for Cardiovascular Research (DZHK). C.R. is a member of the Center for Translational Vascular Biology (CTVB), the Research Center for Immunotherapy (FZI), and the Potentialbereich EXPOHEALTH at the Johannes Gutenberg-University Mainz. C.R. is a member of the DFG Research Unit 5644 INFINITE (RE 3450/15-1). C.R. was awarded a Fellowship from the Gutenberg Research College at the Johannes Gutenberg-University Mainz. K.K. is supported by the DZHK &#34;Promotion of Women Scientists&#34; Excellence Programme and is a member of Young DZHK. Z.G and O.D. are PhD students at the Mainz Research School of Translational Biomedicine (TransMed).

All procedures involving mice were approved by the local committee on the legislation of animals (Landesuntersuchungsamt Rheinland-Pfalz, Koblenz, Germany; G21-1-041). 6-8 week-old male and female B6.FVB-F2rtm1a(EUCOMM) Tg/Cdh5-cre)7Mlia/Tarc mice were used for the study. The endothelial cell-specific regulation of F2r (PAR1) occurs via the VE-Cadherin Cre promoter28. In this study, flox-F2r x VE-Cadherin Cre+ (F2R&#916;EC)&#160;exhibited reduced F2r (PAR1) expression on endothelial cells,&#160;and flox-F2r x VE-Cadherin Cre- (WT) express normal endothelial F2r (PAR1) levels. The details of the reagents and the equipment used in this study are listed in the Table of Materials.
1. Preparation for the surgery
<ol>
	<li>Sterilize the necessary surgical instruments (extra narrow scissors straight, forceps, vascular clamp, etc.).</li>
	<li>Prepare the oxygen and isoflurane-based anesthesia system with a nose cone and a heating plate.</li>
</ol>
2. Animal preparation
<ol>
	<li>Weigh the animal.</li>
	<li>Perform anesthesia: Anesthetize mice via intraperitoneal (i.p.) injection of a solution containing midazolam (5 mg/kg), medetomidine (0.5 mg/mL), and fentanyl (0.5 mg/kg) (following institutionally approved protocols).</li>
	<li>Remove hair from the neck and abdomen operation area with an electric shaver for small animals.</li>
	<li>Position the mouse in dorsal recumbency on the heating pad and connect it to the oxygen system via a nose cone. Secure limbs of the mouse&#160;to a heated pad with surgical tape. Ensure that the latex nose cone membrane fits firmly over the head of the mouse. Monitor the animal&#39;s body temperature rectally using a rodent-specific thermometer.</li>
	<li>Apply hair removal cream to remove any remaining hair from the neck surgical area and wipe the skin of the operation area with 70% ethanol.</li>
	<li>Perform a toe pinch test (pedal reflex) to ensure that the animal is fully anesthetized.</li>
</ol>
3. Surgical procedure
<ol>
	<li>Catheter implantation in the jugular vein
	<ol>
		<li>Make a transverse incision (~0.5 cm) over the trachea, remove the skin covering the neck, and isolate the right jugular vein.</li>
		<li>Use a silk thread of about 5 cm, close the distal end of the vein, and fix it with surgical forceps. Place three silk threads about 2 cm below the vein: one close to the distal end and two close to the proximal end of the jugular vein. Tie a surgical knot, but do not close the vessel.</li>
		<li>Prepare a polyethylene catheter (0.28 mm ID, 0.61 mm OD) filled with 0.9% NaCl and plugged with a 1 mL syringe. Use scissors to cut a hole between the second and third knots and implant the catheter into the jugular vein. Aspirate the syringe to ensure that blood is present in the catheter.</li>
		<li>Fix the catheter in the vein by tying the silk thread, ensuring it is securely fastened. Use medical tape to secure the syringe.</li>
		<li>Prepare Acridine orange: dilute 1:4 a 2 mg/mL stock solution with sterile saline (0.5 mg/mL final concentration) in a 1 mL syringe. Keep the syringe in the dark and inject 50 &#181;L in the mouse.</li>
		<li>Prepare nucleic acid dye: dilute 1:1000 a 5 mM stock solution with sterile saline (5 &#181;M final concentration) in a 1 mL syringe. Keep the syringe in the dark and inject 50 &#181;L in the mouse.</li>
