تم دعم هذا العمل جزئيا من قبل شبكة جائزة رود آيلاند للتطوير المؤسسي (IDeA) للتميز في البحوث الطبية الحيوية من المعهد الوطني للعلوم الطبية العامة التابع للمعاهد الوطنية للصحة بموجب المنحة رقم P20GM103430 ومركز براينت للصحة والعلوم السلوكية.

التقاط شكل الكروموسوم (3C) للبحث والتدريس الجامعي

<ol>
	<li>McBryant, S. J., Adams, V. H., Hansen, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+architectural+proteins.">Chromatin architectural proteins.</a> Chromosome Research. 14 (1), 39-51 (2006).</li><li>Nalabothula, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chromatin+architectural+proteins+HMGD1+and+H1+bind+reciprocally+and+have+opposite+effects+on+chromatin+structure+and+gene+regulation.">The chromatin architectural proteins HMGD1 and H1 bind reciprocally and have opposite effects on chromatin structure and gene regulation.</a> BMC Genomics. 15, 92 (2014).</li><li>John, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+accessibility+pre-determines+glucocorticoid+receptor+binding+patterns.">Chromatin accessibility pre-determines glucocorticoid receptor binding patterns.</a> Nature Genetics. 43 (3), 264-268 (2011).</li><li>Fawcett, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+occurrence+of+a+fibrous+lamina+on+the+inner+aspect+of+the+nuclear+envelope+in+certain+cells+of+vertebrates.">On the occurrence of a fibrous lamina on the inner aspect of the nuclear envelope in certain cells of vertebrates.</a> The American Journal of Anatomy. 119 (1), 129-145 (1966).</li><li>Reddy, K. L., Zullo, J. M., Bertolino, E., Singh, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+repression+mediated+by+repositioning+of+genes+to+the+nuclear+lamina.">Transcriptional repression mediated by repositioning of genes to the nuclear lamina.</a> Nature. 452 (7184), 243-247 (2008).</li><li>Finlan, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+to+the+nuclear+periphery+can+alter+expression+of+genes+in+human+cells.">Recruitment to the nuclear periphery can alter expression of genes in human cells.</a> PLoS Genetics. 4 (3), e1000039 (2008).</li><li>Chambeyron, S., Da Silva, N. R., Lawson, K. A., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+re-organisation+of+the+Hoxb+complex+during+mouse+embryonic+development.">Nuclear re-organisation of the Hoxb complex during mouse embryonic development.</a> Development. 132 (9), 2215-2223 (2005).</li><li>Chambeyron, S., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+decondensation+and+nuclear+reorganization+of+the+HoxB+locus+upon+induction+of+transcription.">Chromatin decondensation and nuclear reorganization of the HoxB locus upon induction of transcription.</a> Genes and Development. 18 (10), 1119-1130 (2004).</li><li>Mahy, N. L., Perry, P. E., Gilchrist, S., Baldock, R. A., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+organization+of+active+and+inactive+genes+and+noncoding+DNA+within+chromosome+territories.">Spatial organization of active and inactive genes and noncoding DNA within chromosome territories.</a> The Journal of Cell Biology. 157 (4), 579-589 (2002).</li><li>Mahy, N. L., Perry, P. E., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+density+and+transcription+influence+the+localization+of+chromatin+outside+of+chromosome+territories+detectable+by+FISH.">Gene density and transcription influence the localization of chromatin outside of chromosome territories detectable by FISH.</a> The Journal of Cell Biology. 159 (5), 753-763 (2002).</li><li>Li, B., Carey, M., Workman, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+chromatin+during+transcription.">The role of chromatin during transcription.</a> Cell. 128 (4), 707-719 (2007).</li><li>Chen, A., Chen, D., Chen, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+of+DNase-seq+for+mapping+active+gene+regulatory+elements+across+the+genome+in+animals.">Advances of DNase-seq for mapping active gene regulatory elements across the genome in animals.</a> Gene. 667, 83-94 (2018).</li><li>Hughes, A. L., Rando, O. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+underlying+nucleosome+positioning+in+vivo.">Mechanisms underlying nucleosome positioning in vivo.</a> Annual Review of Biophysics. 43, 41-63 (2014).</li><li>Weiner, A., Hughes, A., Yassour, M., Rando, O. J., Friedman, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+nucleosome+mapping+reveals+transcription-dependent+promoter+packaging.">High-resolution nucleosome mapping reveals transcription-dependent promoter packaging.</a> Genome Research. 20 (1), 90-100 (2010).</li><li>Hughes, A. L., Jin, Y., Rando, O. J., Struhl, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functional+evolutionary+approach+to+identify+determinants+of+nucleosome+positioning:+A+unifying+model+for+establishing+the+genome-wide+pattern.">A functional evolutionary approach to identify determinants of nucleosome positioning: A unifying model for establishing the genome-wide pattern.</a> Molecular Cell. 48 (1), 5-15 (2012).</li><li>Dekker, J., Rippe, K., Dekker, M., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+chromosome+conformation.">Capturing chromosome conformation.</a> Science. 295 (5558), 1306-1311 (2002).</li><li>van Berkum, N. L., Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+spatial+chromatin+organization+of+large+genomic+regions+using+5C+technology.">Determining spatial chromatin organization of large genomic regions using 5C technology.</a> Methods in Molecular Biology. 567, 189-213 (2009).</li><li>Smith, E. M., Lajoie, B. R., Jain, G., Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invariant+TAD+boundaries+constrain+cell-type-specific+looping+interactions+between+promoters+and+distal+elements+around+the+CFTR+locus.">Invariant TAD boundaries constrain cell-type-specific looping interactions between promoters and distal elements around the CFTR locus.</a> American Journal of Human Genetics. 98 (1), 185-201 (2016).</li><li>Crane, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+inputs+into+C.+elegans+dosage+compensation:+Chromosome+conformation+and+the+miRNA-specific+argonaute+ALG-2.">Two inputs into C. elegans dosage compensation: Chromosome conformation and the miRNA-specific argonaute ALG-2.</a> University of California, Berkeley. , (2012).</li><li>Bell, A. C., West, A. G., Felsenfeld, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+protein+CTCF+is+required+for+the+enhancer+blocking+activity+of+vertebrate+insulators.">The protein CTCF is required for the enhancer blocking activity of vertebrate insulators.</a> Cell. 98 (3), 387-396 (1999).</li><li>Cuadrado, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+contributions+of+cohesin-SA1+and+cohesin-SA2+to+TADs+and+polycomb+domains+in+embryonic+stem+cells.">Specific contributions of cohesin-SA1 and cohesin-SA2 to TADs and polycomb domains in embryonic stem cells.</a> Cell Reports. 27 (12), 3500-3510 (2019).</li><li>Sarro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disrupting+the+three-dimensional+regulatory+topology+of+the+Pitx1+locus+results+in+overtly+normal+development.">Disrupting the three-dimensional regulatory topology of the Pitx1 locus results in overtly normal development.</a> Development. 145 (7), (2018).</li><li>Tolhuis, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+among+polycomb+domains+are+guided+by+chromosome+architecture.">Interactions among polycomb domains are guided by chromosome architecture.</a> PLoS Genetics. 7 (3), e1001343 (2011).</li><li>Splinter, E., de Wit, E., van de Werken, H. J. G., Klous, P., de Laat, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+long-range+chromatin+interactions+for+selected+genomic+sites+using+4C-seq+technology:+From+fixation+to+computation.">Determining long-range chromatin interactions for selected genomic sites using 4C-seq technology: From fixation to computation.</a> Methods. 58 (3), 221-230 (2012).</li><li>Fern&#225;ndez-Mi&#241;&#225;n, A., Bessa, J., Tena, J. J., G&#243;mez-Skarmeta, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+21+-+Assay+for+transposase-accessible+chromatin+and+circularized+chromosome+conformation+capture,+two+methods+to+explore+the+regulatory+landscapes+of+genes+in+zebrafish.">Chapter 21 - Assay for transposase-accessible chromatin and circularized chromosome conformation capture, two methods to explore the regulatory landscapes of genes in zebrafish.</a> Methods in Cell Biology. 135, 413-430 (2016).</li><li>Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+three+&amp;#34;C&amp;#34;+s+of+chromosome+conformation+capture:+controls,+controls,+controls.">The three &amp;#34;C&amp;#34; s of chromosome conformation capture: controls, controls, controls.</a> Nature Methods. 3 (1), 17-21 (2006).</li><li>Hag&#232;ge, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+chromosome+conformation+capture+assays+(3C-qPCR).">Quantitative analysis of chromosome conformation capture assays (3C-qPCR).</a> Nature Protocols. 2 (7), 1722-1733 (2007).</li><li>Lajoie, B. R., van Berkum, N. L., Sanyal, A., Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=My5C:+Webtools+for+chromosome+conformation+capture+studies.">My5C: Webtools for chromosome conformation capture studies.</a> Nature Methods. 6 (10), 690-691 (2009).</li><li>Han, M., Wei, G., McManus, C. E., Hillier, L. W., Reinke, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolated+C.+elegans+germ+nuclei+exhibit+distinct+genomic+profiles+of+histone+modification+and+gene+expression.">Isolated C. elegans germ nuclei exhibit distinct genomic profiles of histone modification and gene expression.</a> BMC Genomics. 20 (1), 500 (2019).</li></ol>

يعلن أصحاب البلاغ عدم وجود تضارب في المصالح.

3C هي تقنية قوية متجذرة في التقنيات الجزيئية الأساسية. هذا هو أساس الأدوات الأساسية التي تجعل 3C تقنية مثيرة للاهتمام لاستخدامها مع الطلاب الجامعيين. مع وجود العديد من الدراسات الحديثة التي تراقب ديناميكيات الكروماتين على هذا النطاق الواسع ، فإن استخدام هذه النتائج لابتكار تجربة ضيقة التركيز على جين واحد أو منطقة جينومية واحدة لديه القدرة على إنشاء تجربة فريدة ومؤثرة في الأبحاث الجامعية. في كثير من الأحيان ، تعتبر مثل هذه التجارب متقدمة جدا بالنسبة للطلاب الجامعيين ، ولكن مع التخطيط الدقيق ، يمكن تحقيقها بسهولة. من المهم ملاحظة أن المقايسات المصممة لفحص اتصالات الكروماتين التي تم التقاطها بواسطة مكتبة 3C يمكن أن تختلف من تفاعل البوليميراز المتسلسل شبه الكمي لنقطة النهاية إلى تسلسل الجينوم الكامل. في الواقع ، تم إنشاء بيانات من أول ورقة 3C16 من qPCR. يمكن استخدام هذه المجموعة الواسعة من المقايسات لأن جميع تقنيات 3C تنتج نفس المنتج - مكتبة من شظايا الحمض النووي التي تمثل اتصالات ثلاثية الأبعاد في النواة.
يظهر هنا تكييف لبروتوكول أكثر مرونة واستيعابا يناسب الباحثين الجامعيين بشكل أفضل. فترات التوقف المذكورة أعلاه تعني تأخيرات بين عشية وضحاها. ومع ذلك ، يمكن أن تمتد هذه التوقفات خلال عطلات نهاية الأسبوع ، وفي حالة الخلايا والنوى ، لأسابيع. الاعتبار الأكثر أهمية هو متى سيتم إنجاز العمل. في كثير من الأحيان في البروتوكولات ، هناك خطوات حساسة للوقت عندما لا يكون الإيقاف المؤقت خيارا. خارج بضع نقاط (اليوم 1 واليوم 2) ، هناك العديد من الأماكن لإيقاف العينة وتجميدها. هذه أمر بالغ الأهمية عند العمل مع الطلاب الجامعيين حيث يجب أن تكون جداول وتوقيت العمل المخبري مرنة. بالإضافة إلى هندسة هذه التوقفات في البروتوكول ، يتم تشجيع الطلاب الجامعيين على العمل في أزواج أو حتى مجموعات صغيرة من ثلاثة أو أربعة. تعمل المجموعات بشكل جيد لهذا البروتوكول ، حيث يمكن للطلاب دعم بعضهم البعض وإنشاء نظام أصدقاء حتى يعمل الجميع بأمان. العمل في المختبر هو أيضا أكثر متعة مع الآخرين المعنيين. مع المجموعات ، يمكن للطلاب أيضا العمل على مجموعة متنوعة من الأسئلة التي تركز على تنظيم الكروماتين مع الاستمرار في تنفيذ نفس البروتوكول. وبالتالي ، حتى أثناء عمل الطلاب في مشاريع منفصلة ، يربط البروتوكول جهودهم ، ولهذا السبب ، يمكنهم دعم بعضهم البعض.
تهدف التعديلات الأخرى إلى التغلب على حقيقة أن بعض الأدوات والمعدات المتخصصة لا توجد بالضرورة في جميع المؤسسات الجامعية. تشمل هذه القطع من المعدات على سبيل المثال لا الحصر أجهزة التدوير الحراري qPCR وأنظمة توثيق الهلام ومطياف حجم النانو. في الواقع ، هذه القطع من المعدات مريحة ولكنها ليست شرطا. هنا ، يتم وصف الطريقة الكلاسيكية ل 3C أيضا في جزء التصميم التمهيدي ؛ يتضمن ذلك تحديد موضع الاهتمام الجينومي ، ومن ثم تقييم المواقع الجينومية الأخرى لنقاط اتصال الكروماتين البعيدة. تعمل هذه التقنية أيضا بشكل جيد إذا تم استخدام مجموعة بيانات منشورة ، مثل مجموعة بيانات تستخدم Hi-C ، حيث يتم تحديد المواقع الإيجابية (المتصلة) والسالبة (غير المتصلة) المعروفة. يعد تصميم التجارب باستخدام مجموعات البيانات المنشورة هذه تكيفا رائعا آخر لمختبرات التدريس ، حيث أن فرصة التعرف الناجح على اتصالات الكروماتين عادة ما تكون أكبر. بالإضافة إلى ذلك ، يمكن مناقشة المقالة البحثية في الفصل واستخدامها كمرجع.
يستخدم هذا البروتوكول نهج qPCR المعدل لتصور تكوين منتج 3C. الضوابط ضرورية لنجاح تقنية 3C. تستخدم كل تجربة كلا من عناصر التحكم في العينة وعناصر التحكم التمهيدية لتحديد اكتمال إجراء 3C. تتضمن عناصر التحكم في العينة عنصر تحكم غير مهضوم (الحمض النووي الجينومي) والتحكم المهضوم. يحدد التحكم غير المهضوم إشارة خط الأساس لمجموعات التمهيدي ويستخدم مع التحكم في الهضم المتقاطع لتحديد كفاءة الهضم من المتوقع أن يكون هناك انخفاض في المنتج لأي بادئات موجهة عبر موقع التقييد. توفر مقارنة هذه القيمة بعنصر التحكم غير المهضوم مؤشرا على مدى جودة هضم العينة.
تشتمل البادئات الخاصة ب PCR على برايمر تحكم وبرايمر اختبار. التمهيدي للتحكم عبارة عن مجموعة أولية تقع بالقرب من المنطقة الجينومية التي يتم فحصها ولا تحتوي على موقع تقييد. يوفر هذا خط الأساس لتحديد وفرة منتجات اختبار PCR التمهيدي. بادئات الاختبار عبارة عن بادئات أمامية وخلفية تحيط بموقع تقييد لموضع اهتمام جينومي معين (الشكل 3). تتم مقارنة التفاعلات باستخدام مجموعات التمهيدي هذه لتحديد كفاءة الهضم ، حيث يجب أن تنخفض وفرة المنتج إذا تم قطع موقع التقييد. عند تحديد تنظيم الكروماتين ، يتم إقران اختبار تمهيدي واحد من موضع واحد مع اختبار تمهيدي آخر من موضع جينومي مختلف لتحديد ما إذا كان هذان الموقعان قريبان من بعضهما البعض في مساحة 3D. في هذه الحالة ، من المتوقع أن يتم العثور على منتج PCR فقط باستخدام عينة 3C كنموذج.
من المهم ملاحظة أنه حتى البادئات التي تم التحقق من صحتها تميل إلى الفشل (الشكل 4: مجموعة التمهيدي r14). بالإضافة إلى ذلك ، يتم تحديد منتجات تفاعل البوليميراز المتسلسل بشكل متكرر في تفاعلات التحكم وفي التفاعلات التي لا يتم فيها التنبؤ باتصال الكروماتين (مثل التحكم المهضوم ، لأنه غير مرتبط). يتم تسلسل هذه الحالات وإما تفشل Sanger QC أو تعود بدون تسلسل محدد (الشكل 5). بالإضافة إلى ذلك ، تولد تجارب 3C التقليدية "قالب تحكم" ، وهو عينة من الحمض النووي غير مترابطة ومهضومة ومربوطة ، والتي تمثل جميع الأجزاء المربوطة المحتملة التي يمكن إنتاجها بكمية معينة من الحمض النووي. يلعب "قالب التحكم" دورا مهما في مقارنة شدة إشارات qPCR بين موقعين جينوميين لتحديد ما إذا كانت الإشارة تمثل تفاعلا حقيقيا أم مجرد ارتباط عشوائي. قد يكون إنشاء "قالب تحكم" مشكلة ، حيث يجب التقاط جزء كبير من الكروماتين الذي يتم فحصه في شكل كروموسوم اصطناعي ومعالجته مع عينات 3C. قد لا يكون تأمين مثل هذا البناء ممكنا ، وقد يكون إنشاء واحد خارج نطاق مشروع الفصل الدراسي. بسبب هذه الصعوبات ، نقترح استخدام التمهيدي التحكم. لا يحل التمهيدي للتحكم محل جميع وظائف "قالب التحكم" ولكنه لا يزال يوفر الفرصة لتحليل البيانات لاتخاذ قرارات "الحضور" أو "الغياب".
عند إجراء qPCR ، من المهم استخدام كميات متساوية من العينة. يجب تحديد ذلك ، حتى لو كان يستخدم مقياس الطيف الضوئي النانوي مثل nanodrop ، عن طريق توليد منحنى قياسي من الحمض النووي الجينومي بتركيز معروف وتركيب عينات 3C على هذا الخط. يجب تسجيل هذه المبالغ واستخدامها في PCRs اللاحقة. جودة تفاعل PCR مهمة أيضا. نظرا لأن تفاعل البوليميراز المتسلسل يعمل في qPCR ، يتم قياس وفرة المنتج باستخدام مضان وتسجيله. يمكن الوصول إلى هذا التسجيل في مخطط التضخيم. بمجرد انتهاء البرنامج ، من المهم التحقق من مخطط التضخيم والتأكد من أن التفاعلات (باستثناء عناصر التحكم في عدم وجود قالب) لها ثلاث مراحل: خط الأساس ، والأسي ، ومرحلة الهضبة / التشبع. من المهم التحقق من أن ردود الفعل لها مرحلة أسية ، خاصة لتحديد العتبة (انظر أدناه). بالإضافة إلى ذلك ، بالنسبة للعينات المخففة بشكل متسلسل ، يجب أن يكون هناك تحول في قيم Ct بما يتفق مع تخفيف العينة (سيكون لأعلى تركيز أدنى قيم Ct ، بينما سيكون للتركيز الأدنى أعلى قيم Ct). تتطلب العينات التي لا تعكس هذا التغيير في مخطط التضخيم تخفيفا جديدا أو تشير إلى مشكلة أكبر في تكوين عينة 3C. أخيرا ، أثناء إنشاء المنحنى القياسي ، سيحسب برنامج PCR كفاءة PCR وقيمة R2 . يجب أن تكون كفاءة PCR أكبر من 90٪ ، ويجب أن تكون قيمة R2 أكبر من 0.99. إذا لم يتم استيفاء أي من هذه الشروط ، فمن المحتمل أن يكون هناك خطأ ما في العينة أو بادئات تفاعل البوليميراز المتسلسل.
بعد qPCR ، يمكن حساب النسبة المئوية للهضم ووجود تفاعلات 3C باستخدام qPCR Ct لكل تفاعل. لتحديد هذه ، أولا ، يجب تعيين عتبة تفاعل PCR. يتم ذلك عادة باستخدام البرنامج الذي يأتي مع جهاز qPCR. سيحدد تحديد العتبة تركيز منتج تفاعل البوليميراز المتسلسل الذي سيتم استخدامه لمقارنة قيم عينة Ct. يجب أن تقسم العتبة منحنيات التضخيم لتفاعلات تفاعل البوليميراز المتسلسل في المرحلة الأسية للتضخيم. يمكن مقارنة تفاعلات تفاعل البوليميراز المتسلسل فقط مع التضخيم الأسي (في هذه الحالة ، بادئات التحكم وتفاعلات الاختبار التمهيدي) ، لأن هذه هي الطريقة الوحيدة للتأكد من أن التفاعلات تضخم الحمض النووي بنفس المعدل ويمكن مقارنتها بأمانة. عند تحليل الرسوم البيانية 3C ، يتم تحديد التفاعلات الإيجابية المشروطة على أنها تلك التي تحتوي على المزيد من المنتج على عينات التحكم ، والتحكم الجيني ، والتحكم في الهضم (الشكل 4B). ومع ذلك ، يجب التحقق من صحة هذه العينات باستخدام تسلسل سانجر بعد تنقية الهلام لمنتج تفاعل البوليميراز المتسلسل.
بعد تسلسل سانجر ، يمكن تحليل العينات التي تجتاز مراقبة الجودة باستخدام Blat. الهدف من هذا التحليل هو تحديد ما إذا كانت العينة تحتوي على تسلسل كل من المواقع الجينومية المستهدفة المحيطة بموقع التقييد (DpnII في حالة هذا البروتوكول). إذا تم تحديد كلا التسلسلين ، فيمكن اعتبار جزء 3C مصدقا عليه. إذا لم ترجع نتائج Blat التسلسل المتوقع ، فقد يشير ذلك إلى أن أحد البادئات أو كليهما ليس هو الأمثل ، مما يؤدي إلى نتيجة qPCR إيجابية خاطئة. ستحتوي ملفات التتبع للعينات الإيجابية الخاطئة على قمم أساسية غير محددة ، وستحتوي تقارير Seq في الغالب على استدعاءات أساسية "n".
يعد التحقق من صحة سانجر أمرا ضروريا ، حيث يمكن الحصول على إيجابيات خاطئة من تكوين منتج تفاعل البوليميراز المتسلسل الأثري. يمكن تحديد هذه الإيجابيات الخاطئة عندما لا تحتوي منتجات التسلسل على التسلسل المستهدف المتوقع أو خاصية موقع DpnII لجزء 3C مناسب (الشكل 5). يوفر تسلسل شظايا تفاعل البوليميراز المتسلسل أيضا نقطة بيانات أخرى للتجربة ويدفع الطلاب إلى أن تقنية 3C تحدد المواقع الجينومية البعيدة التي تتجمع في الفضاء ثلاثي الأبعاد داخل النوى.
توفر تقنية 3C ثروة من التقنيات الجزيئية الأساسية للطلاب الجامعيين في إجراء مرن ومباشر. تعد تقنية 3C هذه أيضا نقطة انطلاق لتقنيات 3C الأخرى التي تتضمن تسلسل الجيل التالي (NGS). هذه الأنواع من التجارب يمكن أن تعرض الطلاب الجامعيين لجوانب مهمة من المعلوماتية الحيوية وهي متجذرة في المبادئ الأساسية الموضحة هنا. الخبرة الجامعية والمشاركة هي مفتاح نجاحهم وتطورهم كعلماء شباب. من خلال توفير هذه الفرص ، يمكن للطلاب الجامعيين تعزيز فهمهم للمبادئ الأساسية مع بناء ثقتهم في معالجة التقنيات والأسئلة المتطورة.

