המחברים מודים קרן רוברט וו דויטש, איום ביטחון הפחתת הסוכנות (DTRA), וקרן המדע מתעוררים הגבולות הלאומיים במחקר וחדשנות (אפרים) לתמיכה כספית. המחברים מודים גם ננוטכנולוגיה של אוניברסיטת מרילנד וFabLab לתמיכת מתקן חדר נקי.

.1 Microfabrication של השבב microfluidic <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן צ&#39;יפ אלקטרוכימי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תבנית זהב אלקטרודות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> יש לשטוף את רקיק ריק 4 &#39;&#39; סיליקון (איכות כיתה ראש) עם אצטון, מתנול, וisopropanol (&quot;עמי&quot; נקי). יש לשטוף את isopropanol מהרקיק במים ללא יונים (DI) ואחריו על ידי ייבוש עם N 2 אקדח. </li><li style=";text-align:right;direction:rtl"> לגדול שכבת 1 מיקרומטר עבה SiO 2 פסיבציה עם אדים כימיים בתצהיר משופר פלזמה כלי (PECVD). להפקיד רובד 200 עבה של כרום ואחריו שכבת 2,000 עבה של זהב עם כלי המקרטעת DC. </li><li style=";text-align:right;direction:rtl"> photoresist החיובי (פרמטרים ספינינג: 3,000 סל&quot;ד, 1,000 סל&quot;ד / sec, 30 שניות) ספין &quot;PR1&quot; כדי ליצור סרט אחיד ~ 1.6 מיקרומטר עבה. טרום לאפות את הרקיק 1 דקות ב100 ° C על פלטה חשמלית. </li><li style=";text-align:right;direction:rtl"> לחשוף את הרקיק עם 190 mJ / 2 סנטימטר באורך גל nm 405 דרך photomask. לפתח את הרקיק ל30 שניות ב352 developer ולשטוף את הרקיק עם DI ויבש עם N 2 אקדח. </li><li style=";text-align:right;direction:rtl"> לחרוט זהב עם etchant זהב ל1.5 דקות. לחרוט הכרום עם etchant כרום ל~ 30 שניות. יש לשטוף את הרקיק עם DI ויבש עם N 2 אקדח. </li><li style=";text-align:right;direction:rtl"> להפשיט photoresist עם נוהל &quot;עמי&quot; נקי. הערה: מחמצן חזק ונפיץ. </li><li style=";text-align:right;direction:rtl"> נקה את הרקיק עם 4: 1 H 2 SO 4: H 2 O 2 תערובת (נקייה &quot;פיראנה&quot;) 1 דקות. יש לשטוף את הרקיק עם DI ויבש עם N 2 אקדח. </li></ol></li><li style=";text-align:right;direction:rtl"> תבנית אלקטרודות פלטינה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> photoresist החיובי (פרמטרים ספינינג: 3,000 סל&quot;ד, 1,000 סל&quot;ד / sec, 30 שניות) ספין &quot;PR2&quot; כדי ליצור סרט אחיד ~ 1.4 מיקרומטר עבה. טרום לאפות את הרקיק 1 דקות ב100 ° C על פלטה חשמלית. </li><li style=";text-align:right;direction:rtl"> לחשוף את הרקיק עם 30 mJ / 2 סנטימטר באורך גל nm 405 דרך photomask. אופים את פרוסות ל45 שניות ב125 ° C על פלטה חשמלית. מבול לחשוףהרקיק עם 1,000 mJ / 2 סנטימטר ב405 אורך גל בלי photomask. לפתח את הרקיק למשך 2 דקות ב6: יזם AZ400K 1 ולשטוף את הרקיק עם DI ויבש עם N 2 אקדח. </li><li style=";text-align:right;direction:rtl"> להפקיד רובד 400 עבה של טיטניום ואחריו שכבה עבה 1,600 Å של פלטינה באמצעות מערכת אידוי E-קורה. </li><li style=";text-align:right;direction:rtl"> הרם את photoresist באמבטית אצטון ultrasonicated למשך 5 דקות ואחריו שטיפה עם אצטון וisopropanol. יש לשטוף את הרקיק עם DI ויבש עם N 2 אקדח. </li></ol></li></ol></li><li style=";text-align:right;direction:rtl"> הכן ערוצי Assay <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן עובש לערוצי Assay <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> יש לשטוף את רקיק ריק 4 &#39;&#39; סיליקון (איכות כיתה מבחן) עם נוהל &quot;עמי&quot; נקי. יש לשטוף את isopropanol מהרקיק עם DI ואחרי ייבוש עם N 2 אקדח. </li><li style=";text-align:right;direction:rtl"> photoresist השלילי (פרמטרים ספין &quot;PR3&quot; 2-צעד ספינינג:. צעד אחד - 600 סל&quot;ד, 120 סל&quot;ד / sec, 10 שניות שלב שני - 1,150 סל&quot;ד, 383 סל&quot;ד / sec,27 שניות) כדי ליצור סרט אחיד ~ 100 מיקרומטר עבה. טרום לאפות את הרקיק על פלטה (פרמטרים אפייה 2 שלבים:. צעד אחד - כבש את מטמפרטורת חדר עד 65 מעלות צלזיוס ב300 ° C / שעה ולהחזיק טמפרטורה עבור 10 דקות שלב 2 - רמפה עד 95 מעלות צלזיוס ב300 ° C / שעה וטמפרטורת אחיזה ל30 דקות). </li><li style=";text-align:right;direction:rtl"> לחשוף את הרקיק עם 2,500 