		<li>Inject in vivo Acridine orange (50 &#181;g/&#181;L, 50 &#181;L per mouse) via the jugular vein catheter to visualize stained leukocytes and an extracellular DNA fluorescent dye similarly to stain neutrophil extracellular traps (NETs) (5 &#181;M, 50 &#181;L per mouse). NETs and leukocytes are imaged simultaneously.</li>
	</ol>
	</li>
	<li>Mesenteric I/R injury model
	<ol>
		<li>Disinfect the abdominal skin with 70% ethanol.</li>
		<li>Perform a 3-5 cm laparotomy along the linea alba using surgical scissors.</li>
		<li>Using two saline-moistened cotton tips, gently remove the intestine and identify a location with minimal fat coverage. Position small intestinal branches on a black dough to reduce the background signal.</li>
		<li>Acquire the videos before I/R (pre ischemia).</li>
		<li>Make a compress moisture with NaCl and place the intestine in it. Ensure&#160;that the intestine is surrounded by the compress and maintained moisture during step 5.6.</li>
		<li>Occlude the superior mesenteric artery with a small vascular clamp.</li>
		<li>Gently push the intestine back into the abdominal cavity using saline-moistened cotton swabs, and use a 7-0 suture to close the abdominal wall to prevent loss of moisture and temperature. Maintain ischemia for 60 min, checking anesthesia at least every 20 min.</li>
		<li>After 1 h, initiate reperfusion by removing the clamp. 
		NOTE: Proper execution of the ischemia procedure results in a visible change. Initially, the affected area will appear pale or white due to the lack of blood flow. Upon removal of the clamp, blood flow will gradually return to the ischemic region, which will regain its normal color, signifying successful occlusion. It is imperative to closely observe the mouse continuously throughout the ischemia stage.</li>
		<li>Following the ischemic period, apply a few drops of saline to the clipped area, then gently remove the microvascular clips using a clip applier.</li>
		<li>Using saline-moistened cotton tips, gently remove the intestine again, position the small branches of the vein on a black dough, inject 50 &#181;L of Acridine orange again, and capture the videos of the same vein in the same location (post-ischemia).</li>
	</ol>
	</li>
</ol>
4. Intravital high-speed video epifluorescence microscopy
<ol>
	<li>Visualize leukocytes and NETs with a high-speed wide-field fluorescence microscope equipped with a long-distance condenser, a monochromator, a 10x water immersion objective, and a charge-coupled device camera. The image acquisition was performed with a 30 ms exposure time and Alexa Fluor 488(495/519) and Rhodamine Red (570/590) filters.</li>
	<li>Use imaging software for image acquisition and analysis.</li>
	<li>Quantify cell recruitment within a 0.06 mm&#178; region of interest.</li>
	<li>Quantify adherent leukocytes as cells remaining stationary or attached to the endothelial lining for a 20 s observation period.</li>
	<li>Identify NETs as extracellular structures labeled with both leukocyte and extracellular nucleic acid fluorescent dyes.</li>
	<li>Euthanize animals by cervical dislocation at the end of the experiment (following institutionally approved protocols).</li>
</ol>
5. Liver endothelial cell (LEC) isolation and quantitative RT-PCR
<ol>
	<li>Isolate LECs via magnetic cell sorting (MACS)29.</li>
	<li>Isolate total RNA.</li>
	<li>Perform complementary DNA (cDNA) synthesis27 by mixing 2 &#181;g of total RNA with 2 &#181;L of RT Buffer, 0.8 &#181;L of dNTP Mix, 2 &#181;L of RT Random Primers, 1 &#181;L of Reverse Transcriptase, and 4.2 &#181;L sterile distilled H2O.</li>
	<li>cDNA transcription was performed applying the following conditions: 25&#160;&#176;C for 10 min, 37 &#176;C for 120 min, 85 &#176;C for 5 min.</li>
	<li>Use 20 ng of cDNA for qPCR.</li>
	<li>Use the following primers: F2r (forward): TGAACCCCCGCTCATTCTTTC, F2r (reverse): CCAGCAGGACGCTTTCATTTTT, L32 (forward): CCTCTGGTGAAGCCCAAGATC, L32 (reverse): TCTGGGTTTCCGCCAGTTT. Use the following conditions: 95&#160;&#176;C 30 s, 45 cycles of (95 &#176;C for 10 s, 60 &#176;C for 25 s), 60 &#176;C to 95 &#176;C for 6 s with &#916;&#932; 1 &#176;C.</li>
</ol>