لا يحتوي جينوم الكائن الحي على جميع الجينات اللازمة للوظيفة فحسب ، بل يحتوي أيضا على جميع التعليمات حول كيفية ووقت استخدامها. هذا يجعل تنظيم الوصول إلى الجينوم أحد أهم وظائف الخلية. هناك العديد من الآليات للتحكم في وظيفة الجينات. ومع ذلك ، في مستواه الأساسي ، يعود تنظيم الجينات إلى قدرة عوامل النسخ التنظيمية (العوامل العابرة) على الارتباط بتسلسلات الحمض النووي المحددة (تسلسلات رابطة الدول المستقلة التنظيمية). هذه ليست قدرة فطرية. بدلا من ذلك ، يحكمها تنظيم / هيكل الجينوم في النواة ، والذي يتحكم في توافر / تعرض التسلسلات التنظيمية لرابطة الدول المستقلة للعواملالعابرة 1،2،3. إذا لم تتمكن العوامل العابرة من العثور على تسلسلاتها التنظيمية لرابطة الدول المستقلة ، فلن تتمكن العوامل العابرة من أداء مهامها التنظيمية. وقد جعل هذا فهم كيفية تنظيم الجينوم في النواة مصدرا مهما للبحث.
من المقبول على نطاق واسع أنه خلال الطور البيني ، تحتل الكروموسومات حقيقية النواة في النواة مجالها الخاص المرتبط بالصفيحة النووية والمصفوفة النووية (الشكل 1) ، مما يجعل الكروموسوم أشبه بشريحة من البيتزا ، بدلا من المعكرونة على طبق من السباغيتي. تتكثف الكروموسومات جزئيا عن طريق تفاعلات البروتين والحمض النووي (الكروماتين) التي تلتف وتدور أجزاء من الكروموسوم. من خلال المجهر الإلكتروني ، ومضان الحمض النووي ثلاثي الأبعاد في التهجين الموضعي (FISH) ، وتقنيات وضع علامات الحمض النووي (أي مثيلة الحمض النووي الفلورية والاصطناعية) ، تم العثور على مجالات غير نشطة من الكروماتين معبأة بإحكام على طول المحيط النووي4،5،6 ، بينما توجد أجزاء من الكروماتين النشط الأقل كثافة في داخل النواة7،8،9 ، 10. توفر هذه التجارب رؤية واسعة الزاوية لديناميكيات الكروموسومات ولكنها لا تفعل الكثير لالتقاط التغييرات التي تحدث محليا حول المحفزات الجينية التي لوحظت في دراسات DNase11,12 و nucleosome13,14,15.
كان المفتاح لفتح ديناميكيات الكروماتين عالية الدقة هو صياغة تقنية رسم خرائط الكروموسوم ثلاثي الأبعاد ، 3C. تتكون تقنية 3C نفسها من أربع خطوات رئيسية: تشابك الكروماتين ، وهضم الكروماتين عن طريق إنزيمات التقييد ، وربط الكروماتين ، وتنقية الحمض النووي (الشكل 2). يمكن بعد ذلك توصيف شظايا الحمض النووي الاصطناعي الجديدة الناتجة عن هذه العملية للكشف عن الارتباط الفيزيائي الوثيق بين القطع البعيدة خطيا من الحمض النووي16. أصبحت تقنية 3C الأساس لإنشاء تقنيات عرضية متعددة تستخدم الخطوات الأولية ل 3C لطرح أسئلة أوسع على مستوى الجينوم (على سبيل المثال ، Hi-C ، 4C ، ChIP-C). حددت هذه العائلة من تقنيات 3C أن الكروموسومات يتم تنظيمها في وحدات منفصلة متعددة تسمى المجالات المرتبطة طوبولوجيا (TADs). يتم ترميز TADs في الجينوم ويتم تعريفها بواسطة حلقات الكروماتين المحاطة بحدود غير حلقية16،17،18،19. يتم الحفاظ على حدود TAD من خلال عاملين محفوظين تطوريا ومنتشرين في كل مكان ، بما في ذلك عامل ربط CCCT (CTCF) والتماسك ، مما يمنع الحلقات داخل TADs المنفصلة من التفاعل16،20. يتم التوسط في الحلقات من خلال تفاعل العوامل العابرة مع تسلسلاتها التنظيمية ، وكذلك CTCF والتماسك21.
على الرغم من أن العديد من الدراسات التي تستخدم تقنيات 3C تطرح أسئلة واسعة على مستوى الجينوم وتستخدم تقنيات معقدة لجمع العينات ، فإن صياغة تقنية 3C تعتمد على تقنيات البيولوجيا الجزيئية الأساسية. هذا يجعل 3C مثيرة للاهتمام للنشر في كل من مختبرات البحث والتدريس الجامعية. يمكن استخدام تقنية 3C للأسئلة الأصغر تركيزا وهي مرنة بطبيعتها للتوسع أو التقليل (الجينات المفردة22 والكروموسومات16 و / أو الجينوم18) اعتمادا على تركيز واتجاه الأسئلة المطروحة. تم تطبيق هذه التقنية أيضا على مجموعة واسعة من الأنظمة النموذجية7،16،19،23 وقد ثبت أنها متعددة الاستخدامات في استخدامها. هذا يجعل 3C تقنية ممتازة للطلاب الجامعيين حيث يمكن للطلاب اكتساب الخبرة في تقنيات البيولوجيا الجزيئية الشائعة مع اكتساب خبرة قيمة في الإجابة على الأسئلة الموجهة.
يظهر هنا بروتوكول مكيف لإعداد مكتبة 3C بناء على البروتوكولات المنشورة مسبقا24،25،26،27. تم تحسين هذا البروتوكول لحوالي 1 × 107 خلايا ، على الرغم من أنه أنشأ مكتبات 3C مع أقل من 1 × 105 خلايا. أثبت هذا البروتوكول أنه متعدد الاستخدامات وقد تم استخدامه لإنشاء مكتبات 3C من أجنة الزرد وخطوط خلايا الزرد والشباب البالغين (YA) Caenorhabditis elegans (الدودة المستديرة). يجب أن يكون البروتوكول مناسبا أيضا لخطوط خلايا الثدييات ، ومع مزيد من التكيف ، الخميرة.
الهدف من هذه التعديلات هو جعل 3C في متناول الطلاب الجامعيين. تم الحرص على استخدام تقنيات مشابهة لتلك التي يمكن تحقيقها في مختبر التدريس الجامعي. توفر تقنية 3C العديد من فرص التعلم للطلاب الجامعيين لتعلم تقنيات البيولوجيا الجزيئية الأساسية التي ستفيد تطورهم على مقاعد البدلاء وفي الفصل الدراسي وفي مساعيهم بعد التخرج.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>37% Formaldehyde&#160;</td>
			<td>Millapore-Sigma</td>
			<td>F8775</td>
			<td></td>
		</tr>
		<tr>
			<td>100% Ethanol</td>
			<td>Millapore-Sigma</td>
			<td>E7023</td>
			<td></td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>MP Biomedical</td>
			<td>215350280</td>
			<td></td>
		</tr>
		<tr>
			<td>chloroform</td>
			<td>Millapore-Sigma</td>
			<td>C0549</td>
			<td></td>
		</tr>
		<tr>
			<td>cOmplete, EDTA-free Protease Inhibitor Cocktail</td>
			<td>Millapore-Sigma</td>
			<td>COEDTAF-RO</td>
			<td>mixed to 50x in water. Diluted to 1x in Sucrose buffer and GB buffer fresh</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>Millapore-Sigma</td>
			<td>D0632</td>
			<td>1 M stock diluted to 500 &#181;M in Sucrose buffer and GB buffer fresh</td>
		</tr>
		<tr>
			<td>DpnII</td>
			<td>NEB</td>
			<td>R0543M</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Millapore-Sigma</td>
			<td>G9012</td>
			<td></td>
		</tr>
		<tr>
			<td>glycine</td>
			<td>Millapore-Sigma</td>
			<td>G8898</td>
			<td></td>
		</tr>
		<tr>
			<td>glycogen</td>
			<td>Millapore-Sigma</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Millapore-Sigma</td>
			<td>H3375</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Millapore-Sigma</td>
			<td>P3911</td>
			<td></td>
		</tr>
		<tr>
			<td>KH2PO4</td>
			<td>Millapore-Sigma</td>
			<td>P5655</td>
			<td></td>
		</tr>
		<tr>
			<td>methyl green pyronin&#160;&#160;</td>
			<td>Millapore-Sigma</td>
			<td>HT70116</td>
			<td></td>
		</tr>
		<tr>
			<td>MgAc2</td>
			<td>Thermoscientific</td>
			<td>1222530</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2HPO4</td>
			<td>Millapore-Sigma</td>
			<td>S5136</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Millapore-Sigma</td>
			<td>S9888</td>
			<td></td>
		</tr>
		<tr>
			<td>phenol-chloroform&#160;</td>
			<td>Millapore-Sigma</td>
			<td>P3803</td>
			<td></td>
		</tr>
		<tr>
			<td>Pronase</td>
			<td>Millapore-Sigma</td>
			<td>11459643001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>IBI Scientific</td>
			<td>IB05406</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR Ready mix (Phire Taq etc)</td>
			<td>Millapore-Sigma</td>
			<td>KCQS07</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase A&#160;</td>
			<td>Millapore-Sigma</td>
			<td>R6148</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Acetate</td>
			<td>Millapore-Sigma</td>
			<td>S2889</td>
			<td></td>
		</tr>
		<tr>
			<td>sodium dodecyl sulfate (SDS)</td>
			<td>Millapore-Sigma</td>
			<td>L3771</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Millapore-Sigma</td>
			<td>S0389</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>Promega</td>
			<td>M1804</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>Millapore-Sigma</td>
			<td>108319</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Millapore-Sigma</td>
			<td>T9284</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin-EDTA&#160;</td>
			<td>Millapore-Sigma</td>
			<td>T4049</td>
			<td></td>
		</tr>
	</tbody>
</table>

getting an a with the 3cs: chromosome conformation capture for undergraduates

التقاط تشكل الكروموسوم (3C) هو أداة قوية أنتجت عائلة من التقنيات المماثلة (على سبيل المثال ، Hi-C و 4C و 5C ، المشار إليها هنا باسم تقنيات 3C) التي توفر معلومات مفصلة عن التنظيم ثلاثي الأبعاد للكروماتين. تم استخدام تقنيات 3C في مجموعة واسعة من الدراسات ، من مراقبة التغيرات في تنظيم الكروماتين في الخلايا السرطانية إلى تحديد جهات الاتصال المحسنة التي تتم مع محفزات الجينات. في حين أن العديد من الدراسات التي تستخدم هذه التقنيات تطرح أسئلة كبيرة على مستوى الجينوم مع أنواع عينات معقدة (أي تحليل خلية واحدة) ، فإن ما يضيع غالبا هو أن تقنيات 3C ترتكز على طرق البيولوجيا الجزيئية الأساسية التي تنطبق على مجموعة واسعة من الدراسات. من خلال معالجة الأسئلة المركزة بإحكام حول تنظيم الكروماتين ، يمكن استخدام هذه التقنية المتطورة لتعزيز تجربة مختبر البحث والتدريس الجامعية. تقدم هذه الورقة بروتوكول 3C وتوفر تعديلات ونقاط تركيز للتنفيذ في المؤسسات الجامعية في المقام الأول في البحث الجامعي وخبرات التدريس.

An organism&#39;s genome not only holds all the genes required for function but also all the instructions on how and when to use them. This makes regulating access to the genome one of the most important functions of the cell. There are many mechanisms to control gene function; however, at its base level, gene regulation comes down to the ability of regulatory transcription factors (trans-factors) to bind to their specific DNA sequences (cis-regulatory sequences). This is not an innate ability; instead, it is governed by the organization/structure of the genome in the nucleus, which controls the availability/exposure of the cis-regulatory sequences to the trans-factors1,2,3. If the trans-factors cannot find their cis-regulatory sequences, then the trans-factors cannot perform their regulatory tasks. This has made understanding how genomes are organized in the nucleus an important source of inquiry.
It is widely accepted that during interphase, eukaryotic chromosomes in the nucleus occupy their own domain anchored to the nuclear lamina and nuclear matrix (Figure 1), thus making the chromosome more like a slice of pizza, rather than a noodle on a plate of spaghetti. Chromosomes are partially condensed by protein-DNA interactions (chromatin) that twist and loop portions of the chromosome. Through electron microscopy, three-dimensional DNA fluorescence in situ hybridization (FISH), and DNA tagging techniques (i.e., fluorescent and artificial DNA methylation), inactive domains of chromatin have been found to be packed tightly along the nuclear periphery4,5,6, while portions of active, less condensed chromatin are found in the interior of the nucleus7,8,9,10. These experiments provide a wide-angle view of chromosome dynamics but do little to capture the changes that occur locally around the gene promotors observed in DNase11,12 and nucleosome13,14,15 studies.
The key to unlocking higher-resolution chromatin dynamics was the formulation of the 3D chromosome mapping technique, 3C. The 3C technique itself comprises four main steps: crosslinking of chromatin, chromatin digestion by restriction enzymes, chromatin ligation, and DNA purification (Figure 2). The new artificial DNA fragments generated by this process can then be characterized to reveal the close physical association between linearly distant pieces of DNA16. The 3C technique became the basis for the creation of multiple spin-off techniques that utilize the initial steps of 3C to ask broader genome-wide questions (e.g., Hi-C, 4C, ChIP-C). This family of 3C techniques has identified that chromosomes are organized into multiple discrete units termed topologically associated domains (TADs). TADs are encoded in the genome and are defined by chromatin loops flanked by unlooped boundaries16,17,18,19. The TAD boundaries are maintained by two evolutionarily conserved and ubiquitous factors, including CCCT binding factor (CTCF) and cohesion, which prevent loops within separate TADs from interacting16,20. The loops are mediated by the interaction of trans-factors with their regulatory sequences, as well as CTCF and cohesion21.
Though many studies using 3C technologies ask broad genome-wide questions and employ complicated sample collection techniques, the formulation of the 3C technique is based on basic molecular biology techniques. This makes 3C intriguing for deployment in both undergraduate research and teaching labs. The 3C technique can be employed for smaller focused questions and is inherently flexible to scaling up or down (single genes22, chromosomes16, and/or genomes18) depending on the focus and direction of the questions asked. This technique has also been applied to a wide range of model systems7,16,19,23 and has been proven to be versatile in its use. This makes 3C an excellent technique for undergraduates in that students can gain experience in common molecular biology techniques while also gaining valuable experience in answering directed questions.
Presented here is an adapted protocol for 3C library preparation based on previously published protocols24,25,26,27. This protocol has been optimized for approximately 1 &#215; 107 cells, though it has generated 3C libraries with as little as 1 &#215; 105 cells. This protocol has proven to be versatile and has been used to generate 3C libraries from zebrafish embryos, zebrafish cell lines, and young-adult (YA) Caenorhabditis elegans (roundworm). The protocol should also be appropriate for mammalian cell lines and, with further adaptation, yeast.
The goal of these adaptations is to make 3C more accessible for undergraduates. Care has been taken to use techniques that are similar to those that can be accomplished in an undergraduate teaching laboratory. The 3C technique provides many learning opportunities for undergraduates to learn basic molecular biology techniques that will benefit their development at the bench, in the classroom, and in their endeavors after graduation.

تسليط الضوء على المؤلف: الحصول على A مع 3Cs: التقاط تشكيل الكروموسوم للطلاب الجامعيين  

الحصول على A مع 3Cs: التقاط تشوه الكروموسوم للطلاب الجامعيين

Our research aims to uncover how chromatin organization controls gene expression. The focus is on determining what factors regulate chromatin at the gene level to control gene activity. Currently, technologies similar to chromosome confirmation capture, or 3C, are used to make progress in this field.Investments in sample collection and sequencing technologies have pushed us what the 3C techniques can show us. The greatest experimental challenge currently is collecting samples having uniform chromatin architecture. Heterogeneity in samples leads to confounding results.In the future, we'll be focusing on how changes in chromatin organization play a role in cancer.

سينتج هذا الإجراء عينة تجريبية واحدة من 3C وعينتين ضابطتين (غير مهضومة ومهضومة). باستخدام هذه العينات الثلاث ، تم إجراء qPCR. من هذه النتائج ، تم حساب كفاءة الهضم (المعادلة 1) وتسجيلها (الجدول 1). من هذه الحسابات ، تم تحديد أن عينة 3C لديها كفاءة هضم تقارب 88٪ (متوسط الجدول 1) عبر المواقع الجينومية السبعة التي تم اختبارها.
بعد ذلك ، تم اختبار العينات لوجود اتصالات كروماتين طويلة المدى بين المواقع الجينومية المختلفة باستخدام مجموعات من البادئات الخاصة بالمواقع (الجدول 2) و qPCR. باستخدام هذه النتائج ، تم حساب وفرة المنتج بالنسبة لمجموعة التمهيدي للتحكم (المعادلة 2) ورسمها بيانيا للمقارنة (الشكل 4). أشارت هذه البيانات إلى أن 8 من 10 تفاعلات كانت إيجابية مشروطة للتفاعلات بعيدة المدى.
ثم تم تشغيل تفاعلات تفاعل البوليميراز المتسلسل على هلام الأغاروز. تم تنقية منتج تفاعل البوليميراز المتسلسل المتوقع للإيجابيات الشرطية الثمانية وتفاعل سلبي واحد بالهلام وإرساله لتسلسل سانجر. تظهر نتائج ردود الفعل التمثيلية الإيجابية (السهم الأزرق ، المربع الأزرق) والسالبة (السهم الأحمر ، المربع الأحمر) (الشكل 5).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65213/65213fig01.jpg"> الشكل 1: تركيب الكروموسوم في النواة. تنظيم كروموسوم افتراضي داخل النواة. (أ) غلاف نووي، خطوط سوداء؛ (ب) الصفيحة النووية، البرتقالية؛ (ج) خطوط متغاير اللون مضغوطة؛ د: إيوكروماتين، حلقات فضفاضة. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig01large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65213/65213fig02.jpg"> الشكل 2: رسم تخطيطي لبروتوكول 3C. يتم تقريب الأجزاء البعيدة من الكروموسومات الخطية (الأزرق والأصفر والوردي) من بعضها البعض داخل النواة من خلال الحلقات التنظيمية. (أ) تتوسط هياكل الحلقة بعوامل النسخ (الدائرة الرمادية والنجمة السوداء)؛ يتم الحفاظ على هذه التفاعلات من خلال التشابك الكيميائي. (ب) تتكسر الحلقات من خلال الهضم الأنزيمي (الخطوط السوداء). (ج) ترتبط قطع الكروماتين البعيدة معا من خلال الأطراف الشائكة الناتجة عن عملية الهضم. د: ينقى الحمض النووي (DNA) من البروتين. ه: يحدد التتابع داخل الأجزاء ويعود إلى الجينوم. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig02large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65213/65213fig03.jpg"> الشكل 3: مخطط التمهيدي 3C. تم تصميم البادئات 3C حول مواقع التقييد على مسافات متفاوتة من الموقع الجينومي محل الاهتمام. تمثل الأسهم الوردية مجموعات التمهيدي التجريبية المحيطة بموقع DpnII. يمكن خلط البادئات التجريبية ومطابقتها لتقييم حلقات الكروماتين في المنطقة. تمثل البادئات البرتقالية تحكما سلبيا بدون موقع DpnII. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig03large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/65213/65213fig04.jpg"> الشكل 4: بيانات qPCR التمثيلية لتجربة 3C. وفرة نسبية لمجموعات اختبار التمهيدي 3C. (أ) رسم بياني للتحكم يوضح الوفرة النسبية للمنتج في عنصر التحكم غير المهضوم (أزرق) ، وعنصر تحكم مهضوم (رمادي) ، وعينة 3C (برتقالي). (ب) تجربة 3C؛ الوفرة النسبية للمنتج من مجموعات من بادئات الاختبار في عنصر التحكم غير المهضوم (الأزرق) ، والتحكم المهضوم (الرمادي) ، وعينة 3C (برتقالي). <a href="https://www.jove.com/files/ftp_upload/65213/65213fig04large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/65213/65213fig05.jpg"> الشكل 5: تصور منتجات 3C qPCR. أعلى ، هلام مع منتجات نقطة نهاية qPCR مع العينات المشار إليها. في القاع ، ملفات تتبع تسلسل سانجر التمثيلية لردود الفعل المشار إليها. العينة البرتقالية هي مثال على نتيجة إيجابية خاطئة (انظر الشكل 4 ، r38 / 34) ، والعينة الزرقاء هي مثال على إيجابية حقيقية مع موقع DpnII المشار إليه أعلاه التتبع. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig05large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>موقع</td>
			<td>٪ الهضم</td>
		</tr><tr><td>آر 8</td>
			<td>86.98</td>
		</tr><tr><td>ر3</td>
			<td>88.44</td>
		</tr><tr><td>آر 38</td>
			<td>89.64</td>
		</tr><tr><td>آر 34</td>
			<td>87.55</td>
		</tr><tr><td>آر 33</td>
			<td>87.85</td>
		</tr><tr><td>آر 14</td>
			<td>86.97</td>
		</tr><tr><td>آر 47</td>
			<td>89.45</td>
		</tr></tbody></table>الجدول 1: كفاءة الهضم المحسوبة.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>اسم</td>
			<td colspan="3">تسلسل</td>
			<td>المواقع الجينومية</td>
		</tr><tr><td>r3 دفع أمامي</td>
			<td colspan="3">ACGCAAGTAAAATTCTGGTTTTTGACC</td>
			<td>chrX:11361475</td>
		</tr><tr><td>r3 RVS</td>
			<td colspan="3">TTTCCTGAGCTCTAACCATGTTTGC</td>
			<td>chrX:11361561</td>
		</tr><tr><td>r38 دفع أمامي</td>
			<td colspan="3">TTACTTCTGAAGTAATCTTTTCTTATCCCC</td>
			<td>chrX: 5859700</td>
		</tr><tr><td>r38 RVS</td>
			<td colspan="3">AGACGAGCTGATTAAAAGTAGTTGAGAG</td>
			<td>chrX:5859775</td>
		</tr><tr><td>r34 دفع أمامي</td>
			<td colspan="3">ATTTGTGGATTGCGTGGAGACG</td>
			<td>chrX:5429702</td>
		</tr><tr><td>r34 RVS</td>
			<td colspan="3">AATAATCCTCTTAACAAACGTGGCC</td>
			<td>chrX:5429777</td>
		</tr><tr><td>r33 دفع أمامي</td>
			<td colspan="3">AAGAGTTGTCCAAAATAAATTGAGCTAAC</td>
			<td>chrX:6296704</td>
		</tr><tr><td>r33 RVS</td>
			<td colspan="3">TTCAGAAAAGTAAACTTTGACTTGGAACG</td>
			<td>chrX:6296807</td>
		</tr><tr><td>r14 دفع أمامي</td>
			<td colspan="3">AATTATCGATTTTTCCATCGCGCAG</td>
			<td>chrX:8036367</td>
		</tr><tr><td>r14 RVS</td>
			<td colspan="3">ATTTCAATGAAAATGTAAAAATGTTCTCTC</td>
			<td>chrX:8036427</td>
		</tr><tr><td>r47 دفع أمامي</td>
			<td colspan="3">ATCTAGACTTGATAATTTGTGTGTCCTC</td>
			<td>chrX:9464939</td>
		</tr><tr><td>r47 RVS</td>
			<td colspan="3">AAGTTCTGCAACTGTTAGATGAATAACAC</td>
			<td>chrX:9465064</td>
		</tr><tr><td>r8 دفع أمامي</td>
			<td colspan="3">GAGAATGTTGTTCTGTAACTGAAAACTTG</td>
			<td>chrX:11094257</td>
		</tr><tr><td>r8 RVS</td>
			<td colspan="3">TTACGAAATTTGGTAGTTGGACC</td>
			<td>chrX:11094362</td>
		</tr><tr><td>برايمر التحكم FWD</td>
			<td colspan="3">CAATCGTCTCGCTCACTTGTC</td>
			<td>chrX:7608049</td>
		</tr><tr><td>التحكم التمهيدي RVS</td>
			<td colspan="3">غاتغتغاكاك</td>
			<td>chrX:7608166</td>
		</tr></tbody></table>الجدول 2: الاشعال لتجربة 3C التمثيلية.

Watch this Scientific Journal Video about Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates at JoVE.com

هنا ، نقدم تكيفا لتقنية التقاط تشكل الكروموسوم (3C) بالتفصيل مع التركيز على المشاركة الجامعية والتعلم.

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C ...

يهدف بحثنا إلى الكشف عن كيفية تحكم تنظيم الكروماتين في التعبير الجيني. ينصب التركيز على تحديد العوامل التي تنظم الكروماتين على مستوى الجينات للتحكم في نشاط الجينات. حاليا ، يتم استخدام تقنيات مشابهة لالتقاط تأكيد الكروموسوم ، أو 3C ، لإحراز تقدم في هذا المجال.لقد دفعتنا الاستثمارات في تقنيات جمع العينات وتسلسلها إلى ما يمكن أن تظهره لنا تقنيات 3C. التحدي التجريبي الأكبر حاليا هو جمع عينات ذات بنية كروماتين موحدة. عدم التجانس في العينات يؤدي إلى نتائج مربكة.في المستقبل ، سنركز على كيفية لعب التغييرات في تنظيم الكروماتين دورا في السرطان.

getting-an-with-3cs-chromosome-conformation-capture-for

Research

JoVE Journal

Genetics

Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates

2.1K Views.  Bryant University. يهدف بحثنا إلى الكشف عن كيفية تحكم تنظيم الكروماتين في التعبير الجيني. ينصب التركيز على تحديد العوامل التي تنظم الكروماتين على مستوى الجينات للتحكم في نشاط الجينات. حاليا ، يتم استخدام تقنيات مشابهة لالتقاط تأكيد الكروموسوم ، أو 3C ، لإحراز تقدم في هذا المجال.لقد دفعتنا...

Video: تسليط الضوء على المؤلف: الحصول على A مع 3Cs: التقاط تشكيل الكروموسوم للطلاب الجامعيين  

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C techniques) that provide detailed information of the three-dimensional organization of chromatin. The 3C techniques have been used in a wide range of studies, from monitoring the changes in chromatin organization in cancer cells to identifying enhancer contacts made with gene promoters. While many of the studies using these techniques are asking big genome-wide questions with intricate sample types (i.e., single-cell analysis), what is often lost is that the 3C techniques are grounded in basic molecular biology methods that are applicable to a broad range of studies. By addressing tightly focused questions of chromatin organization, this cutting-edge technique can be used to enhance the undergraduate research and teaching lab experience. This paper presents a 3C protocol and provides adaptations and points of emphasis for implementation at primarily undergraduate institutions in undergraduate research and teaching experiences.

Here, we present an adaption of the chromosome conformation capture (3C) technique in detail with an emphasis on undergraduate involvement and learning.

Generation and Purification of Chromosome Conformation Capture (3C) Library

On day one after chromatin cross-linking and nuclei collection from 5, 000 young adult Caenorhabditis Elegans worms, transfer the nuclei pellet re-suspended in 450 microliters of clean water to a clean 1.5 milliliter micro centrifuge tube. Then add 60 microliters of 10X DPN2 restriction enzyme buffer to it and mix well. Incubate the samples with 15 microliters of 10%sodium dodecyl sulfate at 37 degrees Celsius for one hour with agitation.Quench the reaction by adding 75 microliters of 20%triton X 100 and incubating as demonstrated previously. Aliquot 10 microliters from the sample, as the undigested control, and store it at four degrees Celsius. After adding 400 units of DPN 2 to the rest of the sample, incubate it overnight at 37 degrees Celsius with agitation for chromatin digestion.On day two, add an additional 200 units of DPN 2 to the sample. To complete the digestion of the cross-linked sample, incubate it at 37 degrees Celsius with agitation for four hours. Heat inactivate the restriction enzyme by incubating the sample for 20 minutes at 65 degrees Celsius.If the enzyme cannot be inactivated by heat, add 80 microliters of 10%sodium dodecyl sulfate and incubate. Then, add 375 microliters of 20%Triton X 100 to the sample and mix by swirling. Keep aside a 10 microliter aliquot from the sample as the digestion control.For chromatin ligation, transfer the sample to a clean 50 milliliter conical tube. Adjust the sample volume to 5.7 milliliters with molecular grade water and mix by swirling. Then, add 700 microliters of 10 X T4 ligase buffer, followed by 60 units of T4 DNA ligase, and incubate the sample overnight at 16 degrees Celsius.On day three, proceed with protein digestion and reverse cross-linking. Add 30 microliters of 10 milligrams per milliliter Proteinase K to the 3C sample and incubate at 65 degrees Celsius overnight with agitation. To begin purification of the 3C library on day four, add 30 microliters of 10 milligrams per milliliter RNase A to the sample and mix by swirling.After incubation, add seven milliliters of phenyl chloroform to the samples and mix by shaking. Centrifuge the sample for 15 minutes at 3, 270 G and room temperature. Collect and transfer the aqueous phase to a clean 50 milliliter conical tube.Add equal volumes of chloroform and mix the sample by shaking. After centrifuging the sample again as demonstrated, transfer the aqueous phase to another clean 50 milliliter conical tube. Add 7.5 milliliters of molecular grade water, 35 milliliters of 100%ethanol and seven microliters of one milligram per milliliter Glycogen.Freeze the properly mixed sample at minus 80 degrees Celsius. While the sample freezes, begin purifying the control samples by adjusting the volume of the controls to 500 microliters using molecular grade water. Add two microliters of 10 milligrams per milliliter RNase A and mix by flicking the tube.Next, add one milliliter of phenyl chloroform to the tubes containing the controls and mix by shaking. Centrifuge the tubes. After transferring the aqueous phase to a clean 1.5 milliliter micro centrifuge tube, add equal volumes of chloroform.Centrifuge as previously demonstrated before collecting the aqueous phase. To the collected aqueous phase, add one milliliter of ethanol and two microliters of one milligram per milliliter glycogen. After mixing the sample by shaking, incubate it at minus 80 degrees Celsius for 30 minutes.Next, centrifuge the sample for 15 minutes at 3, 270 G at four degrees Celsius. After removing the supernatant, add 750 microliters of chilled 70%ethanol and centrifuge. Re-suspend the air dried pellet in 50 microliters of molecular grade water.The suspension can be frozen here if not proceeding further immediately. To continue with the 3C sample purification, remove the sample from the freezer and centrifuge at 3, 270 G for 30 minutes. Add 10 milliliters of chilled 70%ethanol and break up the DNA pellet.After centrifuging and removing the supernatant, partially air dry the sample at room temperature. Re suspend the pellet in 150 microliters of 10 millimolar tris HCL at pH 7.5 by pipetting up and down to obtain the purified 3C library. QPCR performed on the one experimental and two control 3C samples helped generate the digestion efficiency data.The 3C sample had an approximately 88%digestion efficiency across the seven genomic loci tested.

مكتبة توليد وتنقية التقاط تشكل الكروموسوم (3C)

Identification of the Chromosome Conformation Capture (3C) Products

Take the chromosome confirmation capture or 3C sample and controls, and perform QPCR. Excise the product bands corresponding to the expected fragment size. To perform gel extraction of the PCR products, use a commercial kit or follow the homemade protocol.For the latter, construct a homemade purification cartridge by poking a hole in the bottom of a 0.5 milliliter tube with a needle. Pack a small amount of cotton into the bottom of the tube with the hole, filling no more than half of the tube. Place the tube into a 1.5 milliliter tube, ensuring that the smaller tube rests on the lip of the bigger tube, and not in the tube.Carefully cut the gel fragment into smaller pieces, and place it in the small tube of the cartridge. Place the assembly in a minus 20 degrees Celsius freezer for five minutes. Then, spin the assembly for three minutes at 13, 000 G and room temperature.Discard the small tube containing the agoros debris, and keep the 1.5 milliliter tube with the extracted DNA in the buffer. The samples were tested for the presence of long range chromatin contacts between the different genomic loci, using combinations of loci-specific primers and QPCR. The product abundance is relative to a control primer set were calculated and graft for comparison.The data indicated that 8 of the 10 reactions were conditional positives. Gel purification and sequencing of the expected PCR product for the eight conditional positives and one negative reaction were gel purified and sequenced. The results for representative positive and negative reactions are shown.