mJ / 2 סנטימטר באורך גל nm 405 דרך photomask. פוסט לאפות את הרקיק על ידי ramping עד 95 מעלות צלזיוס ב300 ° C / שעה ולהחזיק טמפרטורה עבור 10 דקות על פלטה חשמלית. לפתח את הרקיק עבור 10 דקות בפרופילן גליקול Monomethyl Ether אצטט מפתח (PGMEA). יש לשטוף את הרקיק עם isopropanol ויבש עם N אקדח 2. </li></ol></li><li style=";text-align:right;direction:rtl"> לפברק ערוצי Assay <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן 10: polydimethylsiloxane 1 (PDMS) תערובת (20 גרם של אלסטומר, 2 גרם של סוכן ריפוי) ודגה לחלוטין בתא ואקום עבור 20 דקות. </li><li style=";text-align:right;direction:rtl"> להגדיר מתחם סביב רקיק התבנית עם רדיד אלומיניום ויוצקים באיטיות PDMS הדפוקעל העובש. </li><li style=";text-align:right;direction:rtl"> אופים את התבנית עם PDMS בתנור תיבה (פרמטרים אפייה 2 שלבים:. צעד אחד - 5 דקות כבש את מטמפרטורת חדר ל80 ° C שלב 2 - להחזיק ב80 מעלות צלזיוס למשך 17 דקות). </li><li style=";text-align:right;direction:rtl"> לקלף PDMS מהתבנית ומניחים על נייר אלומיניום. חותך את שבבי assay עם סכין מנתח, להגדיר חורים עם כלי חבטות ביופסיה. </li></ol></li></ol></li></ol> .2 להרכיב את המכשיר <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ידני ליישר את ערוצי assay PDMS עם אלקטרודות עובדות על השבב אלקטרוכימיים. PDMS מקלות גם לשבב אלקטרוכימיים, איטום הערוצים ומניעת דליפה. </li><li style=";text-align:right;direction:rtl"> חבר צינור גמיש (OD 0.087 &#39;&#39; ומזהה 0.015 &#39;&#39;) למרפק פלסטיק או מחבר ישר באמצעות צינור גמיש קצר כמתאם (OD .1875 &#39;&#39; ומזהה 0.0625 &#39;&#39;). צרף מחברים לכל אחד מפתחי הכניסה מחורר במכשיר. </li><li style=";text-align:right;direction:rtl"> חבר מזרק בקצה השני שלצינורות ולמקם את המזרק במשאבת מזרק. לחלופין לשנות את המערכת של מזרק, צינור, ומחבר לפי הצעד נדרש הליך בסעיף 3 והפתרון המתאים לו. </li></ol> .3 לנתח DNA הכלאה הערה: הצג את כל פתרון באיטיות לתוך הערוץ בקצב זרימה של 200 μl / שעה עד שכל הערוץ מלא. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Functionalize כל microchannel אנכי עם רצף בדיקה ssDNA שונה (לבצע במקביל ל3 microchannels האנכית נפרדת): <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ממלא כל microchannel עם פתרון דגירה בדיקה שונה ssDNA (חיץ פוספט 10 מ&quot;מ, phosphine 100 mM NaCl, 10 מיקרומטר טריס (2-carboxyethyl) (TCEP), ובדיקת 1 מיקרומטר ssDNA), ודגירה עבור שעה 1 ואחריו שטיפת microchannel עם PBS. </li><li style=";text-align:right;direction:rtl"> מלא את microchannel עם תמיסה המכילה 1 מ&quot;מ של 6-mercapto-1-hexanol (MCH) במאגר של 10 מ&quot;מ PBS, 100 mM NaCl ו1.395 מ&quot;מ TCEP, וincuבייט עבור שעה 1 ואחריו שטיפת microchannel עם PBS. </li></ol></li><li style=";text-align:right;direction:rtl"> הרם את PDMS, לסובב 90 ° לכיוון אופקי, ולמקם את מטה וחושפים שורות נפרדות של תאי תגובה עם כל שורה המכילה דלפק ייחודי ואלקטרודה השוואתית (איור S1). </li><li style=";text-align:right;direction:rtl"> מלא את microchannels עם פתרון מדידת שליטה של ​​4x מרוכז ציטראט מלוחים נתרן חיץ (SSC), והדגירה של 20 דקות. </li><li style=";text-align:right;direction:rtl"> מדידת רקע: מלא את microchannels עם 5 מ&quot;מ ferricyanide / 5 של ברזל מ&quot;מ בפתרון PBS ולהקליט את ערכי העכבה של המערכת אלקטרוכימיים לתדרים שונים (ספקטרוסקופיה עכבה אלקטרוכימי; EIS) באמצעות potentiostat מחובר לעבודה, הדלפק, ואלקטרודות התייחסות ( טווח תדרים מMHz 1 עד 0.1 הרץ, 10 נקודות נתונים תדירות לעשור, 25 משרעת mV, 5 קיטוב mV לעומת אלקטרודה ההפניה): פרמטרים EIS. חזור על מדידה זו עבור כל אלקטרודה עובדת בmicrochannels. </li&gt; <li style=";text-align:right;direction:rtl"> למדוד הכלאת DNA (לבצע עבור כל יעד ssDNA שאינו משלים ומשלים). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מלא את microchannels עם יעד פתרון מדידת ssDNA של 4x מרוכז חיץ SSC המכיל 1 מיקרומטר של היעד ssDNA, ודגירה של 20 דקות. מדוד את DNA על פי צעד 3.4. </li></ol></li></ol>