Endothelial PAR1 Role in Leukocyte Adhesion and NET Formation During I/R Injury

The authors disclose no conflict of interest.

The mesenteric I/R injury combined with intravital microscopy was applied to a genetic mouse model of F2r (PAR1) deficiency in endothelial cells for the in vivo analysis of leukocytes and NETs after 1 h of ischemia. The mesenteric I/R injury model is frequently used in rodents with both ischemia and reperfusion times varying from minutes to several hours23,31, influencing the inflammatory outcome32 and mortality<sup class...

Acute mesenteric ischemia (AMI) is a rare pathology1 with a high mortality risk2, characterized by reduced blood flow in the mesentery due to thrombi in the celiac axis, or the superior or inferior mesenteric artery. In 60%-70% of the cases, acute occlusions of the superior mesenteric artery due to thrombosis or embolization are responsible for acute bowel ischemia3. In contrast, in 5-15% of cases, mesenteric venous thrombosis accounts for mesenteric ischemia involving the superior mesenteric vein and, more rarely, the inferior mesenteric vein4. The hypoxia and malnutrition arising from ischemia lead to energy metabolism disorders at the cellular level5. For instance, impaired mitochondrial function activates multiple signaling pathways, initiating cellular death mechanisms6. Although rapid reperfusion enables the restoration of aerobic metabolism, the restoration of blood flow to an ischemic region often causes extensive tissue injury due to reactive oxygen species (ROS) production7, calcium overload8, endothelial dysfunction9, and inflammatory responses10.
Many experimental animal models employing temporary vascular occlusion of the superior mesenteric artery have been established to elucidate the molecular mechanisms during ischemia-reperfusion (I/R) injury11. The use of such models in combination with intravital microscopy (IVM) is fundamental for gaining insights into the underlying cellular interactions and disease progression11. Gut barrier dysfunction is observed shortly after ischemia12, with the epithelium losing its integrity13, resulting in bacterial translocation to extraintestinal sites such as the mesenteric lymph nodes, spleen, liver, and kidney12,14. Reperfusion further aggravates the mucosal injury15. An inflammatory response in the arterioles is manifested by the rolling and firm adhesion of leukocytes on the endothelial cell layer, which is dependent on molecules such as L-selectin16, P-selectin (CD62P)17, platelet GPIIb/IIIa, and fibrinogen18. Interestingly, leukocyte adhesion to mesenteric venules is influenced by the presence of gut microbiota19 and Toll-like receptor 4 signaling10. I/R injury also triggers neutrophil extracellular trap (NET) formation10. Therapeutic targeting of the extracellular DNA, originating from activated leukocytes such as neutrophils, improves the outcome of intestinal I/R injury20. In the liver, I/R injury is ignited by resident microphages21, and microRNA inhibition notably attenuates apoptosis22. Of note, I/R injury in the mesentery results in gut dysbiosis, which is reversible and resolved after revascularization23.
The endothelium is also influenced by the damaging effects of I/R injury, with ROS playing a pivotal role in the process24. Leukocyte adhesion to the endothelial cell layer, endothelial damage, and alterations of nitric oxide (NO) metabolism are observed9. However, the molecular pathways involved have not yet been fully explored.
Protease-activated receptor 1 (PAR1, F2r), is a membrane receptor expressed by a variety of cells, including endothelial cells, and is activated during inflammatory conditions25. Its activation occurs when serine proteases cleave the receptor at the N-terminus, exposing the tethered ligand that, in turn, activates the receptor by binding to the second extracellular loop of the molecule26. The endothelial protein C receptor (EPCR)-PAR1 signaling pathway impacts endothelial NO homeostasis and facilitates the restoration of blood flow in peripheral ischemia27.
In this study, I/R injury was applied to a genetic mouse model characterized by endothelial cell-specific PAR1 deficiency to visualize leukocyte rolling, adhesion, and NET formation. The combination of a genetic mouse model and intravital microscopy after I/R microsurgery provides valuable insights by highlighting the specific cell types involved in the disease progression. Applying I/R injury to genetic mouse models is instrumental in identifying potential therapeutic targets that can be used to improve the course of the disease. Moreover, the significance of endothelial PAR1 in NETosis was shown.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Acridine orange</td>
			<td >Sigma-Aldrich&#160;</td>
			<td >&#160;A-6014</td>
			<td ></td>
		</tr>
		<tr >
			<td >96-well plate Multiply PCR-Platten&#160;</td>
			<td >Sarstedt</td>
			<td >721977202.00</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anaesthesia Systems for Rodents</td>
			<td >GROPPLER medizintechnik</td>
			<td >Uni Vet -Porta T-8</td>
			<td ></td>
		</tr>
		<tr >
			<td >Aqua ad injectabilia IVM</td>
			<td >B Braun Melsungen</td>
			<td >53402101</td>
			<td ></td>
		</tr>
		<tr >
			<td >black dough</td>
			<td >Staedtler</td>
			<td ></td>
			<td >modelling clay</td>
		</tr>
		<tr >
			<td >CD146 Microbeads, mouse</td>
			<td >Miltenyi Biotec</td>
			<td >130-092-007</td>
			<td ></td>
		</tr>
		<tr >
			<td >cellSens</td>
			<td >Olympus</td>
			<td >Olympus cellSense Dimension Desktop 2.3</td>
			<td >software</td>
		</tr>
		<tr >
			<td >charge-coupled device camera</td>
			<td >Hamamatsu Photonics</td>
			<td >ORCA-R2</td>
			<td >camera</td>
		</tr>
		<tr >
			<td >cotton swabs</td>
			<td >B&#246;ttger</td>
			<td >09-119-9100</td>
			<td ></td>
		</tr>
		<tr >
			<td >Curved Hemostat 125mm/5&#34;</td>
			<td >Indigo Instruments&#160;</td>
			<td >22466</td>
			<td ></td>
		</tr>
		<tr >
			<td >Depilatory cream</td>
			<td >Balea</td>
			<td >not applicable</td>
			<td ></td>
		</tr>
		<tr >
			<td >Dorbene Vet</td>
			<td >zoetis</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Dumont Forceps</td>
			<td >Fine Science Tools</td>
			<td >11251-35</td>
			<td ></td>
		</tr>
		<tr >
			<td >Ethanol p.a. 99,5 %</td>
			<td >Roth</td>
			<td >5504.20</td>
			<td ></td>
		</tr>
		<tr >
			<td >Extra Narrow Scissors &#8211; Straight/Sharp-Sharp/10.5</td>
			<td >FST</td>
			<td >14088-10</td>
			<td ></td>
		</tr>
		<tr >
			<td >Fentanyl</td>
			<td >Janssen-Cilag GmBH</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Forceps &#34;Dumont #5&#34; (Inox, tip 0.1mm, length 11 cm)</td>
			<td >FST</td>
			<td >11251-20</td>
			<td ></td>
		</tr>
		<tr >
			<td >GentleMACS C Tubes</td>
			<td >Miltenyi Biotec</td>
			<td >130-093-236</td>
			<td ></td>
		</tr>
		<tr >
			<td >Graphpadprism</td>
			<td >Graphpad</td>
			<td >Prism 10</td>
			<td >software</td>
		</tr>
		<tr >
			<td >isoflurane&#160;</td>
			<td >Piramal</td>
			<td >4150097146757.00</td>
			<td ></td>
		</tr>
		<tr >
			<td >iTaq UniversalSYBR Green Supermix 10x5ml</td>
			<td >BioRad</td>
			<td >1725125.00</td>
			<td ></td>
		</tr>
		<tr >
			<td >Leukofix medical tape</td>
			<td >BSNMedical</td>
			<td >0213600</td>
			<td ></td>
		</tr>
		<tr >
			<td >Liver Dissociation Kit, mouse</td>
			<td >Miltenyi Biotec</td>
			<td >130-105-807</td>
			<td ></td>
		</tr>
		<tr >
			<td >LS-Separation columns MACS</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-401</td>
			<td ></td>
		</tr>
		<tr >
			<td >MACS Smart Strainer 100 &#181;m</td>
			<td >Miltenyi Biotec</td>
			<td >130-098-463</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microseal B Seal Seals</td>
			<td >Biorad</td>
			<td >MSB1001</td>
			<td ></td>
		</tr>
		<tr >
			<td >Midazolam</td>
			<td >hameln</td>
			<td >5918501.00</td>
			<td ></td>
		</tr>
		<tr >
			<td >NaCl</td>
			<td >Braun</td>
			<td >2350748</td>
			<td ></td>
		</tr>
		<tr >
			<td >Needle holder</td>
			<td >FST</td>
			<td >12001-13</td>
			<td ></td>
		</tr>
		<tr >
			<td >Nonabsorbable Braided Silk Suture, Size: 7/0, 91 Meters&#160;</td>
			<td >Fine Science Tools</td>
			<td >18020-70</td>
			<td ></td>
		</tr>
		<tr >
			<td >Olympus BX51WI fluorescence microscope</td>
			<td >Olympus</td>
			<td ></td>
			<td >microscope</td>
		</tr>
		<tr >
			<td >PCR for Tube Strips</td>
			<td >Sarstedt</td>
			<td >72985002.00</td>
			<td ></td>
		</tr>
		<tr >
			<td >PCR Tube Lids</td>
			<td >Sarstedt</td>
			<td >65989002.00</td>
			<td ></td>
		</tr>
		<tr >
			<td >Plyethylene Catheter</td>
			<td >Smith Medical Deutschland GmbH</td>
			<td >800/100/100</td>
			<td ></td>
		</tr>
		<tr >
			<td >Prolene (8648G), Polypropylen 6-0, Nahtmaterial&#160;</td>
			<td >Johnson &#38; Johnson Medical GmbH&#160;</td>
			<td >8695H</td>
			<td ></td>
		</tr>
		<tr >
			<td >Relia Prep RNA Miniprep Systems</td>
			<td >Promega</td>
			<td >Z6112</td>
			<td ></td>
		</tr>
		<tr >
			<td >Reverse Tanscription Kit (High Capacity cDNA)</td>
			<td >Applied Biosystems</td>
			<td >4368813.00</td>
			<td ></td>
		</tr>
		<tr >
			<td >School scale&#160;</td>
			<td >KERN &#38; SOHN GmbH</td>
			<td >EMB 500-1</td>
			<td ></td>
		</tr>
		<tr >
			<td >Spring Scissors - Angled to Side</td>
			<td >FST</td>
			<td >15006-09</td>
			<td ></td>
		</tr>
		<tr >
			<td >Stereo microscope</td>
			<td >Leica</td>
			<td >M50</td>
			<td ></td>
		</tr>
		<tr >
			<td >Straight Hemostats 135mm/5.5&#34;</td>
			<td >Indigo Instruments&#160;</td>
			<td >22468</td>
			<td ></td>
		</tr>
		<tr >
			<td >Syringe 1 mL</td>
			<td >Braun</td>
			<td >9166017V</td>
			<td ></td>
		</tr>
		<tr >
			<td >SYTOX Orange</td>
			<td >Thermo Fisher Scientific</td>
			<td >S11368</td>
			<td ></td>
		</tr>
		<tr >
			<td >Temperature Controller TC-1000</td>
			<td >FMI F&#246;hr Medical Instruments GmbH</td>
			<td >not applicable</td>
			<td ></td>
		</tr>
		<tr >
			<td >Tissue Forceps - 1x2 Teeth</td>
			<td >FST</td>
			<td >18057-14</td>
			<td ></td>
		</tr>
		<tr >
			<td >vascular clamp</td>
			<td >Fine Science Tools</td>
			<td >18055-02</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vetiva mini</td>
			<td >WAHL</td>
			<td >1584-0480</td>
			<td ></td>
		</tr>
	</tbody>
</table>

visualization of neutrophil extracellular traps in mesenteric venules after mesenteric ischemia-reperfusion injury via intravital microscopy

Intestinal ischemia-reperfusion (I/R) injury is an acute condition characterized by tissue damage resulting from restricted blood flow to the mesenteric vessels, leading to both local and systemic pathologies with a poor prognosis. Both ischemia and reperfusion trigger a series of cellular and molecular responses, with inflammatory cells serving as key regulators of the pathology. These interactions with the ischemic endothelium are mediated by multiple adhesion receptors. Several animal models have been established to mimic this pathology and investigate the involved molecular pathways. In this study, a microsurgical model of I/R injury is combined with intravital microscopy to visualize leukocyte rolling, adhesion, and neutrophil extracellular trap (NET) formation. This model is applied to transgenic mice deficient in endothelial PAR1 (F2r) to assess the impact of PAR1 on leukocyte rolling and NET formation 1 h after ischemia and immediately following reperfusion. In vivo, Acridine Orange leukocyte staining was employed, and NETs were visualized using a nucleic acid stain. Interestingly, reduced leukocyte adhesion and NET formation were observed in mice lacking the endothelial PAR1 receptor. This model enables the in vivo analysis of key regulators involved in I/R injury.

To study the endothelial cell-dependent effects on leukocyte rolling and adhesion as well as on NET formation, initially, the efficacy of the VE-Cadherin Cre inducible F2r-deficiency was examined in endothelial cells. Magnetic cell sorting was employed to isolate hepatic endothelial cells. Subsequently, RNA was isolated, followed by quantitative real-time PCR (qRT-PCR). The F2r&#916;EC mice, in which the Cre recombinase expressed under the control of the VE-Cadherin promoter is absent, showed...

Visualization of Neutrophil Extracellular Traps in Mesenteric Venules After Mesenteric Ischemia-Reperfusion Injury via Intravital Microscopy

This protocol presents a method for inducing mesenteric ischemia-reperfusion injury and visualizing neutrophil extracellular traps (NETs) in mesenteric venules using intravital microscopy. Blood flow in the superior mesenteric artery was restricted for 1 h, followed by reperfusion, allowing direct quantification of leukocyte adhesion and NETosis.

Intestinal ischemia-reperfusion (I/R) injury is an acute condition characterized by tissue damage resulting from restricted blood flow to the mesenteric ...

visualization-neutrophil-extracellular-traps-mesenteric-venules-after

Research

JoVE Journal

Medicine

334 Views.  University Medical Center Mainz, Johannes Gutenberg-University Mainz. This protocol presents a method for inducing mesenteric ischemia-reperfusion injury and visualizing neutrophil extracellular traps (NETs) in mesenteric venules using intravital microscopy. Blood flow in the superior mesenteric artery was restricted for 1 h, followed by reperfusion, allowing direct quantification of leukocyte adhesion and NETosis.

Video: Visualization of Neutrophil Extracellular Traps in Mesenteric Venules After Mesenteric Ischemia-Reperfusion Injury via Intravital Microscopy

Ischemia-reperfusion Model of Acute Kidney Injury and Post Injury Fibrosis in Mice

Ischemia-reperfusion induced acute kidney injury (IR-AKI) is widely used as a model of AKI in mice, but results are often quite variable with high, often unreported mortality rates that may confound analyses. Bilateral renal pedicle clamping is commonly used to induce IR-AKI, but differences between effective clamp pressures and/or renal responses to ischemia between kidneys often lead to more variable results. In addition, shorter clamp times are known to induce more variable tubular injury, and while mice undergoing bilateral injury with longer clamp times develop more consistent tubular injury, they often die within the first 3 days after injury due to severe renal insufficiency. To improve post-injury survival and obtain more consistent and predictable results, we have developed two models of unilateral ischemia-reperfusion injury followed by contralateral nephrectomy. Both surgeries are performed using a dorsal approach, reducing surgical stress resulting from ventral laparotomy, commonly used for mouse IR-AKI surgeries. For induction of moderate injury BALB/c mice undergo unilateral clamping of the renal pedicle for 26 min and also undergo simultaneous contralateral nephrectomy. Using this approach, 50-60% of mice develop moderate AKI 24 hr after injury but 90-100% of mice survive. To induce more severe AKI, BALB/c mice undergo renal pedicle clamping for 30 min followed by contralateral nephrectomy 8 days after injury. This allows functional assessment of renal recovery after injury with 90-100% survival. Early post-injury tubular damage as well as post injury fibrosis are highly consistent using this model.

We describe models of moderate and severe ischemia-reperfusion-induced kidney injury in which the mice undergo unilateral renal pedicle clamping followed by simultaneous or delayed contralateral nephrectomy, respectively. These models consistently give rise to renal dysfunction and post-injury fibrosis, but injury severity and survival are dependent on mouse background, age and surgical equipment.

Ischemia-reperfusion induced acute kidney injury (IR-AKI) is widely used as a model of AKI in mice, but results are often quite variable with high, often ...

Induction and Assessment of Ischemia-reperfusion Injury in Langendorff-perfused Rat Hearts

The biochemical events surrounding ischemia reperfusion injury in the acute setting are of great importance to furthering novel treatment options for myocardial infarction and cardiac complications of thoracic surgery. The ability of certain drugs to precondition the myocardium against ischemia reperfusion injury has led to multiple clinical trials, with little success. The isolated heart model allows acute observation of the functional effects of ischemia reperfusion injury in real time, including the effects of various pharmacological interventions administered at any time-point before or within the ischemia-reperfusion injury window. Since brief periods of ischemia can precondition the heart against ischemic injury, in situ aortic cannulation is performed to allow for functional assessment of non-preconditioned myocardium. A saline filled balloon is placed into the left ventricle to allow for real-time measurement of pressure generation. Ischemic injury is simulated by the cessation of perfusion buffer flow, followed by reperfusion. The duration of both ischemia and reperfusion can be modulated to examine biochemical events at any given time-point. Although the Langendorff isolated heart model does not allow for the consideration of systemic events affecting ischemia and reperfusion, it is an excellent model for the examination of acute functional and biochemical events within the window of ischemia reperfusion injury as well as the effect of pharmacological intervention on cardiac pre- and postconditioning. The goal of this protocol is to demonstrate how to perform in situ aortic cannulation and heart excision followed by ischemia/reperfusion injury in the Langendorff model.

The isolated rat heart is an enduring model for ischemia reperfusion injury. Here, we describe the process of harvesting the beating heart from a rat via in situ aortic cannulation, Langendorff perfusion of the heart, simulated ischemia-reperfusion injury, and infarct staining to confirm the extent of ischemic insult.

The biochemical events surrounding ischemia reperfusion injury in the acute setting are of great importance to furthering novel treatment options for ...

Murine Model of Intestinal Ischemia-reperfusion Injury

Intestinal ischemia is a life-threatening condition associated with a broad range of clinical conditions including atherosclerosis, thrombosis, hypotension, necrotizing enterocolitis, bowel transplantation, trauma and chronic inflammation. Intestinal ischemia-reperfusion (IR) injury is a consequence of acute mesenteric ischemia, caused by inadequate blood flow through the mesenteric vessels, resulting in intestinal damage. Reperfusion following ischemia can further exacerbate damage of the intestine. The mechanisms of IR injury are complex and poorly understood. Therefore, experimental small animal models are critical for understanding the pathophysiology of IR injury and the development of novel therapies.
Here we describe a mouse model of acute intestinal IR injury that provides reproducible injury of the small intestine without mortality. This is achieved by inducing ischemia in the region of the distal ileum by temporally occluding the peripheral and terminal collateral branches of the superior mesenteric artery for 60 min using microvascular clips. Reperfusion for 1 hr, or 2 hr after injury results in reproducible injury of the intestine examined by histological analysis. Proper position of the microvascular clips is critical for the procedure. Therefore the video clip provides a detailed visual step-by-step description of this technique. This model of intestinal IR injury can be utilized to study the cellular and molecular mechanisms of injury and regeneration.

Here we describe the detailed procedure of intestinal ischemia-reperfusion in mice which results in reproducible injury without mortality to encourage the standardization of this technique across the field. This model of intestinal ischemia-reperfusion injury can be utilized to study the cellular and molecular mechanisms of injury and regeneration.

Intestinal ischemia is a life-threatening condition associated with a broad range of clinical conditions including atherosclerosis, thrombosis, ...

Inducing Ischemia-reperfusion Injury in the Mouse Ear Skin for Intravital Multiphoton Imaging of Immune Responses

Ischemia-reperfusion injury (IRI) occurs when there is transient hypoxia due to the obstruction of blood flow (ischemia) followed by a subsequent re-oxygenation of the tissues (reperfusion). In the skin, ischemia-reperfusion (IR) is the main contributing factor to the pathophysiology of pressure ulcers. While the cascade of events leading up to the inflammatory response has been well studied, the spatial and temporal responses of the different subsets of immune cells to an IR injury are not well understood. Existing models of IR using the clamping technique on the skin flank are highly invasive and unsuitable for studying immune responses to injury, while similar non-invasive magnet clamping studies in the skin flank are less-than-ideal for intravital imaging studies. In this protocol, we describe a robust model of non-invasive IR developed on mouse ear skin, where we aim to visualize in real-time the cellular response of immune cells after reperfusion via multiphoton intravital imaging (MP-IVM).

This protocol describes the induction of an ischemia-reperfusion (IR) model on mouse ear skin using magnet clamping. Using a custom-built intravital imaging model, we study in vivo inflammatory responses post-reperfusion. The rationale behind the development of this technique is to extend the understanding of how leukocytes respond to skin IR injury.

Ischemia-reperfusion injury (IRI) occurs when there is transient hypoxia due to the obstruction of blood flow (ischemia) followed by a subsequent ...

Evaluation of Coronary Flow Reserve After Myocardial Ischemia Reperfusion in Rats

Coronary artery disease is the leading cause of death worldwide. After an acute myocardial infarction, early and successful myocardial intervention via recanalization of the coronary artery is the most effective strategy for reducing the size of ischemic myocardium. The coronary microvasculature cannot be visualized and imaged&#160;in vivo, but there are several invasive and noninvasive techniques that can be used to assess parameters which depend directly on coronary microvascular function. The endothelial function after ischemia reperfusion can be assessed also at the level of the coronary circulation via the coronary flow reserve (CFR).&#160;In this study, peak velocity of left anterior descending (LAD) coronary arteries was measured in rats in vivo via Transthoracic Doppler Echocardiography during resting and stress challenge (induced by Dobutamine). A normal heart can increase its coronary blood flow up to four times above the resting values during stress induction. Following ischemia reperfusion, we found a significantly diminished CFR, which can be used as a marker of coronary microvascular dysfunction. CFR has opened a window on the importance of microvascular dysfunction and has been shown to predict cardiovascular risk independent of whether the severe obstructive disease is present.

Coronary flow reserve (CFR), is defined as the ratio of maximal coronary blood flow to the resting coronary blood flow. We present a protocol for evaluating CFR in rats via ultrasound, which offers the opportunity to predict cardiovascular risk factors in the absence of obstructive coronary disease.

Coronary artery disease is the leading cause of death worldwide. After an acute myocardial infarction, early and successful myocardial intervention via ...

Immunofluorescence Labelling of Human and Murine Neutrophil Extracellular Traps in Paraffin-Embedded Tissue

Neutrophil granulocytes, also called polymorphonuclear leukocytes (PMN) due to their lobulated nucleus, are the most abundant type of leukocytes. They mature in the bone marrow and are released into the peripheral blood, where they circulate for about 6&#8722;8 h; however, in tissue, they can survive for days. By diapedesis through the endothelium, they leave the blood stream, enter tissues, and migrate towards the site of an infection following chemotactic gradients.&#160;Neutrophils can combat invading microorganisms by phagocytosis,&#160;degranulation, and generation of neutrophil extracellular traps (NETs). This protocol will help to detect NETs in paraffin-embedded tissue. NETs are the result of a process called NETosis, which leads to the release of nuclear, granular, and cytoplasmic components either from living (vital NETosis) or dying (suicidal NETosis) neutrophils. In vitro, NETs form cloud-like structures, which occupy a space several times larger than that of the cells from which they descended. The backbone of NETs is chromatin, to which a selection of proteins and peptides originating from granules and cytoplasm are bound. Thereby, a high local concentration of toxic compounds is maintained so that NETs can capture and inactivate a variety of pathogens including bacteria, fungi, viruses, and parasites, while diffusion of the highly active NET components leading to damage in neighboring tissue is limited. Nevertheless, in recent years it has become apparent that NETs, if generated in abundance or cleared insufficiently, do have pathological potential ranging from autoimmune diseases to cancer. Thus, detection of NETs in tissue samples may have diagnostic significance, and the detection of NETs in diseased tissue can influence the treatment of patients. Since paraffin-embedded tissue samples are the standard specimen used for pathological analysis, it was sought to establish a protocol for fluorescent staining of NET components in paraffin-embedded tissue using commercially available antibodies.

Neutrophil extracellular traps (NETs) are three-dimensional structures generated by stimulated neutrophil granulocytes. It has become clear in recent years that NETs are involved in a wide variety of diseases. Detection of NETs in tissue may have diagnostic relevance, so standardized protocols for labelling NET components are required.

Neutrophil granulocytes, also called polymorphonuclear leukocytes (PMN) due to their lobulated nucleus, are the most abundant type of leukocytes. They ...

A Pre-clinical Rat Model for the Study of Ischemia-reperfusion Injury in Reconstructive Microsurgery

Ischemia-reperfusion injury is the main cause of flap failure in reconstructive microsurgery. The rat is the preferred preclinical animal model in many areas of biomedical research due to its cost-effectiveness and its translation to humans. This protocol describes a method to create a preclinical free skin flap model in rats with ischemia-reperfusion injury. The described 3 cm x 6 cm rat free skin flap model is easily obtained after the placement of several vascular ligatures and the section of the vascular pedicle. Then, 8 h after the ischemic insult and completion of the microsurgical anastomosis, the free skin flap develops the tissue damage. These ischemia-reperfusion injury-related damages can be studied in this model, making it a suitable model for evaluating therapeutic agents to address this pathophysiological process. Furthermore, two main monitoring techniques are described in the protocol for the assessment of this animal model: transit-time ultrasound technology and laser speckle contrast analysis.

Here, we describe a pre-clinical animal model for studying the pathophysiology of ischemia-reperfusion injury in reconstructive microsurgery. This free skin flap model based on the superficial caudal epigastric vessels in the rat may also allow for the evaluation of different therapies and compounds to counteract ischemia-reperfusion injury-related damage.

Ischemia-reperfusion injury is the main cause of flap failure in reconstructive microsurgery. The rat is the preferred preclinical animal model in many ...

Delayed Intramyocardial Delivery of Stem Cells after Ischemia Reperfusion Injury in a Murine Model

There is significant interest in the use of stem cells (SCs) for the recovery of cardiac function in individuals with myocardial injuries. Most commonly, cardiac stem cell therapy is studied by delivering SCs concurrently with the induction of myocardial injury. However, this approach presents two significant limitations: the early hostile pro-inflammatory ischemic environment may affect the survival of transplanted SCs, and it does not represent the subacute infarction scenario where SCs will likely be used. Here we describe a two-part series of surgical procedures for the induction of ischemia-reperfusion injury and delivery of mesenchymal stem cells (MSCs). This method of stem cell administration may allow for the longer viability and retention around damaged tissue by circumventing the initial immune response. A model of ischemia reperfusion injury was induced in mice accompanied by the delivery of mesenchymal stem cells (3.0 x 105), stably expressing the reporter gene firefly luciferase under the constitutively expressed CMV promoter, intramyocardially 7 days later. The animals were imaged via ultrasound and bioluminescent imaging for confirmation of injury and injection of cells, respectively. Importantly, there was no added complication rate when performing this two-procedure approach for SC delivery. This method of stem cell administration, collectively with the utilization of state-of-the-art reporter genes, may allow for the in vivo study of viability and retention of transplanted SCs in a situation of chronic ischemia commonly seen clinically, while also circumventing the initial pro-inflammatory response. In summary, we established a protocol for the delayed delivery of stem cells into the myocardium, which can be used as a potential new approach in promoting regeneration of the damaged tissue.

Stems cells are continuously investigated as potential treatments for individuals with myocardial damage, however, their decreased viability and retention within injured tissue can impact their long-term efficacy. In this manuscript we describe an alternative method for stem cell delivery in a murine model of ischemia reperfusion injury.

There is significant interest in the use of stem cells (SCs) for the recovery of cardiac function in individuals with myocardial injuries. Most commonly, ...

An Effective Mouse Model of Unilateral Renal Ischemia-Reperfusion Injury

Ischemia-reperfusion injury (IRI) is the leading cause of acute renal failure and is a significant contributor to delayed graft function. Animal models are the only available resources that mimic the complexities of the IRI-associated damage encountered in vivo. This paper describes an effective mouse model of unilateral renal IRI that delivers highly reproducible data. Ischemia is induced by occluding the right renal pedicle for 30 min followed by reperfusion. In addition to the surgical procedure, a sequential overview of the expected physiological and histopathological changes following renal IRI will be provided by comparing data from seven different reperfusion times (4 h, 8 h, 16 h, 1 day, 2 days, 4 days, and 7 days). Critical data for planning experiments ahead, such as mean surgical time, average anesthetic consumption, and body weight changes over time, will be shared. This work will help researchers implement a reliable renal IRI model and select the appropriate reperfusion time that aligns with their intended investigative goals.

Renal ischemia-reperfusion injury is associated with high morbidity and mortality in hospitalized patients. Here, we present a simple and effective mouse model of unilateral renal ischemia-reperfusion injury and provide a sequential overview of representative pathological changes observed in the kidney.

Ischemia-reperfusion injury (IRI) is the leading cause of acute renal failure and is a significant contributor to delayed graft function. Animal models ...

Induction of Myocardial Infarction and Myocardial Ischemia-Reperfusion Injury in Mice

Acute myocardial infarction is a common cardiovascular disease with high mortality. Myocardial reperfusion injury can counteract the beneficial effects of heart reflow and induce secondary myocardial injury. A simple and reproducible model of myocardial infarction and myocardial ischemia-reperfusion injury is a good tool for researchers. Here, a customizable method to create a myocardial infarction (MI) model and MIRI by precision ligation of the left anterior descending coronary artery (LAD) through micromanipulation is described. Accurate and reproducible ligature positioning of the LAD helps obtain consistent results for heart injury. ST-segment changes can help to identify model accuracy. The serum level of cardiac troponin T (cTnT) is used to assess the myocardial injury, cardiac ultrasound is employed to evaluate the myocardial systolic function, and Evans-Blue/triphenyl tetrazolium chloride staining is used to measure infarct size. In general, this protocol reduces procedure duration, ensures controllable infarct size, and improves mouse survival.

Here we describe a simple and reproducible method that can induce myocardial infarction or myocardial ischemia-reperfusion injury in mice by precision ligation of the left anterior descending coronary artery through micromanipulation.

Acute myocardial infarction is a common cardiovascular disease with high mortality. Myocardial reperfusion injury can counteract the beneficial effects of ...