The authors acknowledge the Robert W. Deutsch Foundation, the Defense Threat Reduction Agency (DTRA), and the National Science Foundation Emerging Frontiers in Research and Innovation (EFRI) for financial support. The authors also thank the Maryland Nanocenter and its Fablab for cleanroom facility support.

1. Microfabrication of the Microfluidic Chip
<ol>
	<li>Prepare Electrochemical Chip
	<ol>
		<li>Pattern Gold Electrodes
		<ol>
			<li>Rinse a blank 4&#8217;&#8217; silicon wafer (prime grade quality) with acetone, methanol, and isopropanol (&#8220;AMI&#8221; clean). Rinse the isopropanol from the wafer with deionized water (DI) followed by drying with N2 gun.</li>
			<li>Grow a 1 &#181;m thick SiO2 passivation layer with plasma-enhanced chemical vapor deposition (PECVD) tool. Deposit a 200 &#197; ...

<ol>
	<li>Hong, J., Edel, J. B., deMello, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micro-+and+nanofluidic+systems+for+high-throughput+biological+screening.">Micro- and nanofluidic systems for high-throughput biological screening.</a> Drug Discov. Today. 14, 134-146 (2009).</li><li>Sun, Y., Kwok, Y. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymeric+microfluidic+system+for+DNA+analysis.">Polymeric microfluidic system for DNA analysis.</a> Anal. Chim. Acta. 556, 80-96 (2006).</li><li>Xu, Y., Yang, X., Wang, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review:+aptamers+in+microfluidic+chips.">Review: aptamers in microfluidic chips.</a> Anal. Chim. Acta. 683, 12-20 (2010).</li><li>Yang, W., Woolley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+multiprocess+microfluidic+systems+for+automating+analysis.">Integrated multiprocess microfluidic systems for automating analysis.</a> J. Lab. Automat. 15, 198-209 (2010).</li><li>Gervais, T., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mass+transport+and+surface+reactions+in+micro&#64258;uidic+systems.">Mass transport and surface reactions in micro&#64258;uidic systems.</a> Chem. Eng. Sci. 61, 1102-1121 (2006).</li><li>Song, H., Ismagilov, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond+kinetics+on+a+microfluidic+chip+using+nanoliters+of+reagents.">Millisecond kinetics on a microfluidic chip using nanoliters of reagents.</a> J. Am. Chem. Soc. 125, 14613-14619 (2003).</li><li>Jiang, H., Weng, X. A., Li, D. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+whole-blood+immunoassays.">Microfluidic whole-blood immunoassays.</a> Microfluid. Nanofluid. 10, 941-964 (2011).</li><li>Dutse, S. W., Yusof, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+lab-on-chip+systems+in+DNA-based+biosensing:+an+overview.">Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview.</a> Sensors. 11, 5754-5768 (2011).</li><li>Dittrich, P. S., Manz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lab-on-a-chip:+microfluidics+in+drug+discovery.">Lab-on-a-chip: microfluidics in drug discovery.</a> Nat. Rev. Drug Discov. 5, 210-218 (2006).</li><li>Craighead, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Future+lab-on-a-chip+technologies+for+interrogating+individual+molecules.">Future lab-on-a-chip technologies for interrogating individual molecules.</a> Nature. 442, 387-393 (2006).</li><li>Hunt, H. K., Armani, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+biological+and+chemical+sensors.">Label-free biological and chemical sensors.</a> Nanoscale. 2, 1544-1559 (2010).</li><li>Dukkipati, V. R., Pang, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+microfluidic+system+for+DNA+analysis.">Integrated microfluidic system for DNA analysis.</a> IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).</li><li>Fang, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+microfluidic+devices+with+concurrent+electrochemical+detection.">Real-time PCR microfluidic devices with concurrent electrochemical detection.</a> Biosens. Bioelectron. 24, 2131-2136 (2009).</li><li>Pavlovic, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+device+architecture+for+electrochemical+patterning+and+detection+of+multiple+DNA+sequences.">Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences.</a> Langmuir. 24, 1102-1107 (2008).</li><li>Xu, X., Zhang, S., Chen, H., Kong, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+electrochemistry+in+micro-total+analysis+systems+for+biochemical+assays:+recent+developments.">Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.</a> Talanta. 80, 8-18 (2009).</li><li>Cai, H., Lee, T. M. -. H., Hsing, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+protein+recognition+using+an+aptamer-based+impedance+measurement+assay.">Label-free protein recognition using an aptamer-based impedance measurement assay.</a> Sensor. Actuat. B-Chem. 114, 433-437 (2006).</li><li>Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic+device+for+impedance+spectroscopy+analysis+of+biological+samples.">A Microfluidic device for impedance spectroscopy analysis of biological samples.</a> Sensor. Actuat. B-Chem. 123, 168-176 (2007).</li><li>Prakash, S. B., Abshire, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+cancer+cell+proliferation+on+a+CMOS+capacitance+sensor+chip.">Tracking cancer cell proliferation on a CMOS capacitance sensor chip.</a> Biosens. Bioelectron. 23, 1449-1457 (2008).</li><li>Yamaguchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+fabrication+of+electrochemical+enzyme+sensor+chip+using+polydimethylsiloxane+microfluidic+channel.">Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel.</a> Anal. Chim. Acta. 468, 143-152 (2002).</li><li>Beebe, D. J., Mensing, G. A., Walker, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physics+and+applications+of+microfluidics+in+biology.">Physics and applications of microfluidics in biology.</a> Annu. Rev. Biomed. Eng. 4, 261-286 (2002).</li><li>Mariella, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preparation:+the+weak+link+in+microfluidics-based+biodetection.">Sample preparation: the weak link in microfluidics-based biodetection.</a> Biomed. Microdevices. 10, 777-784 (2008).</li><li>Bhushan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Springer handbook of nanotechnology. , (2010).</li><li>Ghallab, Y. H., Badawy, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).</li><li>Chee, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+genetic+information+with+high-density+DNA+arrays.">Accessing genetic information with high-density DNA arrays.</a> Science. 25, 610-614 (1996).</li><li>Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+hybridization+detection+by+label+free+versus+impedance+amplifying+label+with+impedance+spectroscopy.">DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy.</a> Sensor. Actuat. B-Chem. 114, 58-64 (2006).</li><li>Ito, T., Hosokawa, K., Maeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+single-base+mismatch+at+distal+end+of+DNA+duplex+by+electrochemical+impedance+spectroscopy.">Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy.</a> Biosens. Bioelectron. 22, 1816-1819 (2007).</li><li>Kao, L. T. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+detection+and+differentiation+of+the+DNA+strains+for+influenza+A+(H1N1+2009)+using+a+silicon-based+microfluidic+system.">Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system.</a> Biosens. Bioelectron. 26, 2006-2011 (2011).</li><li>Li, J., Chen, S., Evans, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Typing+and+subtyping+influenza+virus+using+DNA+microarrays+and+multiplex+reverse+transcriptase+PCR.">Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR.</a> J. Clin. Microbiol. 39, 696-704 (2001).</li><li>Gautier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybridization-induced+interfacial+changes+detected+by+non-faradaic+impedimetric+measurements+compared+to+faradaic+approach.">Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach.</a> J. Electroanal. Chem. 610, 227-233 (2007).</li><li>Ma, Y., Jiao, K., Yang, T., Sun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitive+PAT+gene+sequence+detection+by+nano-SiO2/p-aminothiophenol+self-assembled+films+DNA+electrochemical+biosensor+based+on+impedance+measurement.">Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement.</a> Sensor. Actuat. B-Chem. 131, 565-571 (2008).</li><li>Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+DNA+hybridization+kinetics+in+a+microfluidic+flow+channel.">Characterization of DNA hybridization kinetics in a microfluidic flow channel.</a> Sensor. Actuat. B-Chem. 113, 281-289 (2006).</li><li>Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+electrochemical+sensor+array+for+characterizing+protein+interactions+with+various+functionalized+surfaces.">Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces.</a> Anal. Chem. 83, 5920-5927 (2011).</li><li>Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic-based+electrochemical+biochip+for+label-free+diffusion-restricted+DNA+hybridization+analysis.">A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.</a> Biosens. Bioelectron. 38, 114-120 (2012).</li><li>Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-assembled+monolayers+for+biosensors.">Self-assembled monolayers for biosensors.</a> Analyst. 122, 43R-50R (1997).</li><li>McEwen, G. D., Chen, F., Zhou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization,+hybridization,+and+oxidation+of+synthetic+DNA+on+gold+surface:+Electron+transfer+investigated+by+electrochemistry+and+scanning+tunneling+microscopy.">Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy.</a> Anal. Chim. Acta. 643, 26-37 (2009).</li><li>Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+surface+charging+during+the+coadsorption+of+mercaptohexanol+to+DNA+layers+on+gold:+Direct+observation+of+desorption+and+layer+reorientation.">The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation.</a> Langmuir. 22, 5560-5562 (2006).</li><li>Katz, E., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+biomolecular+interactions+at+conductive+and+semiconductive+surfaces+by+impedance+spectroscopy:+Routes+to+impedimetric+immunosensors,+DNA-sensors,+and+enzyme+biosensors.">Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors.</a> Electroanalysis. 15, 913-947 (2003).</li></ol>

Our procedures demonstrate the manufacturing of a microfluidic-based electrochemical biochip and its utilization for DNA hybridization events analysis. Through a high yield controlled microfabrication process we develop a device comprised of microscale channels integrated with an array of electrochemical transducers. We have devised controlled processing parameters for the photolithography procedure of the electrochemical chip and the microfluidic channel mold through an iterative approach. These steps provide guidelines...

Microfluidic lab-on-a-chip (LOC) devices provide numerous advantages in clinical diagnostics, environmental monitoring and biomedical research. These devices utilize microfluidic channels to control fluid flow to regions of the chip where a variety of procedures can take place including reagent mixing, affinity based binding, signal transduction, and cell culturing1-4. Microfluidics provides many advantages over conventional clinical diagnostic tools such as microwell plate readers or electrophoretic gel shift assays. Microfluidic devices require 2 to 3 orders of magnitude (nanoliters as opposed to microliters) fewer reagents to perform similar assays. Also, these devices can increase the speed by which some biological events occur due to the smaller confinement of the species within the channels5,6. Thirdly, sensors can be integrated within microfluidic devices using lithography and etching techniques, which can provide label-free detection. Lastly, these devices are inexpensive to produce and require little work on the part of the technician to operate7-10.
Label-free detection typically is performed using an optical or electrical transducer. Optical devices can present better sensing performance due to lower interference with analytes in the sample. Nevertheless, their performance is compromised in cases where the sample&#8217;s background has the same resonating wavelength as the sensor11. There are many advantages to using electrical signals to perform biological and chemical detection in microfluidic systems. The fabrication is inherently less complicated since these sensors typically only require patterned electrodes to operate. In addition, electrical signals can be directly interfaced with most measurement equipment while other signal modalities may require a transducer to convert the signal12-15. Electrical sensors commonly measure changes in impedance16,17, capacitance18, or redox activity19. However, new challenges are presented as these systems are miniaturized. The most important challenges to overcome include: sample preparation and mixing of fluids (due to the low sample volume and Reynolds number), physical and chemical effects (including capillary forces, surface roughness, chemical interactions between construction materials and analytes), low signal-to-noise ratio (produced by the reduced surface area and volume)20-23, and potential interference from electro-active analytes in complex biological samples (e.g., blood and saliva). Further investigation of these effects will result in guidelines for an accurate fabrication and operation of these devices in a reproducible manner that would improve upon their overall performance.
DNA hybridization detection is used extensively to diagnose genetic disorders24,25 and various forms of cancer26. Every year, multiple strains of influenza are identified in patients using results from DNA hybridization techniques27. The influenza virus alone accounts for 36,000 deaths each year in the United States28. Such examples could benefit from a bench-top microfluidic device that can perform the same assay techniques as a plate reader or gel shift assay with low sample volume and at a fraction of the cost without sacrificing sensitivity or specificity. Due to the many advantages of label-free electrochemical sensing, it has been used extensively for detection of DNA hybridization events29,30. A setup where macro-scale electrodes (in the millimeter range) are dipped in beakers with the solution of interest can be used to provide very sensitive data regarding the binding kinetics of single stranded DNA sequences to their matching complementary sequences. Recently, there have been a few advances in incorporating electrochemical sensing in microfluidics for DNA hybridization. Studies have been performed regarding hybridization kinetics31 and integration of sensors for detection15 in microfluidic channels. However, there still exists a need for a rapid high throughput microfluidic device that can analyze DNA hybridization events in parallel without complicated sample preparation steps.
The device presented in this work provides a platform that allows for multiple interactions to be screened in parallel and without complicated sample preparation steps. Our protocol presents how microfluidic-based electrochemical biochips are microfabricated with micro-electromechanical systems (MEMS) technology32,33. We describe the fabrication process of both the microfluidic chip, made of polydimethylsiloxane (PDMS), and the electrochemical chip, comprised of an array of electrodes. The chemical functionalization of the biochip with ssDNA probes is also addressed. Finally, the ability of the biosensor to specifically detect and analyze ssDNA targets is demonstrated. Overall, the microfluidic-based electrochemical biochip is a rapid and high-throughput analysis technique. It can be used to investigate interactions between biological molecules and conducting transducers, and can be utilized in a variety of lab-on-a-chip applications.

<table border="0" cellpadding="0" cellspacing="0" width="765">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:155px;">Company</td>
			<td style="width:227px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Material</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4&#39;&#39; Silicon wafer</td>
			<td style="width:155px;">Ultrasil</td>
			<td style="width:227px;">4-5664</td>
			<td>Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm*cm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Shipley 1813 photoresist (&#34;PR1&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">AZ5214 photoresist (&#34;PR2&#34;)</td>
			<td style="width:155px;">Hoechst Celanse</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SU-8 50 photoresist (&#34;PR3&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">negative photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gold etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">TFA</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chromium etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">1020AC</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS elastomer</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097366 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS curing agent</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097358 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Biopsy punching tool</td>
			<td style="width:155px;">Healthlink</td>
			<td style="width:227px;">BP20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible tubing</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">R 3603</td>
			<td>.015&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible adapter</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">06417-41</td>
			<td>.0625&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">1 mL syringe</td>
			<td style="width:155px;">Beckton-Dickenson</td>
			<td align="right" style="width:227px;">301025</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Monobasic potassium phosphate</td>
			<td style="width:155px;">Fluka</td>
			<td align="right" style="width:227px;">1551139</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium phosphate dibasic anhydrous</td>
			<td style="width:155px;">Sigma</td>
			<td style="width:227px;">RES20765-A7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium chloride</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:227px;">S7653</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">tris(2-carboxyethyl)phosphine</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">C4706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">6-mercapto-1-hexanol</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">451088</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">20x concentrated saline-sodium citrate buffer</td>
			<td style="width:155px;">Sigma</td>
			<td align="right" style="width:227px;">93017</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium hexacyanoferrate(III)</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">455946</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium ferrocyanide</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">CDS001589</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/AAAGCTCCGATAGCGCTCCG 
			TGGACGTCCC-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-GGGACGTCCACGGAGCGCTA 
			TCGGAGCTTT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA 
			ATCGATGAGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-ACTCATCGATTCGTCAATGA 
			CCTGACCCGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA 
			CCCATGATGA-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-TCATCATGGGTCTAACTACT 
			GGATCTAGGT-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Instrument</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Plasma Enhanced Chemical Vapor Deposition (PECVD)</td>
			<td style="width:155px;">Oxford Instruments</td>
			<td style="width:227px;">PlasmaLab System 100</td>
			<td>Chamber pressure 1000 mTorr, Tempreture 200 celsius degrees, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Angstrom/minute.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DC sputtering unit</td>
			<td style="width:155px;">AJA International</td>
			<td style="width:227px;">ATC 1800-V</td>
			<td>For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">E-beam evaporation system</td>
			<td style="width:155px;">Denton</td>
			<td style="width:227px;">Custom-built</td>
			<td>For Titanium: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 6-10 Angstrom/second. For Platinum: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 2-3 Angstrom/second.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Potentiostat</td>
			<td style="width:155px;">CH Instruments</td>
			<td style="width:227px;">660D</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Syringe pump</td>
			<td style="width:155px;">KD Scientific</td>
			<td style="width:227px;">KDS230</td>
			<td></td>
		</tr>
	</tbody>
</table>

a microfluidic-based electrochemical biochip for label-free dna hybridization analysis

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration of pre-processing steps. Utilizing these devices towards the analysis of DNA hybridization events is important because it offers a technology for real time assessment of biomarkers at the point-of-care for various diseases. However, when the device footprint decreases the dominance of various physical phenomena increases. These phenomena influence the fabrication precision and operation reliability of the device. Therefore, there is a great need to accurately fabricate and operate these devices in a reproducible manner in order to improve the overall performance. Here, we describe the protocols and the methods used for the fabrication and the operation of a microfluidic-based electrochemical biochip for accurate analysis of DNA hybridization events. The biochip is composed of two parts: a microfluidic chip with three parallel micro-channels made of polydimethylsiloxane (PDMS), and a 3 x 3 arrayed electrochemical micro-chip. The DNA hybridization events are detected using electrochemical impedance spectroscopy (EIS) analysis. The EIS analysis enables monitoring variations of the properties of the electrochemical system that are dominant at these length scales. With the ability to monitor changes of both charge transfer and diffusional resistance with the biosensor, we demonstrate the selectivity to complementary ssDNA targets, a calculated detection limit of 3.8 nM, and a 13% cross-reactivity with other non-complementary ssDNA following 20 min&#160;of incubation. This methodology can improve the performance of miniaturized devices by elucidating on the behavior of diffusion at the micro-scale regime and by enabling the study of DNA hybridization events.

A controllable and accurate manufacturing process for the experimental device is essential in research. It allows researchers to obtain reproducible and high throughput experiments. Here we have demonstrated a high yield, high reproducibility microfabrication process of a microfluidic-based electrochemical biochip (Figure 1). With a low failure rate, few devices have shown bonding issues that lead to solution leakage. In order to validate the electrochemical activity of the biochip, cyclic voltammetry me...

Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

We present a microfluidic-based electrochemical biochip for DNA hybridization detection. Following ssDNA probe functionalization, the specificity, sensitivity, and detection limit are studied with complementary and non-complementary ssDNA targets. Results illustrate the influence of the DNA hybridization events on the electrochemical system, with a detection limit of 3.8 nM.

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

a-microfluidic-based-electrochemical-biochip-for-label-free-dna

Research

JoVE Journal

Bioengineering

17.0K visualizações.  University of Maryland.  Nós apresentamos um biochip electroquímica à base de microfluidos para a detecção de hibridação de ADN. Após a funcionalização ADNcs sonda, a especificidade, a sensibilidade, e o limite de detecção são estudadas com alvos de ADNcs complementares e não complementares. Os resultados ilustram a influência dos eventos de hibridação de ADN no sistema electroquimico, com um limite de detecção de 3,8 nM. 