<ol>
	<li>Hong, J., Edel, J. B., deMello, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micro-+and+nanofluidic+systems+for+high-throughput+biological+screening.">Micro- and nanofluidic systems for high-throughput biological screening.</a> Drug Discov. Today. 14, 134-146 (2009).</li><li>Sun, Y., Kwok, Y. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymeric+microfluidic+system+for+DNA+analysis.">Polymeric microfluidic system for DNA analysis.</a> Anal. Chim. Acta. 556, 80-96 (2006).</li><li>Xu, Y., Yang, X., Wang, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review:+aptamers+in+microfluidic+chips.">Review: aptamers in microfluidic chips.</a> Anal. Chim. Acta. 683, 12-20 (2010).</li><li>Yang, W., Woolley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+multiprocess+microfluidic+systems+for+automating+analysis.">Integrated multiprocess microfluidic systems for automating analysis.</a> J. Lab. Automat. 15, 198-209 (2010).</li><li>Gervais, T., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mass+transport+and+surface+reactions+in+micro&#64258;uidic+systems.">Mass transport and surface reactions in micro&#64258;uidic systems.</a> Chem. Eng. Sci. 61, 1102-1121 (2006).</li><li>Song, H., Ismagilov, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond+kinetics+on+a+microfluidic+chip+using+nanoliters+of+reagents.">Millisecond kinetics on a microfluidic chip using nanoliters of reagents.</a> J. Am. Chem. Soc. 125, 14613-14619 (2003).</li><li>Jiang, H., Weng, X. A., Li, D. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+whole-blood+immunoassays.">Microfluidic whole-blood immunoassays.</a> Microfluid. Nanofluid. 10, 941-964 (2011).</li><li>Dutse, S. W., Yusof, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+lab-on-chip+systems+in+DNA-based+biosensing:+an+overview.">Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview.</a> Sensors. 11, 5754-5768 (2011).</li><li>Dittrich, P. S., Manz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lab-on-a-chip:+microfluidics+in+drug+discovery.">Lab-on-a-chip: microfluidics in drug discovery.</a> Nat. Rev. Drug Discov. 5, 210-218 (2006).</li><li>Craighead, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Future+lab-on-a-chip+technologies+for+interrogating+individual+molecules.">Future lab-on-a-chip technologies for interrogating individual molecules.</a> Nature. 442, 387-393 (2006).</li><li>Hunt, H. K., Armani, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+biological+and+chemical+sensors.">Label-free biological and chemical sensors.</a> Nanoscale. 2, 1544-1559 (2010).</li><li>Dukkipati, V. R., Pang, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+microfluidic+system+for+DNA+analysis.">Integrated microfluidic system for DNA analysis.</a> IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).</li><li>Fang, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+microfluidic+devices+with+concurrent+electrochemical+detection.">Real-time PCR microfluidic devices with concurrent electrochemical detection.</a> Biosens. Bioelectron. 24, 2131-2136 (2009).</li><li>Pavlovic, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+device+architecture+for+electrochemical+patterning+and+detection+of+multiple+DNA+sequences.">Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences.</a> Langmuir. 24, 1102-1107 (2008).</li><li>Xu, X., Zhang, S., Chen, H., Kong, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+electrochemistry+in+micro-total+analysis+systems+for+biochemical+assays:+recent+developments.">Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.</a> Talanta. 80, 8-18 (2009).</li><li>Cai, H., Lee, T. M. -. H., Hsing, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+protein+recognition+using+an+aptamer-based+impedance+measurement+assay.">Label-free protein recognition using an aptamer-based impedance measurement assay.</a> Sensor. Actuat. B-Chem. 114, 433-437 (2006).</li><li>Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic+device+for+impedance+spectroscopy+analysis+of+biological+samples.">A Microfluidic device for impedance spectroscopy analysis of biological samples.</a> Sensor. Actuat. B-Chem. 123, 168-176 (2007).</li><li>Prakash, S. B., Abshire, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+cancer+cell+proliferation+on+a+CMOS+capacitance+sensor+chip.">Tracking cancer cell proliferation on a CMOS capacitance sensor chip.</a> Biosens. Bioelectron. 23, 1449-1457 (2008).</li><li>Yamaguchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+fabrication+of+electrochemical+enzyme+sensor+chip+using+polydimethylsiloxane+microfluidic+channel.">Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel.</a> Anal. Chim. Acta. 468, 143-152 (2002).</li><li>Beebe, D. J., Mensing, G. A., Walker, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physics+and+applications+of+microfluidics+in+biology.">Physics and applications of microfluidics in biology.</a> Annu. Rev. Biomed. Eng. 4, 261-286 (2002).</li><li>Mariella, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preparation:+the+weak+link+in+microfluidics-based+biodetection.">Sample preparation: the weak link in microfluidics-based biodetection.</a> Biomed. Microdevices. 10, 777-784 (2008).</li><li>Bhushan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Springer handbook of nanotechnology. , (2010).</li><li>Ghallab, Y. H., Badawy, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).</li><li>Chee, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+genetic+information+with+high-density+DNA+arrays.">Accessing genetic information with high-density DNA arrays.</a> Science. 25, 610-614 (1996).</li><li>Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+hybridization+detection+by+label+free+versus+impedance+amplifying+label+with+impedance+spectroscopy.">DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy.</a> Sensor. Actuat. B-Chem. 114, 58-64 (2006).</li><li>Ito, T., Hosokawa, K., Maeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+single-base+mismatch+at+distal+end+of+DNA+duplex+by+electrochemical+impedance+spectroscopy.">Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy.</a> Biosens. Bioelectron. 22, 1816-1819 (2007).</li><li>Kao, L. T. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+detection+and+differentiation+of+the+DNA+strains+for+influenza+A+(H1N1+2009)+using+a+silicon-based+microfluidic+system.">Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system.</a> Biosens. Bioelectron. 26, 2006-2011 (2011).</li><li>Li, J., Chen, S., Evans, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Typing+and+subtyping+influenza+virus+using+DNA+microarrays+and+multiplex+reverse+transcriptase+PCR.">Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR.</a> J. Clin. Microbiol. 39, 696-704 (2001).</li><li>Gautier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybridization-induced+interfacial+changes+detected+by+non-faradaic+impedimetric+measurements+compared+to+faradaic+approach.">Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach.</a> J. Electroanal. Chem. 610, 227-233 (2007).</li><li>Ma, Y., Jiao, K., Yang, T., Sun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitive+PAT+gene+sequence+detection+by+nano-SiO2/p-aminothiophenol+self-assembled+films+DNA+electrochemical+biosensor+based+on+impedance+measurement.">Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement.</a> Sensor. Actuat. B-Chem. 131, 565-571 (2008).</li><li>Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+DNA+hybridization+kinetics+in+a+microfluidic+flow+channel.">Characterization of DNA hybridization kinetics in a microfluidic flow channel.</a> Sensor. Actuat. B-Chem. 113, 281-289 (2006).</li><li>Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+electrochemical+sensor+array+for+characterizing+protein+interactions+with+various+functionalized+surfaces.">Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces.</a> Anal. Chem. 83, 5920-5927 (2011).</li><li>Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic-based+electrochemical+biochip+for+label-free+diffusion-restricted+DNA+hybridization+analysis.">A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.</a> Biosens. Bioelectron. 38, 114-120 (2012).</li><li>Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-assembled+monolayers+for+biosensors.">Self-assembled monolayers for biosensors.</a> Analyst. 122, 43R-50R (1997).</li><li>McEwen, G. D., Chen, F., Zhou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization,+hybridization,+and+oxidation+of+synthetic+DNA+on+gold+surface:+Electron+transfer+investigated+by+electrochemistry+and+scanning+tunneling+microscopy.">Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy.</a> Anal. Chim. Acta. 643, 26-37 (2009).</li><li>Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+surface+charging+during+the+coadsorption+of+mercaptohexanol+to+DNA+layers+on+gold:+Direct+observation+of+desorption+and+layer+reorientation.">The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation.</a> Langmuir. 22, 5560-5562 (2006).</li><li>Katz, E., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+biomolecular+interactions+at+conductive+and+semiconductive+surfaces+by+impedance+spectroscopy:+Routes+to+impedimetric+immunosensors,+DNA-sensors,+and+enzyme+biosensors.">Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors.</a> Electroanalysis. 15, 913-947 (2003).</li></ol>

יש לי המחברים אין לחשוף.

הנהלים שלנו להדגים את הייצור של biochip אלקטרוכימיים המבוסס על microfluidic והניצול שלה לניתוח אירועי הכלאת DNA. באמצעות תהליך microfabrication תשואה גבוהה בשליטתנו לפתח מכשיר מורכב מערוצי microscale המשולבים עם מערך של חיישני אלקטרוכימיים. אנחנו פיתחנו פרמטרים עיבוד מבוקרים להליך photolithog...

מעבדה על שבב microfluidic מכשירים (LOC) מספקים יתרונות רבים באבחון קליני, ניטור סביבתי ומחקר ביו. התקנים אלה לנצל ערוצי microfluidic לשלוט זרימת נוזל לאזורים של השבב שבו מגוון רחב של נהלים יכול להתקיים כולל ערבוב מגיב, זיקה מבוססת מחייב, הולכים אותות, ותא culturing 1-4. מיקרופלואידיקה מספקת יתרונות רבים על פני כלי אבחון קליניים קונבנציונליים כגון קוראי צלחת microwell או מבחני משמרת ג&#39;ל electrophoretic. מכשירי microfluidic דורשים 2 עד 3 סדרי הגודל (nanoliters בניגוד למיקרוליטר) פחות חומרים כימיים לביצוע מבחני דומים. כמו כן, מכשירים אלה יכולים להגדיל את המהירות שבה כמה אירועים ביולוגיים להתרחש עקב הכליאה קטנה יותר של המינים בתוך הערוצים 5,6. שלישית, ניתן לשלב חיישנים בתוך המכשירים microfluidic תוך שימוש בטכניקות ליתוגרפיה ותחריט, אשר יכול לספק detectio ללא תוויתn. לבסוף, התקנים אלה הם זולים לייצור ודורש קצת עבודה על החלק של הטכנאי לפעול 7-10. זיהוי ללא תווית בדרך כלל מתבצע באמצעות מתמר אופטי או חשמלי. מכשירים אופטיים יכולים להציג ביצועים טובים יותר חישה עקב הפרעה נמוכה יותר עם analytes במדגם. עם זאת, הביצועים שלהם נפגעת במקרים בהם הרקע של המדגם יש את אותו אורך גל מהדהד כמו החיישן 11. ישנם יתרונות רבים לשימוש באותות חשמליים כדי לבצע זיהוי ביולוגי וכימי במערכות microfluidic. הייצור הוא מטבעו פחות מסובך מאז חיישנים אלה בדרך כלל דורשים רק אלקטרודות בדוגמת לפעול. בנוסף, אותות חשמליים יכולים להיות ממשק ישיר עם ציוד המדידה ביותר, תוך שיטות אות מסוימות עשויות לדרוש מתמר להמיר את האות 12-15. חיישנים חשמליים נפוצים למדוד שינויים בimpedancפעילות הדואר 16,17, קיבול 18, או חיזור 19. עם זאת, אתגרים חדשים מוצגים כמערכות אלה ממוזערים. האתגרים החשובים ביותר להתגבר כוללים: הכנת מדגם וערבוב של נוזלים (עקב נמוך נפח הדגימה ומספר ריינולדס), השפעות פיזיות וכימיות (כולל כוחות נימים, חספוס פני השטח, אינטראקציות כימיות בין חומרי הבנייה וanalytes), איתות נמוכה יחס לרעש (המיוצר על ידי האזור המופחת פני השטח ונפח) 20-23, והפרעה אפשרית מanalytes אלקטרו הפעיל בדגימות מורכבות ביולוגיות (למשל, דם ורוק). חקירה נוספת של תופעות אלה תגרום להנחיות לייצור ותפעול מדויקים של מכשירים אלה באופן לשחזור שישפרו על הביצועים הכוללים שלהם. זיהוי הכלאת DNA נעשה שימוש נרחב כדי לאבחן הפרעות גנטיות 24,25 וצורות שונות של cancאה 26. בכל שנה, זנים רבים של שפעת מזוהות בחולים באמצעות תוצאות של טכניקות הכלאת DNA 27. נגיף שפעת חשבונות לבד עבור 36,000 מקרי מוות בכל שנה בארצות הברית 28. דוגמאות כאלה יכולות להפיק תועלת ממכשיר microfluidic ספסל העליון שיכול לבצע את אותן טכניקות assay כassay משמרת צלחת קורא או ג&#39;ל עם נמוך נפח דגימה ובכל חלק של העלות מבלי להקריב את רגישות או סגוליות. בשל יתרונות הרבים של חישה אלקטרוכימיים ללא תווית, זה כבר בשימוש נרחב לגילוי של אירועי הכלאת DNA 29,30. התקנה שבו אלקטרודות מאקרו בקנה מידה (בטווח של מילימטר) טבולות בכוסות עם הפתרון של עניין יכול לשמש כדי לספק נתונים רגישים מאוד בנוגע לקינטיקה מחייבת של רצפי DNA חד גדילים לרצפים המשלימים ההתאמה שלהם. לאחרונה, יש כבר כמה התקדמות בשילוב חישה אלקטרוכימיים בMICRofluidics להכלאת DNA. מחקרים שבוצעו לגבי קינטיקה הכלאה יום 31 ובאינטגרציה של חיישנים לגילוי 15 בערוצי microfluidic. עם זאת, עדיין קיים צורך במכשיר מהיר תפוקה גבוהה microfluidic שיכול לנתח אירועי הכלאת DNA במקביל ללא צעדי הכנת מדגם מסובכים. המכשיר שהוצג בעבודה זו מספק פלטפורמה שמאפשרת לאינטראקציות מרובות כדי להיות מוקרנים במקביל וללא צעדי הכנת מדגם מסובכים. הפרוטוקול שלנו מציג כיצד microfluidic מבוסס שבבים אלקטרוכימיים הם microfabricated עם מערכות מיקרו אלקטרו טכנולוגיה (MEMS) 32,33. אנו מתארים את תהליך הייצור של שני השבב microfluidic, עשוי polydimethylsiloxane (PDMS), והשבב אלקטרוכימיים, מורכב ממערך של אלקטרודות. Functionalization הכימי של biochip עם בדיקות ssDNA הוא התייחס גם. לבסוף, אבילity של biosensor כדי לזהות באופן ספציפי ולנתח מטרות ssDNA בא לידי ביטוי. בסך הכל, biochip אלקטרוכימיים המבוסס על microfluidic הוא טכניקה מהירה וניתוח תפוקה גבוהה. זה יכול לשמש כדי לחקור אינטראקציות בין מולקולות ביולוגיות ומתמר ביצוע, ויכול להיות מנוצל במגוון רחב של יישומי מעבדה על שבב.

<table border="0" cellpadding="0" cellspacing="0" width="765">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:155px;">Company</td>
			<td style="width:227px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Material</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4&#39;&#39; Silicon wafer</td>
			<td style="width:155px;">Ultrasil</td>
			<td style="width:227px;">4-5664</td>
			<td>Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm*cm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Shipley 1813 photoresist (&#34;PR1&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">AZ5214 photoresist (&#34;PR2&#34;)</td>
			<td style="width:155px;">Hoechst Celanse</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SU-8 50 photoresist (&#34;PR3&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">negative photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gold etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">TFA</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chromium etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">1020AC</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS elastomer</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097366 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS curing agent</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097358 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Biopsy punching tool</td>
			<td style="width:155px;">Healthlink</td>
			<td style="width:227px;">BP20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible tubing</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">R 3603</td>
			<td>.015&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible adapter</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">06417-41</td>
			<td>.0625&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">1 mL syringe</td>
			<td style="width:155px;">Beckton-Dickenson</td>
			<td align="right" style="width:227px;">301025</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Monobasic potassium phosphate</td>
			<td style="width:155px;">Fluka</td>
			<td align="right" style="width:227px;">1551139</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium phosphate dibasic anhydrous</td>
			<td style="width:155px;">Sigma</td>
			<td style="width:227px;">RES20765-A7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium chloride</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:227px;">S7653</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">tris(2-carboxyethyl)phosphine</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">C4706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">6-mercapto-1-hexanol</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">451088</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">20x concentrated saline-sodium citrate buffer</td>
			<td style="width:155px;">Sigma</td>
			<td align="right" style="width:227px;">93017</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium hexacyanoferrate(III)</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">455946</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium ferrocyanide</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">CDS001589</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/AAAGCTCCGATAGCGCTCCG 
			TGGACGTCCC-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-GGGACGTCCACGGAGCGCTA 
			TCGGAGCTTT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA 
			ATCGATGAGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-ACTCATCGATTCGTCAATGA 
			CCTGACCCGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA 
			CCCATGATGA-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-TCATCATGGGTCTAACTACT 
			GGATCTAGGT-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Instrument</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Plasma Enhanced Chemical Vapor Deposition (PECVD)</td>
			<td style="width:155px;">Oxford Instruments</td>
			<td style="width:227px;">PlasmaLab System 100</td>
			<td>Chamber pressure 1000 mTorr, Tempreture 200 celsius degrees, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Angstrom/minute.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DC sputtering unit</td>
			<td style="width:155px;">AJA International</td>
			<td style="width:227px;">ATC 1800-V</td>
			<td>For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">E-beam evaporation system</td>
			<td style="width:155px;">Denton</td>
			<td style="width:227px;">Custom-built</td>
			<td>For Titanium: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 6-10 Angstrom/second. For Platinum: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 2-3 Angstrom/second.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Potentiostat</td>
			<td style="width:155px;">CH Instruments</td>
			<td style="width:227px;">660D</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Syringe pump</td>
			<td style="width:155px;">KD Scientific</td>
			<td style="width:227px;">KDS230</td>
			<td></td>
		</tr>
	</tbody>
</table>

a microfluidic-based electrochemical biochip for label-free dna hybridization analysis

מזעור של נהלים המעבדתיים אנליטיים למייקרו בקנה המידה מספק יתרונות משמעותיים בכל הקשור לזמן תגובה, עלות, ושילוב של מדרגות עיבוד מראש. ניצול מכשירים אלה לקראת הניתוח של אירועי הכלאת DNA הוא חשוב משום שהיא מציעה טכנולוגיה להערכה בזמן אמת של סמנים ביולוגיים בנקודה של הטיפול למחלות שונות. עם זאת, כאשר טביעת רגל המכשיר מפחיתה את הדומיננטיות של עליות תופעות פיסיקליות שונות. תופעות אלה משפיעים על דיוק הייצור ואמינות תפעול של המכשיר. לכן, יש צורך גדול כדי להמציא באופן מדויק והפעלת מכשירים אלו באופן לשעתק על מנת לשפר את הביצועים הכוללים. כאן, אנו מתארים את הפרוטוקולים ושיטות המשמשות לייצור והתפעול של biochip אלקטרוכימיים המבוסס על microfluidic לניתוח מדויק של אירועי הכלאת DNA. Biochip מורכב משני חלקים: שבב microfluidic עםשלושה מיקרו ערוצים מקבילים עשויים polydimethylsiloxane (PDMS), ו3 x 3 מיקרו שבב אלקטרוכימיים ערוך. אירועי הכלאת DNA מזוהים באמצעות ניתוח אלקטרוכימיים ספקטרוסקופיה עכבה (EIS). ניתוח EIS מאפשר וריאציות ניטור של המאפיינים של המערכת אלקטרוכימיים כי הם דומיננטיים בקני מידת אורך אלה. עם היכולת לעקוב אחר שינויים של שתי העברת המטען והתנגדות diffusional עם biosensor, אנחנו מדגימים את הסלקטיביות למטרות ssDNA משלימות, גבול גילוי מחושב של 3.8 ננומטר, ו13% תגובתיות צולבת עם ssDNA שאינו משלימים אחרים הבא 20 דקות של דגירה. מתודולוגיה זו יכולה לשפר את הביצועים של מכשירים ממוזערים על ידי הבהרה על ההתנהגות של דיפוזיה במשטר מיקרו בקנה מידה ועל ידי הפעלת המחקר של אירועי הכלאת DNA.

תהליך ייצור לשליטה ומדויק למכשיר הניסוי הוא חיוני במחקר. זה מאפשר לחוקרים לקבל ניסויי תפוקה לשחזור וגבוהים. כאן יש לנו הפגנו תשואה גבוהה, תהליך microfabrication שחזור גבוה של biochip אלקטרוכימיים המבוסס על microfluidic (איור 1). עם שיעור כישלון נמוך, כמה מכשירים הראו נושאי מלי...

Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

אנו מציגים biochip אלקטרוכימיים המבוסס על microfluidic לגילוי הכלאת DNA. בעקבות functionalization הבדיקה ssDNA, הסגוליות, הרגישות, וגבול הגילוי נלמדים ביעדי ssDNA משלימים ולא משלימים. תוצאות ממחישות את השפעתם של אירועי הכלאת DNA על מערכת אלקטרוכימיים, עם גבול גילוי של 3.8 ננומטר.

Biochip אלקטרוכימי מבוסס Microfluidic לניתוח הכלאה DNA ללא תווית

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

a-microfluidic-based-electrochemical-biochip-for-label-free-dna

Research

JoVE Journal

Bioengineering

17.0K Views.  University of Maryland.  אנו מציגים biochip אלקטרוכימיים המבוסס על microfluidic לגילוי הכלאת DNA. בעקבות functionalization הבדיקה ssDNA, הסגוליות, הרגישות, וגבול הגילוי נלמדים ביעדי ssDNA משלימים ולא משלימים. תוצאות ממחישות את השפעתם של אירועי הכלאת DNA על מערכת אלקטרוכימיים, עם גבול גילוי...

Video: A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

A Microfluidic-based Hydrodynamic Trap for Single Particles

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science. Methods for particle trapping based on optical, magnetic, electrokinetic, and acoustic techniques have led to major advancements in physics and biology ranging from the molecular to cellular level. In this article, we introduce a new microfluidic-based technique for particle trapping and manipulation based solely on hydrodynamic fluid flow. Using this method, we demonstrate trapping of micro- and nano-scale particles in aqueous solutions for long time scales. The hydrodynamic trap consists of an integrated microfluidic device with a cross-slot channel geometry where two opposing laminar streams converge, thereby generating a planar extensional flow with a fluid stagnation point (zero-velocity point). In this device, particles are confined at the trap center by active control of the flow field to maintain particle position at the fluid stagnation point. In this manner, particles are effectively trapped in free solution using a feedback control algorithm implemented with a custom-built LabVIEW code. The control algorithm consists of image acquisition for a particle in the microfluidic device, followed by particle tracking, determination of particle centroid position, and active adjustment of fluid flow by regulating the pressure applied to an on-chip pneumatic valve using a pressure regulator. In this way, the on-chip dynamic metering valve functions to regulate the relative flow rates in the outlet channels, thereby enabling fine-scale control of stagnation point position and particle trapping. The microfluidic-based hydrodynamic trap exhibits several advantages as a method for particle trapping. Hydrodynamic trapping is possible for any arbitrary particle without specific requirements on the physical or chemical properties of the trapped object. In addition, hydrodynamic trapping enables confinement of a "single" target object in concentrated or crowded particle suspensions, which is difficult using alternative force field-based trapping methods. The hydrodynamic trap is user-friendly, straightforward to implement and may be added to existing microfluidic devices to facilitate trapping and long-time analysis of particles. Overall, the hydrodynamic trap is a new platform for confinement, micromanipulation, and observation of particles without surface immobilization and eliminates the need for potentially perturbative optical, magnetic, and electric fields in the free-solution trapping of small particles.

In this article, we present a microfluidic-based method for particle confinement based on hydrodynamic flow. We demonstrate stable particle trapping at a fluid stagnation point using a feedback control mechanism, thereby enabling confinement and micromanipulation of arbitrary particles in an integrated microdevice.

Microfluidic מבוססי הידרודינמית מלכודת חלקיקים יחיד

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

המצאה של אלקטרוכימי-DNA Biosensors לגילוי Reagentless של חומצות, חלבונים ומולקולות קטנות גרעין

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Non-contact, Label-free Monitoring of Cells and Extracellular Matrix using Raman Spectroscopy

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, currently available routine methods require processing steps and alter sample integrity. Raman spectroscopy is a fast method that enables the measurement of biological samples without the need for further processing steps. This laser-based technology detects the inelastic scattering of monochromatic light.6 As every chemical vibration is assigned to a specific Raman band (wavenumber in cm-1), each biological sample features a typical spectral pattern due to their inherent biochemical composition.7-9 Within Raman spectra, the peak intensities correlate with the amount of the present molecular bonds.1 Similarities and differences of the spectral data sets can be detected by employing a multivariate analysis (e.g. principal component analysis (PCA)).10
Here, we perform Raman spectroscopy of living cells and native tissues. Cells are either seeded on glass bottom dishes or kept in suspension under normal cell culture conditions (37 &deg;C, 5% CO2) before measurement. Native tissues are dissected and stored in phosphate buffered saline (PBS) at 4 &deg;C prior measurements. Depending on our experimental set up, we then either focused on the cell nucleus or extracellular matrix (ECM) proteins such as elastin and collagen. For all studies, a minimum of 30 cells or 30 random points of interest within the ECM are measured. Data processing steps included background subtraction and normalization.

Raman spectroscopy is a suitable technique for the non-contact, label-free analysis of living cells, tissue-engineered constructs and native tissues. Source-specific spectral fingerprints can be generated and analyzed using multivariate analysis.

ללא קשר, לייבל ללא ניטור של תאים תאי מטריקס באמצעות ספקטרוסקופיית ראמאן

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, ...

Hollow Microneedle-based Sensor for Multiplexed Transdermal Electrochemical Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals suffering from chronic medical conditions facile assessment of their immediate physiological state. Furthermore, it could serve as a research tool for analysis of complex, multifactorial medical conditions. In order for such a multianalyte sensor to be realized, it must be minimally invasive, sampling of interstitial fluid must occur without pain or harm to the user, and analysis must be rapid as well as selective.
Initially developed for pain-free drug delivery, microneedles have been used to deliver vaccines and pharmacologic agents (e.g., insulin) through the skin.1-2 Since these devices access the interstitial space, microneedles that are integrated with microelectrodes can be used as transdermal electrochemical sensors. Selective detection of glucose, glutamate, lactate, hydrogen peroxide, and ascorbic acid has been demonstrated using integrated microneedle-electrode devices with carbon fibers, modified carbon pastes, and platinum-coated polymer microneedles serving as transducing elements.3-7,8
This microneedle sensor technology has enabled a novel and sophisticated analytical approach for in situ and simultaneous detection of multiple analytes. Multiplexing offers the possibility of monitoring complex microenvironments, which are otherwise difficult to characterize in a rapid and minimally invasive manner. For example, this technology could be utilized for simultaneous monitoring of extracellular levels of, glucose, lactate and pH,9 which are important metabolic indicators of disease states7,10-14 (e.g., cancer proliferation) and exercise-induced acidosis.15

This article details the construction of a multiplexed microneedle-based sensor. The device is being developed for in situ sampling and electrochemical analysis of multiple analytes in a rapid and selective manner. We envision clinical medicine and biomedical research uses for these microneedle-based sensors.

חיישן הולו Microneedle מבוסס על מרובב דרך העור אלקטרוכימי חישה

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

גילוי חיידקים וזיהוי באמצעות חיישנים אלקטרוכימיים

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Multi-analyte Biochip (MAB) Based on All-solid-state Ion-selective Electrodes (ASSISE) for Physiological Research

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) that can withstand prolonged storage in complex biological media 1-4. An all-solid-state ion-selective-electrode (ASSISE) is especially attractive for the aforementioned applications. The electrode should have the following favorable characteristics: easy construction, low maintenance, and (potential for) miniaturization, allowing for batch processing. A microfabricated ASSISE intended for quantifying H+, Ca2+, and CO32- ions was constructed. It consists of a noble-metal electrode layer (i.e. Pt), a transduction layer, and an ion-selective membrane (ISM) layer. The transduction layer functions to transduce the concentration-dependent chemical potential of the ion-selective membrane into a measurable electrical signal.
The lifetime of an ASSISE is found to depend on maintaining the potential at the conductive layer/membrane interface 5-7. To extend the ASSISE working lifetime and thereby maintain stable potentials at the interfacial layers, we utilized the conductive polymer (CP) poly(3,4-ethylenedioxythiophene) (PEDOT) 7-9 in place of silver/silver chloride (Ag/AgCl) as the transducer layer. We constructed the ASSISE in a lab-on-a-chip format, which we called the multi-analyte biochip (MAB) (Figure 1).
Calibrations in test solutions demonstrated that the MAB can monitor pH (operational range pH 4-9), CO32- (measured range 0.01 mM - 1 mM), and Ca2+ (log-linear range 0.01 mM to 1 mM). The MAB for pH provides a near-Nernstian slope response after almost one month storage in algal medium. The carbonate biochips show a potentiometric profile similar to that of a conventional ion-selective electrode. Physiological measurements were employed to monitor biological activity of the model system, the microalga Chlorella vulgaris.
The MAB conveys an advantage in size, versatility, and multiplexed analyte sensing capability, making it applicable to many confined monitoring situations, on Earth or in space.
Biochip Design and Experimental Methods
The biochip is 10 x 11 mm in dimension and has 9 ASSISEs designated as working electrodes (WEs) and 5 Ag/AgCl reference electrodes (REs). Each working electrode (WE) is 240 &mu;m in diameter and is equally spaced at 1.4 mm from the REs, which are 480 &mu;m in diameter. These electrodes are connected to electrical contact pads with a dimension of 0.5 mm x 0.5 mm. The schematic is shown in Figure 2.
Cyclic voltammetry (CV) and galvanostatic deposition methods are used to electropolymerize the PEDOT films using a Bioanalytical Systems Inc. (BASI) C3 cell stand (Figure 3). The counter-ion for the PEDOT film is tailored to suit the analyte ion of interest. A PEDOT with poly(styrenesulfonate) counter ion (PEDOT/PSS) is utilized for H+ and CO32-, while one with sulphate (added to the solution as CaSO4) is utilized for Ca2+. The electrochemical properties of the PEDOT-coated WE is analyzed using CVs in redox-active solution (i.e. 2 mM potassium ferricyanide (K3Fe(CN)6)). Based on the CV profile, Randles-Sevcik analysis was used to determine the effective surface area 10. Spin-coating at 1,500 rpm is used to cast ~2 &mu;m thick ion-selective membranes (ISMs) on the MAB working electrodes (WEs).
The MAB is contained in a microfluidic flow-cell chamber filled with a 150 &mu;l volume of algal medium; the contact pads are electrically connected to the BASI system (Figure 4). The photosynthetic activity of Chlorella vulgaris is monitored in ambient light and dark conditions.

Multi-analyte Biochip MAB Based on All-solid-state Ion-selective Electrodes ASSISE for Physiological Research

All-solid-state ion-selective electrodes (ASSISEs) constructed from a conductive polymer (CP) transducer provide several months of functional lifetime in liquid media. Here, we describe the fabrication and calibration process of ASSISEs in a lab-on-a-chip format. The ASSISE is demonstrated to have maintained a near-Nernstian slope profile after prolonged storage in complex biological media.

Biochip Multi-אנליטי (MAB) על בסיס אלקטרודות יון-All-סלקטיבית של מצב מוצק (ASSISE) למחקר הפיזיולוגי

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) ...

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans' Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and pathways as well as its ease of cultivation. Several C. elegans disease models have been reported, including neurodegenerative disorders such as Parkinson's disease (PD), which involves the degeneration of dopaminergic (DA) neurons 1. Both transgenes and neurotoxic chemicals have been used to induce DA neurodegeneration and consequent movement defects in worms, allowing for investigations into the basis of neurodegeneration and screens for neuroprotective genes and compounds 2,3.
Screens in lower eukaryotes like C. elegans provide an efficient and economical means to identify compounds and genes affecting neuronal signaling. Conventional screens are typically performed manually and scored by visual inspection; consequently, they are time-consuming and prone to human errors. Additionally, most focus on cellular level analysis while ignoring locomotion, which is an especially important parameter for movement disorders.
We have developed a novel microfluidic screening system (Figure 1) that controls and quantifies C. elegans' locomotion using electric field stimuli inside microchannels. We have shown that a Direct Current (DC) field can robustly induce on-demand locomotion towards the cathode ("electrotaxis") 4. Reversing the field's polarity causes the worm to quickly reverse its direction as well. We have also shown that defects in dopaminergic and other sensory neurons alter the swimming response 5. Therefore, abnormalities in neuronal signaling can be determined using locomotion as a read-out. The movement response can be accurately quantified using a range of parameters such as swimming speed, body bending frequency and reversal time.
Our work has revealed that the electrotactic response varies with age. Specifically, young adults respond to a lower range of electric fields and move faster compared to larvae 4. These findings led us to design a new microfluidic device to passively sort worms by age and phenotype 6.
We have also tested the response of worms to pulsed DC and Alternating Current (AC) electric fields. Pulsed DC fields of various duty cycles effectively generated electrotaxis in both C. elegans and its cousin C. briggsae 7. In another experiment, symmetrical AC fields with frequencies ranging from 1 Hz to 3 KHz immobilized worms inside the channel 8.
Implementation of the electric field in a microfluidic environment enables rapid and automated execution of the electrotaxis assay. This approach promises to facilitate high-throughput genetic and chemical screens for factors affecting neuronal function and viability.

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans&#039; Locomotion

A semi-automated micro-electro-fluidic method to induce on-demand locomotion in Caenorhabditis elegans is described. This method is based on the neurophysiologic phenomenon of worms responding to mild electric fields (&#x201C;electrotaxis&#x201D;) inside microfluidic channels. Microfluidic electrotaxis serves as a rapid, sensitive, low-cost, and scalable technique to screen for factors affecting neuronal health.

Electrotaxis מבוסס microfluidic לניתוח כמותי על פי דרישה של<em&gt; Elegans Caenorhabditis</em&gt; &#39;נידות

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and ...

Use of Label-free Optical Biosensors to Detect Modulation of Potassium Channels by G-protein Coupled Receptors

Ion channels control the electrical properties of neurons and other excitable cell types by selectively allowing ions to flow through the plasma membrane1. To regulate neuronal excitability, the biophysical properties of ion channels are modified by signaling proteins and molecules, which often bind to the channels themselves to form a heteromeric channel complex2,3. Traditional assays examining the interaction between channels and regulatory proteins require exogenous labels that can potentially alter the protein&#39;s behavior and decrease the physiological relevance of the target, while providing little information on the time course of interactions in living cells. Optical biosensors, such as the X-BODY Biosciences BIND Scanner system, use a novel label-free technology, resonance wavelength grating (RWG) optical biosensors, to detect changes in resonant reflected light near the biosensor. This assay allows the detection of the relative change in mass within the bottom portion of living cells adherent to the biosensor surface resulting from ligand induced changes in cell adhesion and spreading, toxicity, proliferation, and changes in protein-protein interactions near the plasma membrane. RWG optical biosensors have been used to detect changes in mass near the plasma membrane of cells following activation of G protein-coupled receptors (GPCRs), receptor tyrosine kinases, and other cell surface receptors. Ligand-induced changes in ion channel-protein interactions can also be studied using this assay. In this paper, we will describe the experimental procedure used to detect the modulation of Slack-B sodium-activated potassium (KNa) channels by GPCRs.

Optical biosensor techniques can detect changes in mass near the plasma membrane in living cells and allow one to follow cellular responses in both individual cells and populations of cells. This protocol will describe detection of the modulation of potassium channels by G-protein coupled receptors in intact cells using this approach.

שימוש בBiosensors האופטי ללא תווית לזיהוי מודולציה של תעלות אשלגן על ידי קולטנים מצמידים G-חלבון

Ion channels control the electrical properties of neurons and other excitable cell types by selectively allowing ions to flow through the plasma ...

A Label-free Technique for the Spatio-temporal Imaging of Single Cell Secretions

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning of such signaling can lead to many disorders. To understand cell-to-cell signaling, it is essential to study the spatial and temporal nature of the secreted molecules from the cell without disturbing the local environment. Various assays have been developed to study protein secretion, however, these methods are typically based on fluorescent probes which disrupt the relevant signaling pathways. To overcome this limitation, a label-free technique is required.
In this paper, we describe the fabrication and application of a label-free localized surface plasmon resonance imaging (LSPRi) technology capable of detecting protein secretions from a single cell. The plasmonic nanostructures are lithographically patterned onto a standard glass coverslip and can be excited using visible light on commercially available light microscopes. Only a small fraction of the coverslip is covered by the nanostructures and hence this technique is well suited for combining common techniques such as fluorescence and bright-field imaging.
A multidisciplinary approach is used in this protocol which incorporates sensor nanofabrication and subsequent biofunctionalization, binding kinetics characterization of ligand and analyte, the integration of the chip and live cells, and the analysis of the measured signal. As a whole, this technology enables a general label-free approach towards mapping cellular secretions and correlating them with the responses of nearby cells.

Inter-cellular communication is critical for controlling various physiological activities within and outside the cell. This paper describes a protocol for measuring the spatio-temporal nature of single cell secretions. To achieve this, a multidisciplinary approach is used which integrates label-free nanoplasmonic sensing with live cell imaging.

טכניקה ללא תווית להדמית החלל-הזמן של פרשות תא בודדת

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning ...

Label-free Single Molecule Detection Using Microtoroid Optical Resonators

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental studies on the behavior of molecules. Single molecule detection techniques commonly utilize labels such as fluorescent tags or quantum dots, however, labels are not always available, increase cost and complexity, and can perturb the events being studied. Optical resonators have emerged as a promising means to detect single molecules without the use of labels. Currently the smallest particle detected by a non-plasmonically-enhanced bare optical resonator system in solution is a 25 nm polystyrene sphere1. We have developed a technique known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that can surpass this limit and achieve label-free single molecule detection in aqueous solution2. As signal strength scales with particle volume, our work represents a &#62; 100x improvement in the signal to noise ratio (SNR) over the current state of the art. Here the procedures behind FLOWER are presented in an effort to increase its usage in the field.

We have developed a label-free biosensing system based on optical resonator technology known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that is capable of detecting single molecules in solution. Here the procedures behind this work are described and presented.

ללא תווית מולקולה בודדת איתור באמצעות תהודה אופטית Microtoroid

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental ...