المؤلفون تقر مؤسسة روبرت دبليو الألمانية، ووكالة الدفاع لتقليص التهديد (DTRA)، ومؤسسة العلوم الوطنية الناشئة حدود في البحث والابتكار (EFRI) للحصول على الدعم المالي. شكرا الكتاب أيضا ماريلاند Nanocenter وFablab من أجل دعم مرفق غرف الأبحاث.

1. التصنيع الدقيق للرقاقة ميكروفلويديك <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد الكهروكيميائية رقاقة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> نمط الذهب أقطاب <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> شطف فارغة 4 &#39;&#39; رقاقة السيليكون (درجة الجودة الأولية) مع الأسيتون، والميثانول، والأيزوبروبانول (&quot;AMI&quot; نظيفة). شطف الأيزوبروبانول من الرقاقة مع الماء منزوع الأيونات (DI)، يليه التجفيف مع N 2 بندقية. </li><li style=";text-align:right;direction:rtl"> تنمو 1 ميكرون سميكة شافي 2 طبقة التخميل مع ترسيب الأبخرة الكيميائية محسنة البلازما (PECVD) الأداة. إيداع 200 طبقة سميكة من الكروم تليها 2،000 طبقة سميكة من الذهب مع أداة DC الاخرق. </li><li style=";text-align:right;direction:rtl"> تدور &quot;PR1&quot; مقاوم الضوء الإيجابي (معلمات الغزل: 3،000 دورة في الدقيقة، 1،000 دورة في الدقيقة / ثانية، 30 ثانية) لإنشاء فيلم موحد ~ 1.6 ميكرون سميكة. قبل خبز الرقاقة لمدة 1 دقيقة في 100 درجة مئوية على طبق ساخن. </li><li style=";text-align:right;direction:rtl"> فضح رقاقة مع 190 ميغا جول / سم 2 في 405 نانومتر الطول الموجي من خلال الضوئية الرئيسية. تطوير رقاقة لمدة 30 ثانية في 352 ديفeloper وشطف الرقاقة مع DI والجافة مع N 2 بندقية. </li><li style=";text-align:right;direction:rtl"> حفر الذهب مع منمش الذهب مقابل 1.5 دقيقة. حفر الكروم مع الكروم لمنمش ~ 30 ثانية. شطف الرقاقة مع DI والجافة مع N 2 بندقية. </li><li style=";text-align:right;direction:rtl"> تجريد مقاومة للضوء مع &quot;AMI&quot; الإجراء نظيفة. ملاحظة: مؤكسد قوي وقابلة للانفجار. </li><li style=";text-align:right;direction:rtl"> تنظيف رقاقة مع 4: 1 H 2 SO 4: H 2 O 2 خليط (&quot;سمكة البيرانا&quot; نظيفة) لمدة 1 دقيقة. شطف الرقاقة مع DI والجافة مع N 2 بندقية. </li></ol></li><li style=";text-align:right;direction:rtl"> نمط البلاتين أقطاب <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تدور &quot;PR2&quot; مقاوم الضوء الإيجابي (معلمات الغزل: 3،000 دورة في الدقيقة، 1،000 دورة في الدقيقة / ثانية، 30 ثانية) لإنشاء فيلم موحد ~ 1.4 ميكرون سميكة. قبل خبز الرقاقة لمدة 1 دقيقة في 100 درجة مئوية على طبق ساخن. </li><li style=";text-align:right;direction:rtl"> فضح رقاقة مع 30 ميغا جول / سم 2 في 405 نانومتر الطول الموجي من خلال الضوئية الرئيسية. خبز الرقاقة لمدة 45 ثانية في 125 درجة مئوية على طبق ساخن. الفيضانات فضحالرقاقة مع 1،000 ميغا جول / سم 2 في 405 نانومتر الطول الموجي بدون الضوئية الرئيسية. تطوير رقاقة لمدة 2 دقيقة في 6: 1 AZ400K المطور وشطف الرقاقة مع DI والجافة مع N 2 بندقية. </li><li style=";text-align:right;direction:rtl"> إيداع 400 طبقة سميكة من التيتانيوم تليها طبقة سميكة 1600 ألف من البلاتين باستخدام نظام التبخر E-شعاع. </li><li style=";text-align:right;direction:rtl"> رفع قبالة مقاومة للضوء في حمام الأسيتون ultrasonicated لمدة 5 دقائق تليها شطف مع الأسيتون والأيزوبروبانول. شطف الرقاقة مع DI والجافة مع N 2 بندقية. </li></ol></li></ol></li><li style=";text-align:right;direction:rtl"> إعداد القنوات الفحص <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد قالب لقنوات الفحص <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> شطف فارغة 4 &#39;&#39; رقاقة السيليكون (اختبار درجة الجودة) مع &quot;AMI&quot; الإجراء نظيفة. شطف الأيزوبروبانول من الرقاقة مع DI تليها تجفيف مع N 2 بندقية. </li><li style=";text-align:right;direction:rtl"> تدور &quot;PR3&quot; مقاوم الضوء السلبية (2 خطوة المعلمات الغزل: خطوة واحدة - 600 دورة في الدقيقة، 120 دورة في الدقيقة / ثانية، 10 ثانية الخطوة الثانية - 1،150 دورة في الدقيقة، 383 دورة في الدقيقة / ثانية،27 ثانية) لخلق فيلم موحد ~ 100 ميكرون سميكة. قبل خبز الرقاقة على طبق ساخن (معلمات الخبز خطوة 2: خطوة واحدة - تكثيف من درجة حرارة الغرفة إلى 65 درجة مئوية في 300 درجة مئوية / ساعة وعقد في درجة الحرارة لمدة 10 دقيقة الخطوة 2 - المنحدر تصل إلى 95 ° C في 300 درجة مئوية / ساعة ودرجة الحرارة عقد لمدة 30 دقيقة). </li><li style=";text-align:right;direction:rtl"> فضح الرقاقة مع 2،500 ميغا جول / سم 2 في 405 نانومتر الطول الموجي من خلال الضوئية الرئيسية. بعد خبز الرقاقة من خلال زيادة تصل إلى 95 درجة مئوية في 300 درجة مئوية / ساعة وعقد في درجة الحرارة لمدة 10 دقيقة على طبق ساخن. تطوير رقاقة لمدة 10 دقيقة في بروبيلين جلايكول الأثير Monomethyl خلات (PGMEA) المطور. شطف الرقاقة مع الأيزوبروبانول والجافة مع N 2 بندقية. </li></ol></li><li style=";text-align:right;direction:rtl"> افتعال قنوات الفحص <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد 10: 1 polydimethylsiloxane (PDMS) خليط (20 غرام من المطاط الصناعي، 2 غرام من وكيل علاج) وديغا تماما في فراغ الغرفة لمدة 20 دقيقة. </li><li style=";text-align:right;direction:rtl"> تحديد ضميمة حول رقاقة العفن مع رقائق الألومنيوم وتصب ببطء PDMS غير مخمرعلى العفن. </li><li style=";text-align:right;direction:rtl"> خبز القالب مع PDMS في فرن مربع (2 المعلمات الخبز خطوة: خطوة واحدة - 5 دقائق ستزيد من درجة حرارة الغرفة إلى 80 درجة مئوية الخطوة 2 - عقد في 80 درجة مئوية لمدة 17 دقيقة). </li><li style=";text-align:right;direction:rtl"> قشر بعيدا PDMS من العفن ومكان على رقائق الألومنيوم. قطع رقائق فحص بسكين الجراح، وتحديد الثقوب مع أداة خزعة اللكم. </li></ol></li></ol></li></ol> 2. تجميع جهاز <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> محاذاة قنوات فحص PDMS مع أقطاب العمل على رقاقة الكهروكيميائية يدويا. PDMS العصي بشكل جيد لشريحة الكهروكيميائية، وختم القنوات ومنع التسرب. </li><li style=";text-align:right;direction:rtl"> توصيل أنابيب مرنة (OD 0.087 &#39;وID 0.015&#39;) إلى الكوع البلاستيك أو موصل مستقيم باستخدام أنبوب مرن قصيرة كما محول (OD 0.1875 &#39;و0.0625 ID&#39; &#39;). إرفاق وصلات إلى كل من مداخل اللكم ثقب في الجهاز. </li><li style=";text-align:right;direction:rtl"> ربط حقنة على الطرف الآخر منالأنابيب ووضع الحقنة في ضخ حقنة. بالتناوب تغيير مجموعة من حقنة، أنبوب، وموصل وفقا لالخطوة الإجراء المطلوب في الفرع 3 و حل المناظر له. </li></ol> 3. تحليل الحمض النووي التهجين ملاحظة: إدخال كل حل ببطء في قناة بمعدل تدفق 200 ميكرولتر / ساعة حتى يتم شغل القناة بأكملها. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Functionalize كل متناهية العمودية مع مختلف تسلسل ssDNA التحقيق (أداء بالتوازي مع 3 microchannels عمودية منفصلة): <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ملء كل متناهية مع حل ssDNA التحقيق حضانة مختلفة (10 ملي العازلة الفوسفات، و 100 مم كلوريد الصوديوم، و 10 ميكرومتر تريس (2 carboxyethyl) الفوسفين (TCEP)، و 1 ميكرومتر التحقيق ssDNA)، واحتضان لمدة 1 ساعة تليها الشطف متناهية مع برنامج تلفزيوني. </li><li style=";text-align:right;direction:rtl"> ملء متناهية مع محلول يحتوي على 1 ملم من 6 mercapto-1-HEXANOL (صحة الأم والطفل) في منطقة عازلة من 10 ملي PBS، 100 مم كلوريد الصوديوم و1.395 ملي TCEP، وincuيليه باتي لمدة 1 ساعة قبل الشطف متناهية مع برنامج تلفزيوني. </li></ol></li><li style=";text-align:right;direction:rtl"> رفع قبالة PDMS، وتناوب 90 درجة إلى اتجاه أفقي، ووضع أسفل لفضح صفوف منفصلة من غرف رد فعل مع كل صف يحتوي على عداد فريدة والإلكترود المرجعي (الشكل S1). </li><li style=";text-align:right;direction:rtl"> تعبئة و microchannels مع حل قياس السيطرة على 4X تتركز سيترات الصوديوم المالحة (SSC) العازلة، واحتضان لمدة 20 دقيقة. </li><li style=";text-align:right;direction:rtl"> قياس الخلفية: إملأ و microchannels مع 5 ملي فيري سيانيد / 5 ملي فيروسيانيد في محلول PBS وتسجيل القيم مقاومة للنظام الكهروكيميائية للترددات مختلفة (الكهروكيميائية الطيفي مقاومة، EIS) باستخدام potentiostat متصلة العمل، ومكافحة، وأقطاب المرجعية ( EIS المعلمات: نطاق الترددات من 1 ميغاهيرتز إلى 0.1 هرتز، 10 نقاط البيانات تردد في العقد الواحد، 25 فولت السعة، 5 بالسيارات الاستقطاب مقابل الإلكترود المرجعي). تكرار هذا القياس لكل العاملين في القطب و microchannels. </لى&gt; <li style=";text-align:right;direction:rtl"> قياس تهجين الحمض النووي (أداء لكل هدف ssDNA غير التكميلي والتكميلي). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تعبئة و microchannels مع الهدف ssDNA حل قياس 4X تتركز عازلة SSC تحتوي على 1 ميكرومتر من الهدف ssDNA، واحتضان لمدة 20 دقيقة. قياس الحمض النووي وفقا للخطوة 3.4. </li></ol></li></ol>

<ol>
	<li>Hong, J., Edel, J. B., deMello, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micro-+and+nanofluidic+systems+for+high-throughput+biological+screening.">Micro- and nanofluidic systems for high-throughput biological screening.</a> Drug Discov. Today. 14, 134-146 (2009).</li><li>Sun, Y., Kwok, Y. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymeric+microfluidic+system+for+DNA+analysis.">Polymeric microfluidic system for DNA analysis.</a> Anal. Chim. Acta. 556, 80-96 (2006).</li><li>Xu, Y., Yang, X., Wang, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review:+aptamers+in+microfluidic+chips.">Review: aptamers in microfluidic chips.</a> Anal. Chim. Acta. 683, 12-20 (2010).</li><li>Yang, W., Woolley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+multiprocess+microfluidic+systems+for+automating+analysis.">Integrated multiprocess microfluidic systems for automating analysis.</a> J. Lab. Automat. 15, 198-209 (2010).</li><li>Gervais, T., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mass+transport+and+surface+reactions+in+micro&#64258;uidic+systems.">Mass transport and surface reactions in micro&#64258;uidic systems.</a> Chem. Eng. Sci. 61, 1102-1121 (2006).</li><li>Song, H., Ismagilov, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond+kinetics+on+a+microfluidic+chip+using+nanoliters+of+reagents.">Millisecond kinetics on a microfluidic chip using nanoliters of reagents.</a> J. Am. Chem. Soc. 125, 14613-14619 (2003).</li><li>Jiang, H., Weng, X. A., Li, D. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+whole-blood+immunoassays.">Microfluidic whole-blood immunoassays.</a> Microfluid. Nanofluid. 10, 941-964 (2011).</li><li>Dutse, S. W., Yusof, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+lab-on-chip+systems+in+DNA-based+biosensing:+an+overview.">Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview.</a> Sensors. 11, 5754-5768 (2011).</li><li>Dittrich, P. S., Manz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lab-on-a-chip:+microfluidics+in+drug+discovery.">Lab-on-a-chip: microfluidics in drug discovery.</a> Nat. Rev. Drug Discov. 5, 210-218 (2006).</li><li>Craighead, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Future+lab-on-a-chip+technologies+for+interrogating+individual+molecules.">Future lab-on-a-chip technologies for interrogating individual molecules.</a> Nature. 442, 387-393 (2006).</li><li>Hunt, H. K., Armani, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+biological+and+chemical+sensors.">Label-free biological and chemical sensors.</a> Nanoscale. 2, 1544-1559 (2010).</li><li>Dukkipati, V. R., Pang, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+microfluidic+system+for+DNA+analysis.">Integrated microfluidic system for DNA analysis.</a> IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).</li><li>Fang, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+microfluidic+devices+with+concurrent+electrochemical+detection.">Real-time PCR microfluidic devices with concurrent electrochemical detection.</a> Biosens. Bioelectron. 24, 2131-2136 (2009).</li><li>Pavlovic, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+device+architecture+for+electrochemical+patterning+and+detection+of+multiple+DNA+sequences.">Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences.</a> Langmuir. 24, 1102-1107 (2008).</li><li>Xu, X., Zhang, S., Chen, H., Kong, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+electrochemistry+in+micro-total+analysis+systems+for+biochemical+assays:+recent+developments.">Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.</a> Talanta. 80, 8-18 (2009).</li><li>Cai, H., Lee, T. M. -. H., Hsing, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+protein+recognition+using+an+aptamer-based+impedance+measurement+assay.">Label-free protein recognition using an aptamer-based impedance measurement assay.</a> Sensor. Actuat. B-Chem. 114, 433-437 (2006).</li><li>Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic+device+for+impedance+spectroscopy+analysis+of+biological+samples.">A Microfluidic device for impedance spectroscopy analysis of biological samples.</a> Sensor. Actuat. B-Chem. 123, 168-176 (2007).</li><li>Prakash, S. B., Abshire, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+cancer+cell+proliferation+on+a+CMOS+capacitance+sensor+chip.">Tracking cancer cell proliferation on a CMOS capacitance sensor chip.</a> Biosens. Bioelectron. 23, 1449-1457 (2008).</li><li>Yamaguchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+fabrication+of+electrochemical+enzyme+sensor+chip+using+polydimethylsiloxane+microfluidic+channel.">Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel.</a> Anal. Chim. Acta. 468, 143-152 (2002).</li><li>Beebe, D. J., Mensing, G. A., Walker, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physics+and+applications+of+microfluidics+in+biology.">Physics and applications of microfluidics in biology.</a> Annu. Rev. Biomed. Eng. 4, 261-286 (2002).</li><li>Mariella, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preparation:+the+weak+link+in+microfluidics-based+biodetection.">Sample preparation: the weak link in microfluidics-based biodetection.</a> Biomed. Microdevices. 10, 777-784 (2008).</li><li>Bhushan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Springer handbook of nanotechnology. , (2010).</li><li>Ghallab, Y. H., Badawy, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).</li><li>Chee, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+genetic+information+with+high-density+DNA+arrays.">Accessing genetic information with high-density DNA arrays.</a> Science. 25, 610-614 (1996).</li><li>Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+hybridization+detection+by+label+free+versus+impedance+amplifying+label+with+impedance+spectroscopy.">DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy.</a> Sensor. Actuat. B-Chem. 114, 58-64 (2006).</li><li>Ito, T., Hosokawa, K., Maeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+single-base+mismatch+at+distal+end+of+DNA+duplex+by+electrochemical+impedance+spectroscopy.">Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy.</a> Biosens. Bioelectron. 22, 1816-1819 (2007).</li><li>Kao, L. T. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+detection+and+differentiation+of+the+DNA+strains+for+influenza+A+(H1N1+2009)+using+a+silicon-based+microfluidic+system.">Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system.</a> Biosens. Bioelectron. 26, 2006-2011 (2011).</li><li>Li, J., Chen, S., Evans, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Typing+and+subtyping+influenza+virus+using+DNA+microarrays+and+multiplex+reverse+transcriptase+PCR.">Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR.</a> J. Clin. Microbiol. 39, 696-704 (2001).</li><li>Gautier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybridization-induced+interfacial+changes+detected+by+non-faradaic+impedimetric+measurements+compared+to+faradaic+approach.">Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach.</a> J. Electroanal. Chem. 610, 227-233 (2007).</li><li>Ma, Y., Jiao, K., Yang, T., Sun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitive+PAT+gene+sequence+detection+by+nano-SiO2/p-aminothiophenol+self-assembled+films+DNA+electrochemical+biosensor+based+on+impedance+measurement.">Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement.</a> Sensor. Actuat. B-Chem. 131, 565-571 (2008).</li><li>Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+DNA+hybridization+kinetics+in+a+microfluidic+flow+channel.">Characterization of DNA hybridization kinetics in a microfluidic flow channel.</a> Sensor. Actuat. B-Chem. 113, 281-289 (2006).</li><li>Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+electrochemical+sensor+array+for+characterizing+protein+interactions+with+various+functionalized+surfaces.">Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces.</a> Anal. Chem. 83, 5920-5927 (2011).</li><li>Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic-based+electrochemical+biochip+for+label-free+diffusion-restricted+DNA+hybridization+analysis.">A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.</a> Biosens. Bioelectron. 38, 114-120 (2012).</li><li>Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-assembled+monolayers+for+biosensors.">Self-assembled monolayers for biosensors.</a> Analyst. 122, 43R-50R (1997).</li><li>McEwen, G. D., Chen, F., Zhou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization,+hybridization,+and+oxidation+of+synthetic+DNA+on+gold+surface:+Electron+transfer+investigated+by+electrochemistry+and+scanning+tunneling+microscopy.">Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy.</a> Anal. Chim. Acta. 643, 26-37 (2009).</li><li>Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+surface+charging+during+the+coadsorption+of+mercaptohexanol+to+DNA+layers+on+gold:+Direct+observation+of+desorption+and+layer+reorientation.">The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation.</a> Langmuir. 22, 5560-5562 (2006).</li><li>Katz, E., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+biomolecular+interactions+at+conductive+and+semiconductive+surfaces+by+impedance+spectroscopy:+Routes+to+impedimetric+immunosensors,+DNA-sensors,+and+enzyme+biosensors.">Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors.</a> Electroanalysis. 15, 913-947 (2003).</li></ol>

الكتاب ليس لديهم ما يكشف.

تثبت إجراءاتنا تصنيع وبيوشيب الكهروكيميائية القائم ميكروفلويديك واستخدامه لتحليل الأحداث تهجين الحمض النووي. من خلال عملية التصنيع الدقيق عالية الغلة تسيطر علينا تطوير جهاز تتألف من قنوات الميكروسكيل متكاملة مع مجموعة واسعة من محولات الطاقة الكهروكيميائية. لقد و...

المختبر على واحد في رقاقة ميكروفلويديك الأجهزة (LOC) توفر مزايا عديدة في التشخيص السريري، والرصد البيئي والبحوث الطبية الحيوية. هذه الأجهزة تستخدم قنوات ميكروفلويديك للسيطرة على تدفق السوائل لمناطق رقاقة حيث مجموعة متنوعة من الإجراءات يمكن أن تأخذ مكان بما في ذلك خلط الكاشف، استنادا تقارب ملزمة، نقل الإشارة، وزراعة الخلايا 1-4. ويوفر مزايا عديدة أكثر على microfluidics أدوات التشخيص السريرية التقليدية مثل القراء لوحة microwell أو الكهربي المقايسات تحول جل. تتطلب أجهزة ميكروفلويديك 2 إلى 3 أوامر من حجم (nanoliters بدلا من ميكرولتر) أقل الكواشف لإجراء فحوصات مماثلة. أيضا، يمكن لهذه الأجهزة أن تزيد من السرعة التي تحدث بعض الأحداث البيولوجية بسبب الحبس أصغر من الأنواع داخل القنوات 5،6. ثالثا، وأجهزة الاستشعار يمكن دمجها داخل الأجهزة ميكروفلويديك باستخدام تقنيات الطباعة الحجرية والحفر، والتي يمكن أن توفر خالية من التسمية detectioن. وأخيرا، وهذه الأجهزة غير مكلفة لإنتاج وتتطلب القليل من العمل من جانب فني للعمل 7-10. كشف خالية من التسمية عادة ما يتم تنفيذ باستخدام المفاتيح الضوئية أو الكهربائية. يمكن للأجهزة البصرية يقدم أداء أفضل الاستشعار بسبب التدخل أقل مع التحاليل في العينة. ومع ذلك، فإن خطر أدائهم في الحالات التي يكون فيها خلفية العينة لها نفس الطول الموجي للصدى وأجهزة الاستشعار 11. هناك العديد من المزايا لاستخدام الإشارات الكهربائية لإجراء الكشف البيولوجي والكيميائي في أنظمة ميكروفلويديك. تلفيق هي بطبيعتها أقل تعقيدا منذ هذه المجسات عادة لا تتطلب سوى أقطاب نمط التشغيل. بالإضافة إلى ذلك، إشارات كهربائية يمكن ربطه مباشرة مع معظم معدات القياس في حين طرائق إشارة أخرى قد تتطلب محول لتحويل إشارة 12-15. أجهزة الاستشعار الكهربائية عادة قياس التغيرات في impedancه 16،17، 18 السعة، أو الأكسدة النشاط 19. ومع ذلك، وتعرض كما هي المنمنمة هذه النظم تحديات جديدة. أهم التحديات للتغلب على ما يلي: إعداد العينات وخلط السوائل (بسبب حجم العينة منخفض وعدد رينولدز)، والتأثيرات الفيزيائية والكيميائية (بما في ذلك القوات الشعرية، خشونة السطح، والتفاعلات الكيميائية بين مواد البناء والتحاليل)، وانخفاض signal- نسبة إلى الضجيج (التي تنتجها المنطقة السطحية وخفض حجم) 20-23، والتدخل المحتمل من التحاليل الكهربائية نشط في العينات البيولوجية المعقدة (مثل الدم واللعاب). سوف مزيد من التحقيق في هذه الآثار تؤدي إلى المبادئ التوجيهية لتصنيع دقيق وتشغيل هذه الأجهزة بطريقة استنساخه التي من شأنها تحسين على أدائها العام. ويستخدم على نطاق واسع كشف تهجين الحمض النووي لتشخيص الاضطرابات الوراثية 24،25 ومختلف أشكال ملغاةإيه 26. كل عام، ويتم تحديد سلالات متعددة من الانفلونزا في المرضى الذين يستخدمون النتائج من تقنيات تهجين الحمض النووي 27. فيروس الانفلونزا وحده مسؤولا عن 36،000 حالة وفاة سنويا في الولايات المتحدة 28. هذه الأمثلة يمكن أن تستفيد من مقعد بين كبار جهاز ميكروفلويديك التي يمكن أن تؤدي تقنيات فحص نفس قارئ لوحة أو هلام تحول الفحص مع انخفاض حجم العينة وعلى جزء صغير من التكلفة دون التضحية حساسية أو خصوصية. بسبب العديد من المزايا من خالية من التسمية الاستشعار الكهروكيميائية، وقد استخدم على نطاق واسع للكشف عن الأحداث تهجين الحمض النووي 29،30. الإعداد حيث انخفضت أقطاب المستوى الكلي (في حدود المليمتر) في الأكواب مع الحل من الفائدة يمكن استخدامها لتوفير البيانات الحساسة للغاية فيما يتعلق حركية ملزمة واحدة من تسلسل الحمض النووي الذين تقطعت بهم السبل لمطابقة تسلسل التي تكمل بعضها بعضا. مؤخرا، كان هناك عدد قليل من التقدم في دمج الاستشعار الكهروكيميائية في ميكرofluidics لتهجين الحمض النووي. وقد أجريت دراسات فيما يتعلق حركية تهجين 31 ودمج أجهزة استشعار للكشف عن 15 في قنوات ميكروفلويديك. ومع ذلك، لا تزال هناك حاجة للحصول على إنتاجية عالية جهاز ميكروفلويديك السريع الذي يمكن تحليل الأحداث تهجين الحمض النووي بالتوازي دون خطوات إعداد العينات المعقدة. الجهاز الواردة في هذا العمل يوفر منصة تسمح للتفاعل متعددة ليتم فحص بالتوازي وبدون خطوات إعداد العينات المعقدة. يقدم بروتوكول لدينا كيف ميكروفلويديك القائم وmicrofabricated biochips الكهروكيميائية مع النظم الكهروميكانيكية الدقيقة (MEMS) التكنولوجيا 32،33. وصفنا عملية تصنيع كل من رقاقة ميكروفلويديك، مصنوعة من polydimethylsiloxane (PDMS)، ورقاقة الكهروكيميائية، تتألف من مجموعة من الأقطاب الكهربائية. وتناولت أيضا functionalization الكيميائية للبيوشيب مع تحقيقات ssDNA. وأخيرا، فإن أبيويتجلى إيتي لجهاز الاستشعار البيولوجي للكشف على وجه التحديد وتحليل الأهداف ssDNA. وعموما، فإن بيوشيب الكهروكيميائية القائم ميكروفلويديك هي تقنية سريعة وتحليل الإنتاجية العالية. ويمكن استخدامه للتحقيق في التفاعلات بين الجزيئات البيولوجية ومحولات إجراء، ويمكن استخدامها في مجموعة متنوعة من التطبيقات المختبر على واحد في رقاقة.

<table border="0" cellpadding="0" cellspacing="0" width="765">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:155px;">Company</td>
			<td style="width:227px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Material</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4&#39;&#39; Silicon wafer</td>
			<td style="width:155px;">Ultrasil</td>
			<td style="width:227px;">4-5664</td>
			<td>Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm*cm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Shipley 1813 photoresist (&#34;PR1&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">AZ5214 photoresist (&#34;PR2&#34;)</td>
			<td style="width:155px;">Hoechst Celanse</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SU-8 50 photoresist (&#34;PR3&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">negative photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gold etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">TFA</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chromium etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">1020AC</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS elastomer</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097366 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS curing agent</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097358 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Biopsy punching tool</td>
			<td style="width:155px;">Healthlink</td>
			<td style="width:227px;">BP20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible tubing</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">R 3603</td>
			<td>.015&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible adapter</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">06417-41</td>
			<td>.0625&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">1 mL syringe</td>
			<td style="width:155px;">Beckton-Dickenson</td>
			<td align="right" style="width:227px;">301025</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Monobasic potassium phosphate</td>
			<td style="width:155px;">Fluka</td>
			<td align="right" style="width:227px;">1551139</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium phosphate dibasic anhydrous</td>
			<td style="width:155px;">Sigma</td>
			<td style="width:227px;">RES20765-A7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium chloride</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:227px;">S7653</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">tris(2-carboxyethyl)phosphine</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">C4706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">6-mercapto-1-hexanol</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">451088</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">20x concentrated saline-sodium citrate buffer</td>
			<td style="width:155px;">Sigma</td>
			<td align="right" style="width:227px;">93017</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium hexacyanoferrate(III)</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">455946</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium ferrocyanide</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">CDS001589</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/AAAGCTCCGATAGCGCTCCG 
			TGGACGTCCC-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-GGGACGTCCACGGAGCGCTA 
			TCGGAGCTTT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA 
			ATCGATGAGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-ACTCATCGATTCGTCAATGA 
			CCTGACCCGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA 
			CCCATGATGA-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-TCATCATGGGTCTAACTACT 
			GGATCTAGGT-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Instrument</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Plasma Enhanced Chemical Vapor Deposition (PECVD)</td>
			<td style="width:155px;">Oxford Instruments</td>
			<td style="width:227px;">PlasmaLab System 100</td>
			<td>Chamber pressure 1000 mTorr, Tempreture 200 celsius degrees, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Angstrom/minute.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DC sputtering unit</td>
			<td style="width:155px;">AJA International</td>
			<td style="width:227px;">ATC 1800-V</td>
			<td>For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">E-beam evaporation system</td>
			<td style="width:155px;">Denton</td>
			<td style="width:227px;">Custom-built</td>
			<td>For Titanium: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 6-10 Angstrom/second. For Platinum: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 2-3 Angstrom/second.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Potentiostat</td>
			<td style="width:155px;">CH Instruments</td>
			<td style="width:227px;">660D</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Syringe pump</td>
			<td style="width:155px;">KD Scientific</td>
			<td style="width:227px;">KDS230</td>
			<td></td>
		</tr>
	</tbody>
</table>

a microfluidic-based electrochemical biochip for label-free dna hybridization analysis

التصغير من الإجراءات التحليلية في الفوق الصغيرة الحجم يوفر مزايا هامة في ما يخص وقت رد الفعل، والتكلفة، والتكامل من الخطوات السابقة للتجهيز. استخدام هذه الأجهزة نحو تحليل الأحداث تهجين الحمض النووي هو مهم لأنه يقدم تكنولوجيا لتقييم الوقت الحقيقي من المؤشرات الحيوية في نقطة من الرعاية لمختلف الأمراض. ومع ذلك، عندما يقلل من البصمة جهاز هيمنة مختلف الظواهر الفيزيائية الزيادات. هذه الظواهر تؤثر على دقة تصنيع وموثوقية تشغيل الجهاز. ولذلك، هناك حاجة كبيرة لافتعال بدقة وتعمل هذه الأجهزة بطريقة استنساخه من أجل تحسين الأداء العام. هنا، نحن تصف البروتوكولات والأساليب المستخدمة لتصنيع وتشغيل بيوشيب الكهروكيميائية استنادا ميكروفلويديك لتحليل دقيق للأحداث تهجين الحمض النووي. يتكون بيوشيب من جزأين: شريحة ميكروفلويديك معثلاث قنوات صغيرة موازية مصنوعة من (PDMS) polydimethylsiloxane، و 3 × 3 العريض الكهروكيميائية الدقيقة رقاقة. تم الكشف عن الأحداث تهجين الحمض النووي باستخدام مقاومة الكهروكيميائية الطيفي (EIS) التحليل. تحليل EIS يتيح مراقبة التغيرات في خصائص النظام الكهروكيميائية التي هي المهيمنة في هذه المقاييس طول. مع القدرة على رصد التغيرات في كل من تهمة نقل والمقاومة الأنتشارى مع جهاز الاستشعار البيولوجي، ونحن لشرح الانتقائية لأهداف ssDNA التكميلية، حد كشف حساب من 3.8 نانومتر، و 13٪ عبر التفاعل مع غيرها من ssDNA غير التكميلية التالية 20 دقيقة من الحضانة. هذه المنهجية يمكن تحسين أداء الأجهزة المنمنمة التي كتبها توضيح على سلوك نشر في النظام الصغيرة الحجم وذلك من خلال تمكين دراسة الأحداث تهجين الحمض النووي.

عملية التصنيع السيطرة عليها ودقيقة للجهاز التجريبي ضروري في مجال البحوث. فإنه يسمح للباحثين بالحصول على التجارب التي مرت استنساخه والعالية. هنا نكون قد أظهرت عالية الغلة، وعملية التصنيع الدقيق استنساخ عالية من بيوشيب الكهروكيميائية استنادا ميكروفلويديك (الشك?...

Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

نقدم بيوشيب القائم ميكروفلويديك الكهروكيميائية للكشف عن تهجين الحمض النووي. التالية ssDNA التحقيق functionalization، يتم دراسة خصوصية وحساسية، والحد من الكشف مع أهداف ssDNA تكميلية وغير تكميلية. وتوضح النتائج أن تأثير الأحداث تهجين الحمض النووي على النظام الكهروكيميائية، مع حد الكشف عن 3.8 نانومتر.

وبيوشيب الكهروكيميائية استنادا ميكروفلويديك لتسمية خالية تحليل الحمض النووي التهجين

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

a-microfluidic-based-electrochemical-biochip-for-label-free-dna

Research

JoVE Journal

Bioengineering

17.0K Views.  University of Maryland.  نقدم بيوشيب القائم ميكروفلويديك الكهروكيميائية للكشف عن تهجين الحمض النووي. التالية ssDNA التحقيق functionalization، يتم دراسة خصوصية وحساسية، والحد من الكشف مع أهداف ssDNA تكميلية وغير تكميلية. وتوضح النتائج أن تأثير الأحداث تهجين الحمض النووي على ا...

Video: A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

A Microfluidic-based Hydrodynamic Trap for Single Particles

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science. Methods for particle trapping based on optical, magnetic, electrokinetic, and acoustic techniques have led to major advancements in physics and biology ranging from the molecular to cellular level. In this article, we introduce a new microfluidic-based technique for particle trapping and manipulation based solely on hydrodynamic fluid flow. Using this method, we demonstrate trapping of micro- and nano-scale particles in aqueous solutions for long time scales. The hydrodynamic trap consists of an integrated microfluidic device with a cross-slot channel geometry where two opposing laminar streams converge, thereby generating a planar extensional flow with a fluid stagnation point (zero-velocity point). In this device, particles are confined at the trap center by active control of the flow field to maintain particle position at the fluid stagnation point. In this manner, particles are effectively trapped in free solution using a feedback control algorithm implemented with a custom-built LabVIEW code. The control algorithm consists of image acquisition for a particle in the microfluidic device, followed by particle tracking, determination of particle centroid position, and active adjustment of fluid flow by regulating the pressure applied to an on-chip pneumatic valve using a pressure regulator. In this way, the on-chip dynamic metering valve functions to regulate the relative flow rates in the outlet channels, thereby enabling fine-scale control of stagnation point position and particle trapping. The microfluidic-based hydrodynamic trap exhibits several advantages as a method for particle trapping. Hydrodynamic trapping is possible for any arbitrary particle without specific requirements on the physical or chemical properties of the trapped object. In addition, hydrodynamic trapping enables confinement of a "single" target object in concentrated or crowded particle suspensions, which is difficult using alternative force field-based trapping methods. The hydrodynamic trap is user-friendly, straightforward to implement and may be added to existing microfluidic devices to facilitate trapping and long-time analysis of particles. Overall, the hydrodynamic trap is a new platform for confinement, micromanipulation, and observation of particles without surface immobilization and eliminates the need for potentially perturbative optical, magnetic, and electric fields in the free-solution trapping of small particles.

In this article, we present a microfluidic-based method for particle confinement based on hydrodynamic flow. We demonstrate stable particle trapping at a fluid stagnation point using a feedback control mechanism, thereby enabling confinement and micromanipulation of arbitrary particles in an integrated microdevice.

A فخ هيدرودينامي ميكروفلويديك المستندة للجسيمات واحدة

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

تصنيع أجهزة الاستشعار الكهروكيميائية الدنا للكشف Reagentless من الأحماض النووية والبروتينات والجزيئات الصغيرة

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Non-contact, Label-free Monitoring of Cells and Extracellular Matrix using Raman Spectroscopy

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, currently available routine methods require processing steps and alter sample integrity. Raman spectroscopy is a fast method that enables the measurement of biological samples without the need for further processing steps. This laser-based technology detects the inelastic scattering of monochromatic light.6 As every chemical vibration is assigned to a specific Raman band (wavenumber in cm-1), each biological sample features a typical spectral pattern due to their inherent biochemical composition.7-9 Within Raman spectra, the peak intensities correlate with the amount of the present molecular bonds.1 Similarities and differences of the spectral data sets can be detected by employing a multivariate analysis (e.g. principal component analysis (PCA)).10
Here, we perform Raman spectroscopy of living cells and native tissues. Cells are either seeded on glass bottom dishes or kept in suspension under normal cell culture conditions (37 &deg;C, 5% CO2) before measurement. Native tissues are dissected and stored in phosphate buffered saline (PBS) at 4 &deg;C prior measurements. Depending on our experimental set up, we then either focused on the cell nucleus or extracellular matrix (ECM) proteins such as elastin and collagen. For all studies, a minimum of 30 cells or 30 random points of interest within the ECM are measured. Data processing steps included background subtraction and normalization.

Raman spectroscopy is a suitable technique for the non-contact, label-free analysis of living cells, tissue-engineered constructs and native tissues. Source-specific spectral fingerprints can be generated and analyzed using multivariate analysis.

عدم الاتصال، تسمية خالية من رصد خلايا المصفوفة خارج الخلية، وباستخدام التحليل الطيفي رامان

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, ...

Hollow Microneedle-based Sensor for Multiplexed Transdermal Electrochemical Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals suffering from chronic medical conditions facile assessment of their immediate physiological state. Furthermore, it could serve as a research tool for analysis of complex, multifactorial medical conditions. In order for such a multianalyte sensor to be realized, it must be minimally invasive, sampling of interstitial fluid must occur without pain or harm to the user, and analysis must be rapid as well as selective.
Initially developed for pain-free drug delivery, microneedles have been used to deliver vaccines and pharmacologic agents (e.g., insulin) through the skin.1-2 Since these devices access the interstitial space, microneedles that are integrated with microelectrodes can be used as transdermal electrochemical sensors. Selective detection of glucose, glutamate, lactate, hydrogen peroxide, and ascorbic acid has been demonstrated using integrated microneedle-electrode devices with carbon fibers, modified carbon pastes, and platinum-coated polymer microneedles serving as transducing elements.3-7,8
This microneedle sensor technology has enabled a novel and sophisticated analytical approach for in situ and simultaneous detection of multiple analytes. Multiplexing offers the possibility of monitoring complex microenvironments, which are otherwise difficult to characterize in a rapid and minimally invasive manner. For example, this technology could be utilized for simultaneous monitoring of extracellular levels of, glucose, lactate and pH,9 which are important metabolic indicators of disease states7,10-14 (e.g., cancer proliferation) and exercise-induced acidosis.15

This article details the construction of a multiplexed microneedle-based sensor. The device is being developed for in situ sampling and electrochemical analysis of multiple analytes in a rapid and selective manner. We envision clinical medicine and biomedical research uses for these microneedle-based sensors.

أجوف Microneedle المستندة إلى الاستشعار عن تعدد في الإرسال الاستشعار الكهروكيميائية عبر الجلد

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

كشف البكتيرية والاستدلال باستخدام مجسات الكهروكيميائية

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Multi-analyte Biochip (MAB) Based on All-solid-state Ion-selective Electrodes (ASSISE) for Physiological Research

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) that can withstand prolonged storage in complex biological media 1-4. An all-solid-state ion-selective-electrode (ASSISE) is especially attractive for the aforementioned applications. The electrode should have the following favorable characteristics: easy construction, low maintenance, and (potential for) miniaturization, allowing for batch processing. A microfabricated ASSISE intended for quantifying H+, Ca2+, and CO32- ions was constructed. It consists of a noble-metal electrode layer (i.e. Pt), a transduction layer, and an ion-selective membrane (ISM) layer. The transduction layer functions to transduce the concentration-dependent chemical potential of the ion-selective membrane into a measurable electrical signal.
The lifetime of an ASSISE is found to depend on maintaining the potential at the conductive layer/membrane interface 5-7. To extend the ASSISE working lifetime and thereby maintain stable potentials at the interfacial layers, we utilized the conductive polymer (CP) poly(3,4-ethylenedioxythiophene) (PEDOT) 7-9 in place of silver/silver chloride (Ag/AgCl) as the transducer layer. We constructed the ASSISE in a lab-on-a-chip format, which we called the multi-analyte biochip (MAB) (Figure 1).
Calibrations in test solutions demonstrated that the MAB can monitor pH (operational range pH 4-9), CO32- (measured range 0.01 mM - 1 mM), and Ca2+ (log-linear range 0.01 mM to 1 mM). The MAB for pH provides a near-Nernstian slope response after almost one month storage in algal medium. The carbonate biochips show a potentiometric profile similar to that of a conventional ion-selective electrode. Physiological measurements were employed to monitor biological activity of the model system, the microalga Chlorella vulgaris.
The MAB conveys an advantage in size, versatility, and multiplexed analyte sensing capability, making it applicable to many confined monitoring situations, on Earth or in space.
Biochip Design and Experimental Methods
The biochip is 10 x 11 mm in dimension and has 9 ASSISEs designated as working electrodes (WEs) and 5 Ag/AgCl reference electrodes (REs). Each working electrode (WE) is 240 &mu;m in diameter and is equally spaced at 1.4 mm from the REs, which are 480 &mu;m in diameter. These electrodes are connected to electrical contact pads with a dimension of 0.5 mm x 0.5 mm. The schematic is shown in Figure 2.
Cyclic voltammetry (CV) and galvanostatic deposition methods are used to electropolymerize the PEDOT films using a Bioanalytical Systems Inc. (BASI) C3 cell stand (Figure 3). The counter-ion for the PEDOT film is tailored to suit the analyte ion of interest. A PEDOT with poly(styrenesulfonate) counter ion (PEDOT/PSS) is utilized for H+ and CO32-, while one with sulphate (added to the solution as CaSO4) is utilized for Ca2+. The electrochemical properties of the PEDOT-coated WE is analyzed using CVs in redox-active solution (i.e. 2 mM potassium ferricyanide (K3Fe(CN)6)). Based on the CV profile, Randles-Sevcik analysis was used to determine the effective surface area 10. Spin-coating at 1,500 rpm is used to cast ~2 &mu;m thick ion-selective membranes (ISMs) on the MAB working electrodes (WEs).
The MAB is contained in a microfluidic flow-cell chamber filled with a 150 &mu;l volume of algal medium; the contact pads are electrically connected to the BASI system (Figure 4). The photosynthetic activity of Chlorella vulgaris is monitored in ambient light and dark conditions.

Multi-analyte Biochip MAB Based on All-solid-state Ion-selective Electrodes ASSISE for Physiological Research

All-solid-state ion-selective electrodes (ASSISEs) constructed from a conductive polymer (CP) transducer provide several months of functional lifetime in liquid media. Here, we describe the fabrication and calibration process of ASSISEs in a lab-on-a-chip format. The ASSISE is demonstrated to have maintained a near-Nernstian slope profile after prolonged storage in complex biological media.

بيوشيب متعددة الحليلة (MAB) بناء على أقطاب ايون انتقائية الصلبة بالكامل للدولة (ASSISE) للبحوث الفسيولوجي

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) ...

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans' Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and pathways as well as its ease of cultivation. Several C. elegans disease models have been reported, including neurodegenerative disorders such as Parkinson's disease (PD), which involves the degeneration of dopaminergic (DA) neurons 1. Both transgenes and neurotoxic chemicals have been used to induce DA neurodegeneration and consequent movement defects in worms, allowing for investigations into the basis of neurodegeneration and screens for neuroprotective genes and compounds 2,3.
Screens in lower eukaryotes like C. elegans provide an efficient and economical means to identify compounds and genes affecting neuronal signaling. Conventional screens are typically performed manually and scored by visual inspection; consequently, they are time-consuming and prone to human errors. Additionally, most focus on cellular level analysis while ignoring locomotion, which is an especially important parameter for movement disorders.
We have developed a novel microfluidic screening system (Figure 1) that controls and quantifies C. elegans' locomotion using electric field stimuli inside microchannels. We have shown that a Direct Current (DC) field can robustly induce on-demand locomotion towards the cathode ("electrotaxis") 4. Reversing the field's polarity causes the worm to quickly reverse its direction as well. We have also shown that defects in dopaminergic and other sensory neurons alter the swimming response 5. Therefore, abnormalities in neuronal signaling can be determined using locomotion as a read-out. The movement response can be accurately quantified using a range of parameters such as swimming speed, body bending frequency and reversal time.
Our work has revealed that the electrotactic response varies with age. Specifically, young adults respond to a lower range of electric fields and move faster compared to larvae 4. These findings led us to design a new microfluidic device to passively sort worms by age and phenotype 6.
We have also tested the response of worms to pulsed DC and Alternating Current (AC) electric fields. Pulsed DC fields of various duty cycles effectively generated electrotaxis in both C. elegans and its cousin C. briggsae 7. In another experiment, symmetrical AC fields with frequencies ranging from 1 Hz to 3 KHz immobilized worms inside the channel 8.
Implementation of the electric field in a microfluidic environment enables rapid and automated execution of the electrotaxis assay. This approach promises to facilitate high-throughput genetic and chemical screens for factors affecting neuronal function and viability.

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans&#039; Locomotion

A semi-automated micro-electro-fluidic method to induce on-demand locomotion in Caenorhabditis elegans is described. This method is based on the neurophysiologic phenomenon of worms responding to mild electric fields (&#x201C;electrotaxis&#x201D;) inside microfluidic channels. Microfluidic electrotaxis serves as a rapid, sensitive, low-cost, and scalable technique to screen for factors affecting neuronal health.

انجذاب كهربي المستندة ميكروفلويديك للتحليل الكمي بناء على الطلب<em&gt; انواع معينة ايليجانس</em&gt; &#39;تنقل

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and ...

Use of Label-free Optical Biosensors to Detect Modulation of Potassium Channels by G-protein Coupled Receptors

Ion channels control the electrical properties of neurons and other excitable cell types by selectively allowing ions to flow through the plasma membrane1. To regulate neuronal excitability, the biophysical properties of ion channels are modified by signaling proteins and molecules, which often bind to the channels themselves to form a heteromeric channel complex2,3. Traditional assays examining the interaction between channels and regulatory proteins require exogenous labels that can potentially alter the protein&#39;s behavior and decrease the physiological relevance of the target, while providing little information on the time course of interactions in living cells. Optical biosensors, such as the X-BODY Biosciences BIND Scanner system, use a novel label-free technology, resonance wavelength grating (RWG) optical biosensors, to detect changes in resonant reflected light near the biosensor. This assay allows the detection of the relative change in mass within the bottom portion of living cells adherent to the biosensor surface resulting from ligand induced changes in cell adhesion and spreading, toxicity, proliferation, and changes in protein-protein interactions near the plasma membrane. RWG optical biosensors have been used to detect changes in mass near the plasma membrane of cells following activation of G protein-coupled receptors (GPCRs), receptor tyrosine kinases, and other cell surface receptors. Ligand-induced changes in ion channel-protein interactions can also be studied using this assay. In this paper, we will describe the experimental procedure used to detect the modulation of Slack-B sodium-activated potassium (KNa) channels by GPCRs.

Optical biosensor techniques can detect changes in mass near the plasma membrane in living cells and allow one to follow cellular responses in both individual cells and populations of cells. This protocol will describe detection of the modulation of potassium channels by G-protein coupled receptors in intact cells using this approach.

استخدام تسمية خالية أجهزة الاستشعار البصرية لكشف التحوير من قنوات البوتاسيوم التي كتبها G-بروتين المستقبلات اقترن

Ion channels control the electrical properties of neurons and other excitable cell types by selectively allowing ions to flow through the plasma ...

A Label-free Technique for the Spatio-temporal Imaging of Single Cell Secretions

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning of such signaling can lead to many disorders. To understand cell-to-cell signaling, it is essential to study the spatial and temporal nature of the secreted molecules from the cell without disturbing the local environment. Various assays have been developed to study protein secretion, however, these methods are typically based on fluorescent probes which disrupt the relevant signaling pathways. To overcome this limitation, a label-free technique is required.
In this paper, we describe the fabrication and application of a label-free localized surface plasmon resonance imaging (LSPRi) technology capable of detecting protein secretions from a single cell. The plasmonic nanostructures are lithographically patterned onto a standard glass coverslip and can be excited using visible light on commercially available light microscopes. Only a small fraction of the coverslip is covered by the nanostructures and hence this technique is well suited for combining common techniques such as fluorescence and bright-field imaging.
A multidisciplinary approach is used in this protocol which incorporates sensor nanofabrication and subsequent biofunctionalization, binding kinetics characterization of ligand and analyte, the integration of the chip and live cells, and the analysis of the measured signal. As a whole, this technology enables a general label-free approach towards mapping cellular secretions and correlating them with the responses of nearby cells.

Inter-cellular communication is critical for controlling various physiological activities within and outside the cell. This paper describes a protocol for measuring the spatio-temporal nature of single cell secretions. To achieve this, a multidisciplinary approach is used which integrates label-free nanoplasmonic sensing with live cell imaging.

تقنية تسمية خالية لتصوير المكانية والزمانية لإفرازات خلية واحدة

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning ...

Label-free Single Molecule Detection Using Microtoroid Optical Resonators

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental studies on the behavior of molecules. Single molecule detection techniques commonly utilize labels such as fluorescent tags or quantum dots, however, labels are not always available, increase cost and complexity, and can perturb the events being studied. Optical resonators have emerged as a promising means to detect single molecules without the use of labels. Currently the smallest particle detected by a non-plasmonically-enhanced bare optical resonator system in solution is a 25 nm polystyrene sphere1. We have developed a technique known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that can surpass this limit and achieve label-free single molecule detection in aqueous solution2. As signal strength scales with particle volume, our work represents a &#62; 100x improvement in the signal to noise ratio (SNR) over the current state of the art. Here the procedures behind FLOWER are presented in an effort to increase its usage in the field.

We have developed a label-free biosensing system based on optical resonator technology known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that is capable of detecting single molecules in solution. Here the procedures behind this work are described and presented.

تسمية خالية واحدة كشف الجزيئة عن طريق Microtoroid البصرية الرنين

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental ...