Yazarlar mali destek için Robert W. Deutsch Vakfı, Savunma Tehdit Azaltma Ajansı (DTRA), ve Araştırma Ulusal Bilim Vakfı Yükselen Frontiers ve Yenilik (EFRI) kabul. Yazarlar ayrıca temiz oda tesisi destek için Maryland Nanocenter ve FabLab teşekkür ederiz.

Mikroakışkan Chip 1. Mikro ve <ol><li> Elektrokimyasal Chip hazırlayın <ol><li> Desen Altın Elektrotlar <ol><li> Aseton, metanol ve izopropanol (&quot;AMI&quot; temiz) ile boş bir 4 &#39;silikon gofret (birinci sınıf kalite) durulayın. N2 tabancası ile kurutma ile, iyonu giderilmiş (Di) su ile gofret izopropanol durulayın. </li><li> Plazma destekli kimyasal buhar biriktirme (PECVD) aracı ile 1 mikron kalınlığında SiO 2 pasivasyon tabakası büyür. Bir DC püskürtme aracı ile altın 2.000 Å kalın bir tabaka tarafından takip krom 200 Å kalın bir tabaka yatırın. </li><li> Spin &quot;PR1&quot; olumlu fotorezist (iplik parametreleri: 3,000 rpm, 1000 rpm / sn, 30 sn) 1.6 mikron kalınlığında üniform bir film ~ oluşturun. Ön fırında sıcak bir plaka üzerinde 100 ° C&#39;de 1 dakika için gofret. </li><li> 190 mj / Bir photomask ile 405 nm dalga boyunda cm 2 ile gofret Açığa. 352 dev 30 saniye boyunca gofretin geliştirilmesiaşığı ile kaçan kimse N 2 tabanca ile DI ile gofret ve kuru yıkayıp durulayın. </li><li> 1.5 dakika boyunca altın yanığı ile altın etch. ~ 30 saniye boyunca krom yanığı ile krom etch. DI ile gofret durulayın ve N 2 tabanca ile kuru. </li><li> &quot;AMI&quot; temiz prosedürü ile photoresist&#39;i soyun. NOT: Güçlü oksitleyici ve PATLAMAYA. </li><li> 1 H 2 SO 4: 4 ile gofret temizleyin H 2 O 2 karışımı (&quot;Piranha&quot; temiz) 1 dakika boyunca. DI ile gofret durulayın ve N 2 tabanca ile kuru. </li></ol></li><li> Desen Platin elektrotlar <ol><li> Spin &quot;PR2&quot; olumlu fotorezist (iplik parametreleri: 3,000 rpm, 1000 rpm / sn, 30 sn) 1.4 mikron kalınlığında üniform bir film ~ oluşturun. Ön fırında sıcak bir plaka üzerinde 100 ° C&#39;de 1 dakika için gofret. </li><li> 30 mj / Bir photomask ile 405 nm dalga boyunda cm 2 ile gofret Açığa. Sıcak bir plaka üzerinde 125 ° C&#39;de 45 saniye boyunca gofret pişirilir. Sel maruz1000 mJ / bir fotomaske olmadan 405 nm dalga boyunda cm 2 olan gofret. 6 2 dakika gofret geliştirin: 1 AZ400K geliştirici ve DI ile gofret durulayın ve N 2 tabanca ile kuru. </li><li> E-demeti buharlaştırma sistemi kullanılarak platin 1.600 Å kalın bir tabaka tarafından takip titanyum 400 Å kalın bir tabaka yatırın. </li><li> Aseton ve izopropanol ile çalkalama, ardından 5 dakika boyunca ultraviyole aseton banyosu içinde fotorezist kaldırın. DI ile gofret durulayın ve N 2 tabanca ile kuru. </li></ol></li></ol></li><li> Deneyi Kanallar hazırlayın <ol><li> Deneyi Kanalları için Kalıp Hazırlama <ol><li> &quot;AMI&quot; temiz prosedürü ile boş bir 4 &#39;silikon gofret (test kalitesinde) durulayın. DI ile gofret izopropanol yıkayın N2 tabancası ile kurutuldu. </li><li> Spin &quot;PR3&quot; negatif Fotorezist (2 adımlı iplik parametreleri:. Adım bir - 600 rpm, 120 rpm / saniye, 10 saniye, iki Adım - 1.150 rpm, 383 devir / sn,27 sn) tekdüze bir film ~ 100 mikron kalınlığında oluşturun. Ön fırında sıcak plaka (2 adımlı pişirme parametrelerine gofretin:. Birinci aşamada - 300 ° C / saatte 65 ° C oda sıcaklığı ile rampa ve 10 dakika boyunca sıcaklığı tutmak Adım 2 - 95 ° C &#39;ye kadar rampa 300 ° C / s ve 30 dakika boyunca beklemeye sıcaklığı). </li><li> 2.500 mJ / Bir photomask ile 405 nm dalga boyunda cm 2 ile gofret Açığa. Post-Bake 300 ° C / saatte 95 ° C &#39;ye kadar ve rampa ile gofretin sıcak bir plaka üzerinde 10 dakika boyunca sıcaklık tutun. Propilen glikol monometil eter asetat (PGMEA) geliştirici içinde 10 dakika için gofret geliştirin. N 2 tabanca ile izopropanol ve kuru ile gofret durulayın. </li></ol></li><li> Deneyi Kanallar Üretiyor <ol><li> 20 dakika boyunca bir vakum odasına 1 polidimetilsiloksan (PDMS) karışımı (20 g, elastomer, sertleştirici 2 g) ve tamamen Degas: 10 hazırlayın. </li><li> Alüminyum folyo ile kalıp gofret etrafında bir kapalı tanımlayın ve yavaş yavaş sertleşmemiş PDMS dökünkalıp üzerine. </li><li> Bir kutu fırın içinde PDMS ile kalıbın fırında (2 adımlı pişirme parametreleri:. Bir adım - 5 dakika 80 ° oda sıcaklığı kadar rampa C Adım 2 - 17 dakika boyunca 80 ° C&#39;de tutun). </li><li> Alüminyum folyo üzerine kalıp ve yerden Peel uzak PDMS. Bir biyopsi delme aracı ile delik tanımlamak, bir cerrah bıçakla tahlil cips kesin. </li></ol></li></ol></li></ol> 2. Cihazı monte <ol><li> Manuel elektrokimyasal çip üzerinde çalışan elektrotlar ile PDMS tahlil kanalları hizalayın. PDMS kanalları sızdırmazlık ve sızıntının önlenmesi, elektrokimyasal çip iyi yapışır. </li><li> Bir plastik dirsek veya düz konnektör adaptör (OD 0,1875 &#39;ve Kimlik 0.0625&#39;) gibi kısa bir esnek tüp kullanılarak esnek bir boru (OD 0.087 &#39;ve Kimlik 0.015&#39;) bağlayın. Cihazdaki delik açılmış girişlerinin her bağlayıcıları takın. </li><li> Diğer ucunda bir enjektörütüp ve bir şırınga pompası şırınga. Alternatif olarak, bölüm 3&#39;te gerekli işlem adımı ve buna karşılık gelen bir çözüme göre, bir şırınga kümesi, bir tüp, ve bir bağlayıcı değiştirin. </li></ol> 3. DNA Hibridizasyon Analiz Not: tüm kanal dolana kadar 200 ul / saatlik bir akış oranında kanala az her solüsyonun verilmesini. <ol><li> Farklı bir ssDNA prob dizisinin her dikey mikrokanalı işlevselleştirmek (3 ayrı dikey mikrokanallardaki paralel gerçekleştirmek): <ol><li> Her biri farklı bir ssDNA Probu inkübasyon çözeltisi ile mikrokanal doldurun (10 mM fosfat tamponu, 100 mM NaCI, 10 uM tris (2-karboksietil) fosfin (TCEP) ve 1 uM prob ssDNA) ve mikrokanal durulanması ile 1 saat boyunca inkübe PBS ile. </li><li> 10 mM PBS, 100 mM NaCI ve 1.395 mM TCEP içeren bir tampon içinde 6-merkapto-1-heksanol (MCH) 1 mM ihtiva eden çözelti ve incu ile doldurun mikrokanal1 saat boyunca PBS ile asitleme mikrokanal çalkalayın. </li></ol></li><li> , PDMS kaldırıp yatay yönde 90 ° döndürmek ve benzersiz bir sayacı ve referans elektrot (Şekil S1) içeren her satır ile reaksiyon odaları ayrı satırları göstermek için aşağı yerleştirin. </li><li> 4x kontrol ölçümü çözeltisi ile mikrokanallar tuz sodyum sitrat (SSC), tampon konsantre edildi doldurulmakta ve 20 dakika boyunca inkübe edin. </li><li> Arka plan ölçümü: (çalışma, sayaç bağlı bir potansiyostatı ile ve referans elektrotlar 5 mM PBS çözüm / 5 mM ferrosiyanür ferricyanide ile mikrokanallara doldurun ve (ÇBS elektrokimyasal empedans spektroskopi), farklı frekanslar için elektrokimyasal sistemin empedans değerleri kayıt ÇBS parametreler: 1 MHz 0.1 Hz, on yılda 10 frekans veri noktaları, 25 mV genlik, referans elektrot karşı 5 mV polarizasyon) frekans aralığı. Mikrokanallardaki her çalışma elektrot için bu ölçümü tekrarlayın. </li&gt; <li> (Her tamamlayıcı olmayan ve ssDNA hedef için gerçekleştirmek) DNA hibridizasyonu ölçün. <ol><li> 4x hedef ssDNA ölçüm çözeltisi ile mikro doldurun hedef ssDNA&#39;nın 1 uM SSC tamponu ihtiva eden, konsantre edildi ve 20 dakika inkübe edilir. 3.4 aşamasına göre olan DNA ölçün. </li></ol></li></ol>

<ol>
	<li>Hong, J., Edel, J. B., deMello, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micro-+and+nanofluidic+systems+for+high-throughput+biological+screening.">Micro- and nanofluidic systems for high-throughput biological screening.</a> Drug Discov. Today. 14, 134-146 (2009).</li><li>Sun, Y., Kwok, Y. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymeric+microfluidic+system+for+DNA+analysis.">Polymeric microfluidic system for DNA analysis.</a> Anal. Chim. Acta. 556, 80-96 (2006).</li><li>Xu, Y., Yang, X., Wang, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review:+aptamers+in+microfluidic+chips.">Review: aptamers in microfluidic chips.</a> Anal. Chim. Acta. 683, 12-20 (2010).</li><li>Yang, W., Woolley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+multiprocess+microfluidic+systems+for+automating+analysis.">Integrated multiprocess microfluidic systems for automating analysis.</a> J. Lab. Automat. 15, 198-209 (2010).</li><li>Gervais, T., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mass+transport+and+surface+reactions+in+micro&#64258;uidic+systems.">Mass transport and surface reactions in micro&#64258;uidic systems.</a> Chem. Eng. Sci. 61, 1102-1121 (2006).</li><li>Song, H., Ismagilov, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond+kinetics+on+a+microfluidic+chip+using+nanoliters+of+reagents.">Millisecond kinetics on a microfluidic chip using nanoliters of reagents.</a> J. Am. Chem. Soc. 125, 14613-14619 (2003).</li><li>Jiang, H., Weng, X. A., Li, D. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+whole-blood+immunoassays.">Microfluidic whole-blood immunoassays.</a> Microfluid. Nanofluid. 10, 941-964 (2011).</li><li>Dutse, S. W., Yusof, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+lab-on-chip+systems+in+DNA-based+biosensing:+an+overview.">Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview.</a> Sensors. 11, 5754-5768 (2011).</li><li>Dittrich, P. S., Manz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lab-on-a-chip:+microfluidics+in+drug+discovery.">Lab-on-a-chip: microfluidics in drug discovery.</a> Nat. Rev. Drug Discov. 5, 210-218 (2006).</li><li>Craighead, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Future+lab-on-a-chip+technologies+for+interrogating+individual+molecules.">Future lab-on-a-chip technologies for interrogating individual molecules.</a> Nature. 442, 387-393 (2006).</li><li>Hunt, H. K., Armani, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+biological+and+chemical+sensors.">Label-free biological and chemical sensors.</a> Nanoscale. 2, 1544-1559 (2010).</li><li>Dukkipati, V. R., Pang, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+microfluidic+system+for+DNA+analysis.">Integrated microfluidic system for DNA analysis.</a> IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).</li><li>Fang, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+microfluidic+devices+with+concurrent+electrochemical+detection.">Real-time PCR microfluidic devices with concurrent electrochemical detection.</a> Biosens. Bioelectron. 24, 2131-2136 (2009).</li><li>Pavlovic, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+device+architecture+for+electrochemical+patterning+and+detection+of+multiple+DNA+sequences.">Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences.</a> Langmuir. 24, 1102-1107 (2008).</li><li>Xu, X., Zhang, S., Chen, H., Kong, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+electrochemistry+in+micro-total+analysis+systems+for+biochemical+assays:+recent+developments.">Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.</a> Talanta. 80, 8-18 (2009).</li><li>Cai, H., Lee, T. M. -. H., Hsing, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+protein+recognition+using+an+aptamer-based+impedance+measurement+assay.">Label-free protein recognition using an aptamer-based impedance measurement assay.</a> Sensor. Actuat. B-Chem. 114, 433-437 (2006).</li><li>Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic+device+for+impedance+spectroscopy+analysis+of+biological+samples.">A Microfluidic device for impedance spectroscopy analysis of biological samples.</a> Sensor. Actuat. B-Chem. 123, 168-176 (2007).</li><li>Prakash, S. B., Abshire, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+cancer+cell+proliferation+on+a+CMOS+capacitance+sensor+chip.">Tracking cancer cell proliferation on a CMOS capacitance sensor chip.</a> Biosens. Bioelectron. 23, 1449-1457 (2008).</li><li>Yamaguchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+fabrication+of+electrochemical+enzyme+sensor+chip+using+polydimethylsiloxane+microfluidic+channel.">Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel.</a> Anal. Chim. Acta. 468, 143-152 (2002).</li><li>Beebe, D. J., Mensing, G. A., Walker, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physics+and+applications+of+microfluidics+in+biology.">Physics and applications of microfluidics in biology.</a> Annu. Rev. Biomed. Eng. 4, 261-286 (2002).</li><li>Mariella, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preparation:+the+weak+link+in+microfluidics-based+biodetection.">Sample preparation: the weak link in microfluidics-based biodetection.</a> Biomed. Microdevices. 10, 777-784 (2008).</li><li>Bhushan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Springer handbook of nanotechnology. , (2010).</li><li>Ghallab, Y. H., Badawy, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).</li><li>Chee, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+genetic+information+with+high-density+DNA+arrays.">Accessing genetic information with high-density DNA arrays.</a> Science. 25, 610-614 (1996).</li><li>Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+hybridization+detection+by+label+free+versus+impedance+amplifying+label+with+impedance+spectroscopy.">DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy.</a> Sensor. Actuat. B-Chem. 114, 58-64 (2006).</li><li>Ito, T., Hosokawa, K., Maeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+single-base+mismatch+at+distal+end+of+DNA+duplex+by+electrochemical+impedance+spectroscopy.">Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy.</a> Biosens. Bioelectron. 22, 1816-1819 (2007).</li><li>Kao, L. T. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+detection+and+differentiation+of+the+DNA+strains+for+influenza+A+(H1N1+2009)+using+a+silicon-based+microfluidic+system.">Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system.</a> Biosens. Bioelectron. 26, 2006-2011 (2011).</li><li>Li, J., Chen, S., Evans, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Typing+and+subtyping+influenza+virus+using+DNA+microarrays+and+multiplex+reverse+transcriptase+PCR.">Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR.</a> J. Clin. Microbiol. 39, 696-704 (2001).</li><li>Gautier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybridization-induced+interfacial+changes+detected+by+non-faradaic+impedimetric+measurements+compared+to+faradaic+approach.">Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach.</a> J. Electroanal. Chem. 610, 227-233 (2007).</li><li>Ma, Y., Jiao, K., Yang, T., Sun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitive+PAT+gene+sequence+detection+by+nano-SiO2/p-aminothiophenol+self-assembled+films+DNA+electrochemical+biosensor+based+on+impedance+measurement.">Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement.</a> Sensor. Actuat. B-Chem. 131, 565-571 (2008).</li><li>Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+DNA+hybridization+kinetics+in+a+microfluidic+flow+channel.">Characterization of DNA hybridization kinetics in a microfluidic flow channel.</a> Sensor. Actuat. B-Chem. 113, 281-289 (2006).</li><li>Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+electrochemical+sensor+array+for+characterizing+protein+interactions+with+various+functionalized+surfaces.">Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces.</a> Anal. Chem. 83, 5920-5927 (2011).</li><li>Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic-based+electrochemical+biochip+for+label-free+diffusion-restricted+DNA+hybridization+analysis.">A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.</a> Biosens. Bioelectron. 38, 114-120 (2012).</li><li>Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-assembled+monolayers+for+biosensors.">Self-assembled monolayers for biosensors.</a> Analyst. 122, 43R-50R (1997).</li><li>McEwen, G. D., Chen, F., Zhou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization,+hybridization,+and+oxidation+of+synthetic+DNA+on+gold+surface:+Electron+transfer+investigated+by+electrochemistry+and+scanning+tunneling+microscopy.">Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy.</a> Anal. Chim. Acta. 643, 26-37 (2009).</li><li>Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+surface+charging+during+the+coadsorption+of+mercaptohexanol+to+DNA+layers+on+gold:+Direct+observation+of+desorption+and+layer+reorientation.">The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation.</a> Langmuir. 22, 5560-5562 (2006).</li><li>Katz, E., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+biomolecular+interactions+at+conductive+and+semiconductive+surfaces+by+impedance+spectroscopy:+Routes+to+impedimetric+immunosensors,+DNA-sensors,+and+enzyme+biosensors.">Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors.</a> Electroanalysis. 15, 913-947 (2003).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Bizim prosedürleri microfluidic tabanlı elektrokimyasal biochipe üretim ve DNA hibridizasyon olaylar analizi için kullanımı göstermektedir. Yüksek verim kontrollü mikroimalat süreçle elektrokimyasal dönüştürücüler bir dizi ile entegre mikro kanallar oluşan bir cihaz geliştirmek. Biz yinelemeli bir yaklaşımla elektrokimyasal çip ve mikroakışkan kanal kalıp fotolitografya prosedürü için kontrollü işlem parametrelerini tasarladılar. Bu adımlar diğer minyatür analitik cihazların gelecektek...

Mikroakışkan lab-on-a-chip (KO) cihazları, klinik teşhis, çevresel izleme ve biyomedikal araştırmalarda sayısız avantajlar sağlamaktadır. Bu cihazlar, çok çeşitli prosedürler 1-4 kültürlenmesini reaktif karıştırma, bağlanma afinitesi göre, sinyal iletimi, ve hücre de dahil olmak üzere yer alabilir çipin bölgelerine sıvı akışını kontrol etmek için mikro-akışkan kanal kullanmaktadır. Mikroakiskan gibi mikro plaka okuyucuları veya elektroforetik jel kayma deneyleri gibi geleneksel klinik tanı araçları üzerinde birçok avantaj sağlar. Benzer deneyler gerçekleştirmek için daha az reaktifleri (mikrolitre karşıt olarak nanolitre) mikroakışkan cihazları büyüklüğünün 2-3 siparişler gerektirir. Ayrıca, bu cihazlar, bazı biyolojik olayları kanalların içindeki 5,6 türlerin daha küçük sınırlanmasından dolayı meydana hangi hızını artırabilir. Üçüncü olarak, sensörler etiketsiz detectio sağlayabilir litografi ve aşındırma teknikleri kullanılarak mikroakışkan cihazlar içinde de entegre edilebilirn. Son olarak, bu cihazlar üretmek ve 7-10 faaliyet teknisyen kısmında küçük çalışma gerektirir ucuzdur. Etiket içermeyen algılama tipik olarak bir optik veya elektriksel transdüktör kullanılarak gerçekleştirilir. Optik aygıtları nedeniyle numunede analitlerle ile daha az müdahaleye daha iyi algılama performansı sunabilir. Bununla birlikte, bunların performansı numunesinin arka sensörü 11 ile aynı çınlayan dalga boyuna sahip olan durumlarda taviz verilmektedir. Akışkan sistemleri biyolojik ve kimyasal algılama gerçekleştirmek için elektrik sinyallerini kullanarak pek çok avantajı vardır. Bu sensörler genellikle sadece çalıştırmak için desenli elektrot gerektiren bu yana imalat doğası gereği daha az karmaşıktır. Diğer sinyal yöntemleri sinyali 12-15 dönüştürmek için bir transdüser gerekebilir ise ek olarak, elektrik sinyalleri doğrudan en ölçüm ekipmanları ile arabirim olabilir. Elektrik sensörleri yaygın impedanc değişiklikleri ölçmekE 16,17, kapasite 18 veya redoks aktivitesi 19. Bu sistemler minyatürize Ancak, yeni sorunlar sunulmaktadır. Üstesinden gelmek için en önemli zorluklar şunlardır: numune hazırlığı ve (nedeniyle düşük örnek hacmi ve Reynolds sayısına kadar) sıvı karıştırma, fiziksel ve kimyasal etkilere (kılcal kuvvetler dahil olmak üzere, yüzey pürüzlülüğü, inşaat malzemeleri ve Analitlerin arasındaki kimyasal etkileşimler), düşük sinyalizasyon karmaşık biyolojik örneklerin (örneğin, kan ve tükürük) elektro-aktif analitlerden 20-23, ve potansiyel girişim (azaltılmış yüzey alanı ve hacim tarafından üretilen) gürültü oranı. Bu etkilerin İleri araştırmalar genel performansını geliştirmek olan bir yeniden üretilebilir bir şekilde, bu cihazların doğru imalatı ve kullanımı için bir kılavuz ile sonuçlanacaktır. DNA hibridizasyon tayini, genetik bozukluklar 24,25 ve Canc çeşitli biçimlerini teşhis etmek için yaygın olarak kullanılırer 26. Her yıl, grip suşları birden çok DNA hibridizasyon teknikleri 27 sonuçları kullanan hastalarda belirlenmiştir. Grip virüsü yalnız Amerika Birleşik Devletleri&#39;nde 28 36.000 ölümlerin her yıl için hesapları. Bu gibi örnekler, duyarlılık veya spesifikliği ödün vermeden düşük bir örnek hacmi, bir plaka okuyucu ya da jel kayma deneyi olarak ve düşük bir maliyetle aynı deney teknikleri gerçekleştiren bir tezgah üstü mikro sıvısal tertibat yarar olabilir. Nedeniyle etiketsiz elektrokimyasal algılama pek çok avantajı nedeniyle, DNA hibridizasyonu olaylarının 29,30 saptanması için yaygın olarak kullanılmaktadır. (Milimetre aralığında) makro ölçekli elektrotlar ilgi çözeltisi beherler daldırılır bir kurulum doğrultusunda kendi tamamlayıcı dizileri tek şeritli DNA dizilerinin bağlanma kinetiği açısından çok hassas veri temin etmek üzere kullanılabilir. Son zamanlarda, MICR elektrokimyasal algılama içeren birkaç gelişmeler olmuşturDNA hibridizasyonu için ofluidics. Çalışmalar hibridizasyon kinetiği 31 ve mikroakışkan kanallarda tespiti için 15 sensörlerin entegrasyonu konusunda yapılmıştır. Bununla birlikte, hala karmaşık numune hazırlama adımları olmadan paralel DNA hibridizasyon olayları analiz edebilen hızlı bir yüksek verimli mikroakışkan cihaz için bir ihtiyaç vardır. Bu çalışmada sunulan cihaz, çoklu etkileşimler paralel ve karmaşık numune hazırlama adımları olmadan ekranlı olması için izin veren bir platform sağlar. Bizim protokol elektrokimyasal biochip mikro-elektromekanik sistemler (MEMS) teknolojisi 32,33 ile mikrofabrike nasıl mikroakışkan tabanlı sunar. Bu elektrotlar, bir tertibinden oluşur (PDMS) polidimetilsiloksan mikroakışkan çip, çip ve hem de elektrokimyasal üretim süreci tarif eder. SsDNA probları ile biochipe kimyasal fonksiyonlandırılması da ele alınmaktadır. Son olarak, AbilÖzellikle ssDNA hedefleri tespit ve analiz etmek için biyosensör Sığ gösterilmiştir. Genel olarak, mikroakışkan-bazlı elektro kimyasal biyoçip hızlı ve yüksek hacimli bir analiz tekniğidir. Biyolojik moleküller ve iletken dönüştürücüler arasındaki etkileşimi araştırmak için kullanılabilir, ve lab-on-a-chip çeşitli uygulamalar içinde kullanılabilir.

<table border="0" cellpadding="0" cellspacing="0" width="765">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:155px;">Company</td>
			<td style="width:227px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Material</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4&#39;&#39; Silicon wafer</td>
			<td style="width:155px;">Ultrasil</td>
			<td style="width:227px;">4-5664</td>
			<td>Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm*cm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Shipley 1813 photoresist (&#34;PR1&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">AZ5214 photoresist (&#34;PR2&#34;)</td>
			<td style="width:155px;">Hoechst Celanse</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SU-8 50 photoresist (&#34;PR3&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">negative photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gold etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">TFA</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chromium etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">1020AC</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS elastomer</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097366 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS curing agent</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097358 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Biopsy punching tool</td>
			<td style="width:155px;">Healthlink</td>
			<td style="width:227px;">BP20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible tubing</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">R 3603</td>
			<td>.015&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible adapter</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">06417-41</td>
			<td>.0625&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">1 mL syringe</td>
			<td style="width:155px;">Beckton-Dickenson</td>
			<td align="right" style="width:227px;">301025</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Monobasic potassium phosphate</td>
			<td style="width:155px;">Fluka</td>
			<td align="right" style="width:227px;">1551139</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium phosphate dibasic anhydrous</td>
			<td style="width:155px;">Sigma</td>
			<td style="width:227px;">RES20765-A7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium chloride</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:227px;">S7653</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">tris(2-carboxyethyl)phosphine</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">C4706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">6-mercapto-1-hexanol</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">451088</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">20x concentrated saline-sodium citrate buffer</td>
			<td style="width:155px;">Sigma</td>
			<td align="right" style="width:227px;">93017</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium hexacyanoferrate(III)</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">455946</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium ferrocyanide</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">CDS001589</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/AAAGCTCCGATAGCGCTCCG 
			TGGACGTCCC-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-GGGACGTCCACGGAGCGCTA 
			TCGGAGCTTT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA 
			ATCGATGAGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-ACTCATCGATTCGTCAATGA 
			CCTGACCCGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA 
			CCCATGATGA-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-TCATCATGGGTCTAACTACT 
			GGATCTAGGT-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Instrument</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Plasma Enhanced Chemical Vapor Deposition (PECVD)</td>
			<td style="width:155px;">Oxford Instruments</td>
			<td style="width:227px;">PlasmaLab System 100</td>
			<td>Chamber pressure 1000 mTorr, Tempreture 200 celsius degrees, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Angstrom/minute.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DC sputtering unit</td>
			<td style="width:155px;">AJA International</td>
			<td style="width:227px;">ATC 1800-V</td>
			<td>For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">E-beam evaporation system</td>
			<td style="width:155px;">Denton</td>
			<td style="width:227px;">Custom-built</td>
			<td>For Titanium: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 6-10 Angstrom/second. For Platinum: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 2-3 Angstrom/second.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Potentiostat</td>
			<td style="width:155px;">CH Instruments</td>
			<td style="width:227px;">660D</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Syringe pump</td>
			<td style="width:155px;">KD Scientific</td>
			<td style="width:227px;">KDS230</td>
			<td></td>
		</tr>
	</tbody>
</table>

a microfluidic-based electrochemical biochip for label-free dna hybridization analysis

Mikro ölçekli analitik olarak masa üstü prosedürler minyatür reaksiyon süresi, maliyet, ve ön-işlem basamağından entegrasyonu ile ilgili olarak önemli avantajlar sağlamaktadır. Bu noktadan-bakım çeşitli hastalıklar için en biyobelirteçlerinin gerçek zamanlı değerlendirilmesi için bir teknoloji sunuyor, çünkü DNA hibridizasyon olayların analizi doğru bu cihazları kullanan önemlidir. Bununla birlikte, söz konusu olduğunda cihaz izi çeşitli fiziksel olaylar artar hakimiyetini azaltır. Bu olgular fabrikasyon hassasiyet ve cihazın çalışma güvenilirliğini etkilemektedir. Bu nedenle, doğru bir genel performansını artırmak amacıyla tekrarlanabilir bir şekilde bu cihazların imal ve işletmek için büyük bir ihtiyaç vardır. Burada, protokoller ve imalat ve bunların DNA hibridizasyon etkinliği doğru analizi için bir mikro-akışkan-bazlı elektro kimyasal Biochip işlemi için kullanılan yöntemleri tarif eder. Biochipin iki bölümden oluşur: microfluidic çip ileÜç polydimetilsiloksan (PDMS) yapılan paralel mikro kanallar, ve 3 x 3 dizilmiş elektrokimyasal mikro-çip. DNA hibridizasyonu olaylarının elektrokimyasal empedans Spektroskopisi (EIS) analizi ile tespit edilir. ÇBS analizi, bu uzunluk ölçeklerinde baskın elektrokimyasal sistemin özelliklerinin izlenmesi varyasyonları sağlayan. Biosensörlü hem yük transferi ve difüzyon direnç değişiklikleri izlemek için yeteneği ile, 20 dakika aşağıdaki ssDNA hedeflerine seçiciliğini, 3.8 nM hesaplanmış saptama sınırı ve diğer tamamlayıcı olmayan ssDNA&#39;ya ile% 13 çapraz reaktivite göstermiştir kuluçkadan. Bu metodoloji mikro ölçekli rejimi difüzyon davranışı üzerinde aydınlatılmasına ve DNA hibridizasyon olayların çalışmayı sağlayarak minyatür cihazların performansını artırabilirsiniz.

Deney cihazı için bir kontrol ve hassas imalat işleminin araştırma için gereklidir. Bu araştırmacılar tekrarlanabilir ve yüksek verimlilik deneyleri elde etmesini sağlar. Burada bir mikroakışkan-bazlı elektro kimyasal Biochip (Şekil 1), yüksek verim, yüksek bir tekrarlanabilirliği mikroüretim işlemi göstermiştir. Bir düşük başarısızlık oranı ile, birkaç cihazlar çözüm sızıntıya neden bağlanma sorunları göstermiştir. Biochipe elektrokimyasal aktivitesini doğrulam...

Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Biz DNA hibridizasyon tespiti için mikroakışkan tabanlı elektrokimyasal Bioçip sunuyoruz. SsDNA probu fonksiyonlandırmalar ardından, özgüllük, duyarlılık ve algılama limiti tamamlayıcı ve non-ssDNA hedefleri ile incelenmiştir. Sonuçlar 3.8 nM&#39;lik bir algılama sınırı ile, elektro-kimyasal sistemine DNA hibridizasyonu olaylarının etkisini göstermektedir.

Etiket-serbest DNA Hibridizasyon Analiz için mikroakışkan tabanlı Elektrokimyasal Biochip

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

a-microfluidic-based-electrochemical-biochip-for-label-free-dna

Research

JoVE Journal

Bioengineering

17.0K Görüntüleme.  University of Maryland.  Biz DNA hibridizasyon tespiti için mikroakışkan tabanlı elektrokimyasal Bioçip sunuyoruz. SsDNA probu fonksiyonlandırmalar ardından, özgüllük, duyarlılık ve algılama limiti tamamlayıcı ve non-ssDNA hedefleri ile incelenmiştir. Sonuçlar 3.8 nM'lik bir algılama sınırı ile, elektro-kimyasal sistemine DNA hibridizasyonu olaylarının etkisini göstermektedir. 

Video: A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

A Microfluidic-based Hydrodynamic Trap for Single Particles

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science. Methods for particle trapping based on optical, magnetic, electrokinetic, and acoustic techniques have led to major advancements in physics and biology ranging from the molecular to cellular level. In this article, we introduce a new microfluidic-based technique for particle trapping and manipulation based solely on hydrodynamic fluid flow. Using this method, we demonstrate trapping of micro- and nano-scale particles in aqueous solutions for long time scales. The hydrodynamic trap consists of an integrated microfluidic device with a cross-slot channel geometry where two opposing laminar streams converge, thereby generating a planar extensional flow with a fluid stagnation point (zero-velocity point). In this device, particles are confined at the trap center by active control of the flow field to maintain particle position at the fluid stagnation point. In this manner, particles are effectively trapped in free solution using a feedback control algorithm implemented with a custom-built LabVIEW code. The control algorithm consists of image acquisition for a particle in the microfluidic device, followed by particle tracking, determination of particle centroid position, and active adjustment of fluid flow by regulating the pressure applied to an on-chip pneumatic valve using a pressure regulator. In this way, the on-chip dynamic metering valve functions to regulate the relative flow rates in the outlet channels, thereby enabling fine-scale control of stagnation point position and particle trapping. The microfluidic-based hydrodynamic trap exhibits several advantages as a method for particle trapping. Hydrodynamic trapping is possible for any arbitrary particle without specific requirements on the physical or chemical properties of the trapped object. In addition, hydrodynamic trapping enables confinement of a "single" target object in concentrated or crowded particle suspensions, which is difficult using alternative force field-based trapping methods. The hydrodynamic trap is user-friendly, straightforward to implement and may be added to existing microfluidic devices to facilitate trapping and long-time analysis of particles. Overall, the hydrodynamic trap is a new platform for confinement, micromanipulation, and observation of particles without surface immobilization and eliminates the need for potentially perturbative optical, magnetic, and electric fields in the free-solution trapping of small particles.

In this article, we present a microfluidic-based method for particle confinement based on hydrodynamic flow. We demonstrate stable particle trapping at a fluid stagnation point using a feedback control mechanism, thereby enabling confinement and micromanipulation of arbitrary particles in an integrated microdevice.

Tek Parçacıklar için mikroakışkan tabanlı Hidrodinamik Tuzak

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Biyomühendislik

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

Nükleik Asitler, Proteinler ve Küçük Moleküller Reagentless Algılama Elektrokimyasal DNA Biyosensörler Fabrikasyon

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Non-contact, Label-free Monitoring of Cells and Extracellular Matrix using Raman Spectroscopy

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, currently available routine methods require processing steps and alter sample integrity. Raman spectroscopy is a fast method that enables the measurement of biological samples without the need for further processing steps. This laser-based technology detects the inelastic scattering of monochromatic light.6 As every chemical vibration is assigned to a specific Raman band (wavenumber in cm-1), each biological sample features a typical spectral pattern due to their inherent biochemical composition.7-9 Within Raman spectra, the peak intensities correlate with the amount of the present molecular bonds.1 Similarities and differences of the spectral data sets can be detected by employing a multivariate analysis (e.g. principal component analysis (PCA)).10
Here, we perform Raman spectroscopy of living cells and native tissues. Cells are either seeded on glass bottom dishes or kept in suspension under normal cell culture conditions (37 &deg;C, 5% CO2) before measurement. Native tissues are dissected and stored in phosphate buffered saline (PBS) at 4 &deg;C prior measurements. Depending on our experimental set up, we then either focused on the cell nucleus or extracellular matrix (ECM) proteins such as elastin and collagen. For all studies, a minimum of 30 cells or 30 random points of interest within the ECM are measured. Data processing steps included background subtraction and normalization.

Raman spectroscopy is a suitable technique for the non-contact, label-free analysis of living cells, tissue-engineered constructs and native tissues. Source-specific spectral fingerprints can be generated and analyzed using multivariate analysis.

Raman Spektroskopisi kullanarak Hücreler ve Ekstrasellüler Matriks Temassız, Etiket ücretsiz izleme

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, ...

Hollow Microneedle-based Sensor for Multiplexed Transdermal Electrochemical Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals suffering from chronic medical conditions facile assessment of their immediate physiological state. Furthermore, it could serve as a research tool for analysis of complex, multifactorial medical conditions. In order for such a multianalyte sensor to be realized, it must be minimally invasive, sampling of interstitial fluid must occur without pain or harm to the user, and analysis must be rapid as well as selective.
Initially developed for pain-free drug delivery, microneedles have been used to deliver vaccines and pharmacologic agents (e.g., insulin) through the skin.1-2 Since these devices access the interstitial space, microneedles that are integrated with microelectrodes can be used as transdermal electrochemical sensors. Selective detection of glucose, glutamate, lactate, hydrogen peroxide, and ascorbic acid has been demonstrated using integrated microneedle-electrode devices with carbon fibers, modified carbon pastes, and platinum-coated polymer microneedles serving as transducing elements.3-7,8
This microneedle sensor technology has enabled a novel and sophisticated analytical approach for in situ and simultaneous detection of multiple analytes. Multiplexing offers the possibility of monitoring complex microenvironments, which are otherwise difficult to characterize in a rapid and minimally invasive manner. For example, this technology could be utilized for simultaneous monitoring of extracellular levels of, glucose, lactate and pH,9 which are important metabolic indicators of disease states7,10-14 (e.g., cancer proliferation) and exercise-induced acidosis.15

This article details the construction of a multiplexed microneedle-based sensor. The device is being developed for in situ sampling and electrochemical analysis of multiple analytes in a rapid and selective manner. We envision clinical medicine and biomedical research uses for these microneedle-based sensors.

Multiplexed Transdermal Elektrokimyasal Algılama Hollow microneedle tabanlı Sensör

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

Elektrokimyasal Sensörler kullanarak Bakteriyel Algılama ve Tanıma

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Multi-analyte Biochip (MAB) Based on All-solid-state Ion-selective Electrodes (ASSISE) for Physiological Research

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) that can withstand prolonged storage in complex biological media 1-4. An all-solid-state ion-selective-electrode (ASSISE) is especially attractive for the aforementioned applications. The electrode should have the following favorable characteristics: easy construction, low maintenance, and (potential for) miniaturization, allowing for batch processing. A microfabricated ASSISE intended for quantifying H+, Ca2+, and CO32- ions was constructed. It consists of a noble-metal electrode layer (i.e. Pt), a transduction layer, and an ion-selective membrane (ISM) layer. The transduction layer functions to transduce the concentration-dependent chemical potential of the ion-selective membrane into a measurable electrical signal.
The lifetime of an ASSISE is found to depend on maintaining the potential at the conductive layer/membrane interface 5-7. To extend the ASSISE working lifetime and thereby maintain stable potentials at the interfacial layers, we utilized the conductive polymer (CP) poly(3,4-ethylenedioxythiophene) (PEDOT) 7-9 in place of silver/silver chloride (Ag/AgCl) as the transducer layer. We constructed the ASSISE in a lab-on-a-chip format, which we called the multi-analyte biochip (MAB) (Figure 1).
Calibrations in test solutions demonstrated that the MAB can monitor pH (operational range pH 4-9), CO32- (measured range 0.01 mM - 1 mM), and Ca2+ (log-linear range 0.01 mM to 1 mM). The MAB for pH provides a near-Nernstian slope response after almost one month storage in algal medium. The carbonate biochips show a potentiometric profile similar to that of a conventional ion-selective electrode. Physiological measurements were employed to monitor biological activity of the model system, the microalga Chlorella vulgaris.
The MAB conveys an advantage in size, versatility, and multiplexed analyte sensing capability, making it applicable to many confined monitoring situations, on Earth or in space.
Biochip Design and Experimental Methods
The biochip is 10 x 11 mm in dimension and has 9 ASSISEs designated as working electrodes (WEs) and 5 Ag/AgCl reference electrodes (REs). Each working electrode (WE) is 240 &mu;m in diameter and is equally spaced at 1.4 mm from the REs, which are 480 &mu;m in diameter. These electrodes are connected to electrical contact pads with a dimension of 0.5 mm x 0.5 mm. The schematic is shown in Figure 2.
Cyclic voltammetry (CV) and galvanostatic deposition methods are used to electropolymerize the PEDOT films using a Bioanalytical Systems Inc. (BASI) C3 cell stand (Figure 3). The counter-ion for the PEDOT film is tailored to suit the analyte ion of interest. A PEDOT with poly(styrenesulfonate) counter ion (PEDOT/PSS) is utilized for H+ and CO32-, while one with sulphate (added to the solution as CaSO4) is utilized for Ca2+. The electrochemical properties of the PEDOT-coated WE is analyzed using CVs in redox-active solution (i.e. 2 mM potassium ferricyanide (K3Fe(CN)6)). Based on the CV profile, Randles-Sevcik analysis was used to determine the effective surface area 10. Spin-coating at 1,500 rpm is used to cast ~2 &mu;m thick ion-selective membranes (ISMs) on the MAB working electrodes (WEs).
The MAB is contained in a microfluidic flow-cell chamber filled with a 150 &mu;l volume of algal medium; the contact pads are electrically connected to the BASI system (Figure 4). The photosynthetic activity of Chlorella vulgaris is monitored in ambient light and dark conditions.

Multi-analyte Biochip MAB Based on All-solid-state Ion-selective Electrodes ASSISE for Physiological Research

All-solid-state ion-selective electrodes (ASSISEs) constructed from a conductive polymer (CP) transducer provide several months of functional lifetime in liquid media. Here, we describe the fabrication and calibration process of ASSISEs in a lab-on-a-chip format. The ASSISE is demonstrated to have maintained a near-Nernstian slope profile after prolonged storage in complex biological media.

Fizyolojik Araştırma All-katı hal İyon seçici elektrotlar (Assise) dayanarak Çok analit Biochip (MAB)

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) ...

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans' Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and pathways as well as its ease of cultivation. Several C. elegans disease models have been reported, including neurodegenerative disorders such as Parkinson's disease (PD), which involves the degeneration of dopaminergic (DA) neurons 1. Both transgenes and neurotoxic chemicals have been used to induce DA neurodegeneration and consequent movement defects in worms, allowing for investigations into the basis of neurodegeneration and screens for neuroprotective genes and compounds 2,3.
Screens in lower eukaryotes like C. elegans provide an efficient and economical means to identify compounds and genes affecting neuronal signaling. Conventional screens are typically performed manually and scored by visual inspection; consequently, they are time-consuming and prone to human errors. Additionally, most focus on cellular level analysis while ignoring locomotion, which is an especially important parameter for movement disorders.
We have developed a novel microfluidic screening system (Figure 1) that controls and quantifies C. elegans' locomotion using electric field stimuli inside microchannels. We have shown that a Direct Current (DC) field can robustly induce on-demand locomotion towards the cathode ("electrotaxis") 4. Reversing the field's polarity causes the worm to quickly reverse its direction as well. We have also shown that defects in dopaminergic and other sensory neurons alter the swimming response 5. Therefore, abnormalities in neuronal signaling can be determined using locomotion as a read-out. The movement response can be accurately quantified using a range of parameters such as swimming speed, body bending frequency and reversal time.
Our work has revealed that the electrotactic response varies with age. Specifically, young adults respond to a lower range of electric fields and move faster compared to larvae 4. These findings led us to design a new microfluidic device to passively sort worms by age and phenotype 6.
We have also tested the response of worms to pulsed DC and Alternating Current (AC) electric fields. Pulsed DC fields of various duty cycles effectively generated electrotaxis in both C. elegans and its cousin C. briggsae 7. In another experiment, symmetrical AC fields with frequencies ranging from 1 Hz to 3 KHz immobilized worms inside the channel 8.
Implementation of the electric field in a microfluidic environment enables rapid and automated execution of the electrotaxis assay. This approach promises to facilitate high-throughput genetic and chemical screens for factors affecting neuronal function and viability.

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans&#039; Locomotion

A semi-automated micro-electro-fluidic method to induce on-demand locomotion in Caenorhabditis elegans is described. This method is based on the neurophysiologic phenomenon of worms responding to mild electric fields (&#x201C;electrotaxis&#x201D;) inside microfluidic channels. Microfluidic electrotaxis serves as a rapid, sensitive, low-cost, and scalable technique to screen for factors affecting neuronal health.

On-talep Kantitatif Analiz için mikroakışkan tabanlı Electrotaxis<em&gt; Caenorhabditis elegans</em&gt; &#39;Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and ...

Use of Label-free Optical Biosensors to Detect Modulation of Potassium Channels by G-protein Coupled Receptors

Ion channels control the electrical properties of neurons and other excitable cell types by selectively allowing ions to flow through the plasma membrane1. To regulate neuronal excitability, the biophysical properties of ion channels are modified by signaling proteins and molecules, which often bind to the channels themselves to form a heteromeric channel complex2,3. Traditional assays examining the interaction between channels and regulatory proteins require exogenous labels that can potentially alter the protein&#39;s behavior and decrease the physiological relevance of the target, while providing little information on the time course of interactions in living cells. Optical biosensors, such as the X-BODY Biosciences BIND Scanner system, use a novel label-free technology, resonance wavelength grating (RWG) optical biosensors, to detect changes in resonant reflected light near the biosensor. This assay allows the detection of the relative change in mass within the bottom portion of living cells adherent to the biosensor surface resulting from ligand induced changes in cell adhesion and spreading, toxicity, proliferation, and changes in protein-protein interactions near the plasma membrane. RWG optical biosensors have been used to detect changes in mass near the plasma membrane of cells following activation of G protein-coupled receptors (GPCRs), receptor tyrosine kinases, and other cell surface receptors. Ligand-induced changes in ion channel-protein interactions can also be studied using this assay. In this paper, we will describe the experimental procedure used to detect the modulation of Slack-B sodium-activated potassium (KNa) channels by GPCRs.

Optical biosensor techniques can detect changes in mass near the plasma membrane in living cells and allow one to follow cellular responses in both individual cells and populations of cells. This protocol will describe detection of the modulation of potassium channels by G-protein coupled receptors in intact cells using this approach.

G-protein bağlı reseptörler ile Potasyum kanallarının modülasyonunu Algılama Label içermeyen optik Biyosensör kullanımı

Ion channels control the electrical properties of neurons and other excitable cell types by selectively allowing ions to flow through the plasma ...

A Label-free Technique for the Spatio-temporal Imaging of Single Cell Secretions

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning of such signaling can lead to many disorders. To understand cell-to-cell signaling, it is essential to study the spatial and temporal nature of the secreted molecules from the cell without disturbing the local environment. Various assays have been developed to study protein secretion, however, these methods are typically based on fluorescent probes which disrupt the relevant signaling pathways. To overcome this limitation, a label-free technique is required.
In this paper, we describe the fabrication and application of a label-free localized surface plasmon resonance imaging (LSPRi) technology capable of detecting protein secretions from a single cell. The plasmonic nanostructures are lithographically patterned onto a standard glass coverslip and can be excited using visible light on commercially available light microscopes. Only a small fraction of the coverslip is covered by the nanostructures and hence this technique is well suited for combining common techniques such as fluorescence and bright-field imaging.
A multidisciplinary approach is used in this protocol which incorporates sensor nanofabrication and subsequent biofunctionalization, binding kinetics characterization of ligand and analyte, the integration of the chip and live cells, and the analysis of the measured signal. As a whole, this technology enables a general label-free approach towards mapping cellular secretions and correlating them with the responses of nearby cells.

Inter-cellular communication is critical for controlling various physiological activities within and outside the cell. This paper describes a protocol for measuring the spatio-temporal nature of single cell secretions. To achieve this, a multidisciplinary approach is used which integrates label-free nanoplasmonic sensing with live cell imaging.

Tek Hücre Salgıları uzay-zamansal Görüntüleme için bir etiket içermeyen Tekniği

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning ...

Label-free Single Molecule Detection Using Microtoroid Optical Resonators

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental studies on the behavior of molecules. Single molecule detection techniques commonly utilize labels such as fluorescent tags or quantum dots, however, labels are not always available, increase cost and complexity, and can perturb the events being studied. Optical resonators have emerged as a promising means to detect single molecules without the use of labels. Currently the smallest particle detected by a non-plasmonically-enhanced bare optical resonator system in solution is a 25 nm polystyrene sphere1. We have developed a technique known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that can surpass this limit and achieve label-free single molecule detection in aqueous solution2. As signal strength scales with particle volume, our work represents a &#62; 100x improvement in the signal to noise ratio (SNR) over the current state of the art. Here the procedures behind FLOWER are presented in an effort to increase its usage in the field.

We have developed a label-free biosensing system based on optical resonator technology known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that is capable of detecting single molecules in solution. Here the procedures behind this work are described and presented.

Microtoroid Optik Rezonatörler Kullanarak Etiket serbest Tek Molekül Algılama

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental ...