The authors acknowledge support from the NIH/NIGMS (R01GM084135 to HJN) and Mizutani Foundation for Glycoscience (grant #110071 to HJN), and are grateful to Tom V. Lee for discussions and suggestions on the assays, and Spyros Artavanis-Tsakonas, Hugo Bellen, Robert Fleming, Ken Irvine and The Drosophila Genomics Resource Center (DGRC) for plasmids and cell lines.

1. Preparation of Double Stranded RNA (dsRNA) for Shams Knockdown
<ol>
	<li>PCR amplification of the products
	<ol>
		<li>Use wild-type yellow white (y w) genomic DNA and pAc5.1-EGFP as template and the following primer pairs to amplify the DNA fragments used in dsRNA synthesis. Use the following PCR thermal profile: Denaturation (95 &#176;C, 30 s), Annealing (58 &#176;C, 30 s) and Extension (72 &#176;C, 1 min). 
		Enhanced Green Fluorescent Protein (EGFP) dsRNA primers (5&#39;-3&#39;)- 
		Forward primer- GAAATTAATACGACTCACTATAGGGGGTGAGCAAGGGCGAGGAG 
		Reverse primer- GAAATTAATACGACTCACTATAGGGGGTCTTTGCTCAGGGCGG 
		Shams dsRNA primers (5&#39;-3&#39;)- 
		Forward primer- TTAATACGACTCACTATAGGGGAGATGCTGTATGTGGACACGGAT 
		Reverse primer- TTAATACGACTCACTATAGGGGAGATCCGTGGATAACCTTAACGA 
		NOTE: EGFP dsRNA is used as negative control.</li>
	</ol>
	</li>
	<li>Gel-purify the polymerase chain reaction (PCR) products using a commercial gel purification kit according to manufacturer&#39;s protocol.</li>
	<li>Perform in vitro transcription using a commercial product capable of transcribing from a T7 promoter according to manufacturer&#39;s protocol.</li>
	<li>Purify the dsRNA using an RNA purification kit according to manufacturer&#39;s protocol and store at -80 &#176;C.</li>
	<li>Assess the efficiency of shams knockdown by using the following steps (1.5.1-1.5.5).
	<ol>
		<li>Count the cells manually using a hemocytometer and plate 5 x 105 S2 cells in each well of a 6 well plate in 1 mL/well of Schneider&#39;s medium supplemented with 10% Fetal Bovine Serum (FBS) and 100 U/mL Penicillin-Streptomycin.</li>
		<li>Add 7.5 &#181;g of EGFP- or shams dsRNA to each well and incubate at 25 &#176;C for 24 h.</li>
		<li>Harvest the control (EGFP dsRNA-treated) and shams dsRNA-treated S2 cells by gentle pipetting followed by pelleting down by centrifugation at 1,000 x g for 5 min at 25 &#176;C and process for RNA isolation using an RNA extraction kit according to manufacturer&#39;s protocol.</li>
		<li>Quantify the RNA using a spectrophotometer and process 100 ng of RNA for 1-step qRT-PCR using commercial qPCR reagents and primer/probes and the following PCR thermal profile: Denaturation (95 &#176;C, 15 s) and Annealing/Extension (60 &#176;C, 1 min). 
		NOTE: Please see the Table of Materials for information on the primer/probe sets and the instrument used for shams and control qRT-PCR experiments in these studies.</li>
		<li>Calculate relative shams mRNA levels using the 2-&#916;&#916;CT method16.</li>
	</ol>
	</li>
</ol>
2. Assessment of the Binding Between the Notch Receptor and Trans-ligands
<ol>
	<li>Prepare signal-receiving cells (S2 cells expressing the Notch receptor).
	<ol>
		<li>Count the cells manually using a hemocytometer and plate 5 x 105 S2 and stable S2-Notch cells in each well of a 6-well plate in 1 mL/well of Schneider&#39;s medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin. 
		NOTE: For S2-Notch cells, which are available from Drosophila Genomics Resource Center (DGRC), add 200 nM methotrexate in media. To prepare a 0.5 mM methotrexate stock solution, first prepare a 20 mM methotrexate solution in 250 &#181;L of 1 M NaOH. Next, dilute this solution to 0.5 mM in 1 M phosphate buffer saline and store at -20 &#176;C. In S2-Notch cells, expression of the Notch protein is under the control of the Drosophila metallothionein promoter in the pMT vector.</li>
		<li>Add 7.5 &#181;g of dsRNA to each well and incubate at 25 &#176;C for 24 h.</li>
		<li>Add 0.7 mM CuSO4 to induce the expression of Notch and incubate at 25 &#176;C for 3 days. 
		NOTE: CuSO4 is used to induce expression of proteins controlled by the metallothionein promoter.</li>
	</ol>
	</li>
	<li>Prepare signal-sending cells (S2 cell expressing Delta or Serrate ligands).
	<ol>
		<li>Count the cells manually using a hemocytometer and plate ~5 x 106 stable S2-Delta or S2-SerrateTom cells in each well of a 6-well plate in 1 mL/well of Schneider&#39;s medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin. 
		NOTE: Add 200 nM methotrexate for S2-Delta cells and 100 &#181;g/mL hygromycin for S2-SerrateTom cells in media. Expression of Delta and SerrateTom&#8212;a Tomato-tagged, functional version of Serrate12&#8212;is under Drosophila metallothionein promoter in the pMT vector.</li>
		<li>Add 0.7 mM CuSO4 to induce the expression of ligands and incubate at 25 &#176;C for 3 h.</li>
	</ol>
	</li>
	<li>Perform aggregation between signal-sending and signal-receiving cells.
	<ol>
		<li>Harvest the dsRNA-treated S2 (control) and S2-Notch cells by gentle pipetting and plate 2.5 x 105 cells/well in a 24-well plate after manual counting by hemocytometer.</li>
		<li>Add 5 x 105 stable S2-Delta or S2-SerrateTom cells in a total volume of 200 &#181;L of Schneider&#39;s medium (supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin). 
		NOTE: All S2 cells handling (including plating, induction and dsRNA treatment) was done under a biosafety cabinet.</li>
		<li>Place the plate on an orbital shaker at 150 rpm (942.48 rad/min).</li>
		<li>After 1 min, mix the contents of each well and take 20 &#181;L out for counting the number of aggregates.
		<ol>
			<li>Simultaneously take a representative image under inverted compound microscope using 10x magnification (PLL 10/0.25 objective).</li>
			<li>Manually count the aggregates (&#62;6 cells) using a hemocytometer.</li>
		</ol>
		</li>
		<li>Place the plate on a shaker.</li>
		<li>Repeat the image acquisition and counting after 5 min and 15 min of aggregation.</li>
	</ol>
	</li>
	<li>Perform quantification of trans-binding.
	<ol>
		<li>Calculate the number of aggregates per mL between S2 cells and S2-Delta or S2-SerrateTom cells as a background control.</li>
		<li>Calculate the number of aggregates per mL between S2-Notch and S2-Delta or S2-SerrateTom cells (magnitude of trans-binding).</li>
	</ol>
	</li>
</ol>
3. Evaluation of Inhibition of Binding Between Notch and Trans-ligands by Cis-ligands
<ol>
	<li>Prepare signal-receiving cells.
	<ol>
		<li>Plate 5 x 105 S2 cells in each well of a 6-well plate in 1 mL/well of Schneider&#39;s medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin.</li>
		<li>Add 7.5 &#181;g of dsRNA to each well and incubate at 25 &#176;C for 24 h.</li>
		<li>Co-transfect the dsRNA-treated cells with pBluescript and pMT-Notch11 (DGRC) alone or with pMT-Notch and pMT-Delta11 (DGRC) or pMT-Serrate17 for a total DNA concentration of 2 &#181;g/well using a commercial transfection reagent according to manufacturer&#39;s protocol. 
		NOTE: pBluescript is used as a control. The co-transfected cells will be called S2-Notch&#38;Deltatransient or S2-Notch&#38;Serratetransient cells hereafter.</li>
		<li>Incubate the transiently-transfected S2 cells at 25 &#176;C for 24 h.</li>
		<li>Add 0.7 mM CuSO4 to induce the expression of Notch and the ligands and incubate at 25 &#176;C for 3 days.</li>
	</ol>
	</li>
	<li>Prepare signal-sending cells as described in 2.2.</li>
	<li>Perform aggregation between signal-sending and signal-receiving cells as described in section 2.3.</li>
	<li>Quantify inhibition of trans-binding by cis-ligands.
	<ol>
		<li>Calculate the number of aggregates per mL between S2 cells and S2-Delta or S2-Serrate cells as a background control.</li>
		<li>Quantify the magnitude of inhibition by cis-ligands as follows.
		<ol>
			<li>Define A as Number of aggregates between S2-Notchtransient and S2-Delta cells.</li>
			<li>Define B as Number of aggregates between S2 cells transiently co-transfected with Notch and Delta (S2-Notch&#38;Deltatransient) and S2-Delta cells.</li>
			<li>Calculate relative aggregation C = (B x 100)/A</li>
			<li>Calculate magnitude of inhibition by cis-ligand (Delta or Serrate) as 100 &#8211; C. 
			NOTE: As an example, if relative aggregation is 45%, then cis-ligands are considered to inhibit the trans-binding by 55%.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>

<ol>
	<li>de Celis, J. F., Bray, S., Garcia-Bellido, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signalling+regulates+veinlet+expression+and+establishes+boundaries+between+veins+and+interveins+in+the+Drosophila+wing.">Notch signalling regulates veinlet expression and establishes boundaries between veins and interveins in the Drosophila wing.</a> Development. 124 (10), 1919-1928 (1997).</li><li>Fortini, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signaling:+the+core+pathway+and+its+posttranslational+regulation.">Notch signaling: the core pathway and its posttranslational regulation.</a> Dev Cell. 16 (5), 633-647 (2009).</li><li>del Alamo, D., Rouault, H., Schweisguth, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism+and+significance+of+cis-inhibition+in+Notch+signalling.">Mechanism and significance of cis-inhibition in Notch signalling.</a> Curr Biol. 21 (1), R40-R47 (2011).</li><li>Sprinzak, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cis-interactions+between+Notch+and+Delta+generate+mutually+exclusive+signalling+states.">Cis-interactions between Notch and Delta generate mutually exclusive signalling states.</a> Nature. 465 (7294), 86-90 (2010).</li><li>Kopan, R., Ilagan, M. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+canonical+Notch+signaling+pathway:+unfolding+the+activation+mechanism.">The canonical Notch signaling pathway: unfolding the activation mechanism.</a> Cell. 137 (2), 216-233 (2009).</li><li>Huppert, S. S., Jacobsen, T. L., Muskavitch, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Feedback+regulation+is+central+to+Delta-Notch+signalling+required+for+Drosophila+wing+vein+morphogenesis.">Feedback regulation is central to Delta-Notch signalling required for Drosophila wing vein morphogenesis.</a> Development. 124 (17), 3283-3291 (1997).</li><li>Lee, T. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+regulation+of+notch+signaling+by+xylose.">Negative regulation of notch signaling by xylose.</a> PLoS Genet. 9 (6), e1003547 (2013).</li><li>Lee, T. V., Pandey, A., Jafar-Nejad, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xylosylation+of+the+Notch+receptor+preserves+the+balance+between+its+activation+by+trans-Delta+and+inhibition+by+cis-ligands+in+Drosophila.">Xylosylation of the Notch receptor preserves the balance between its activation by trans-Delta and inhibition by cis-ligands in Drosophila.</a> PLoS Genet. 13 (4), e1006723 (2017).</li><li>Jacobsen, T. L., Brennan, K., Arias, A. M., Muskavitch, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cis-interactions+between+Delta+and+Notch+modulate+neurogenic+signalling+in+Drosophila.">Cis-interactions between Delta and Notch modulate neurogenic signalling in Drosophila.</a> Development. 125 (22), 4531-4540 (1998).</li><li>Schneider, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+lines+derived+from+late+embryonic+stages+of+Drosophila+melanogaster.">Cell lines derived from late embryonic stages of Drosophila melanogaster.</a> J Embryol Exp Morphol. 27 (2), 353-365 (1972).</li><li>Fehon, R. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+interactions+between+the+protein+products+of+the+neurogenic+loci+Notch+and+Delta,+two+EGF-homologous+genes+in+Drosophila.">Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila.</a> Cell. 61 (3), 523-534 (1990).</li><li>Fleming, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+extracellular+region+of+Serrate+is+essential+for+ligand-induced+cis-inhibition+of+Notch+signaling.">An extracellular region of Serrate is essential for ligand-induced cis-inhibition of Notch signaling.</a> Development. 140 (9), 2039-2049 (2013).</li><li>Saj, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+combined+ex+vivo+and+in+vivo+RNAi+screen+for+notch+regulators+in+Drosophila+reveals+an+extensive+notch+interaction+network.">A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.</a> Dev Cell. 18 (5), 862-876 (2010).</li><li>Fiuza, U. M., Klein, T., Martinez Arias, A., Hayward, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+ligand-mediated+inhibition+in+Notch+signaling+activity+in+Drosophila.">Mechanisms of ligand-mediated inhibition in Notch signaling activity in Drosophila.</a> Dev Dyn. 239 (3), 798-805 (2010).</li><li>Ahimou, F., Mok, L. P., Bardot, B., Wesley, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+adhesion+force+of+Notch+with+Delta+and+the+rate+of+Notch+signaling.">The adhesion force of Notch with Delta and the rate of Notch signaling.</a> J Cell Biol. 167 (6), 1217-1229 (2004).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Okajima, T., Xu, A., Irvine, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+notch-ligand+binding+by+protein+O-fucosyltransferase+1+and+fringe.">Modulation of notch-ligand binding by protein O-fucosyltransferase 1 and fringe.</a> J Biol Chem. 278 (43), 42340-42345 (2003).</li><li>Acar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rumi+is+a+CAP10+domain+glycosyltransferase+that+modifies+Notch+and+is+required+for+Notch+signaling.">Rumi is a CAP10 domain glycosyltransferase that modifies Notch and is required for Notch signaling.</a> Cell. 132 (2), 247-258 (2008).</li><li>Bruckner, K., Perez, L., Clausen, H., Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycosyltransferase+activity+of+Fringe+modulates+Notch-Delta+interactions.">Glycosyltransferase activity of Fringe modulates Notch-Delta interactions.</a> Nature. 406 (6794), 411-415 (2000).</li><li>Yamamoto, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+EGF+repeat-8+of+Notch+discriminates+between+Serrate/Jagged+and+Delta+family+ligands.">A mutation in EGF repeat-8 of Notch discriminates between Serrate/Jagged and Delta family ligands.</a> Science. 338 (6111), 1229-1232 (2012).</li></ol>

The authors have no conflict of interest.

Canonical Notch signaling depends on the interactions between the Notch receptor and its ligands5. Although most studies on the Notch pathway primarily consider the binding of Notch and ligands in neighboring cells (trans), Notch and same-cell ligands do interact, and these so-called cis-interactions can play an inhibitory role in Notch signaling3,4. Accordingly, to decipher the mechanisms underlying the effects of a modi...

Canonical Notch signaling is a short-range cell to cell communication mechanism that requires physical contact of neighboring cells to facilitate the interaction between Notch receptors and their ligands1. Interaction of Notch receptor (present on the surface of signal-receiving cells) with ligands (present on the surface of signal-sending cells) initiates Notch signaling and is known as trans-activation2. On the other hand, interaction between Notch and its ligands in the same cell leads to the inhibition of Notch pathway and is known as cis-inhibition3. The balance between trans- and cis-interactions is required to ensure optimum ligand-dependent Notch signaling4. Drosophila has one Notch receptor and two ligands (Delta and Serrate) as opposed to mammals, which have four Notch receptors and five ligands [jagged 1 (JAG1), JAG2, delta-like 1 (DLL1), DLL3 and DLL4]5. Having this simplicity, the Drosophila model offers the ease to dissect/study the effects of pathway modifiers on Notch-ligand interactions and subsequently on Notch signaling. In certain contexts during animal development (including wing development in Drosophila), both cis- and trans-interactions are involved to achieve proper Notch signaling and cell fate1,6. It is important to distinguish the effects of Notch pathway modifiers in these contexts on cis- versus trans-interactions of Notch with its ligands.
Our group previously reported that addition of a carbohydrate residue called xylose to Drosophila Notch negatively regulates Notch signaling in certain contexts, including wing development7. Loss of shams (the enzyme that xylosylates Notch) leads to a &#34;loss of wing vein&#34; phenotype7. More recently, gene dosage experiments and clonal analysis were used to show that loss of shams enhances Delta-mediated Notch singling. To distinguish whether the enhanced Notch signaling in shams mutants is a result of decreased cis-inhibition or increased trans-activation, ectopic overexpression studies of Notch ligands in larval wing imaginal discs using the dpp-GAL4 driver were performed. These experiments provided evidence suggesting that Shams regulates trans-activation of Notch by Delta without affecting Notch cis-inhibition by ligands8. However, feed-back regulations and effects of endogenous ligands might complicate the interpretation of ectopic overexpression studies1,6,9.
To resolve this issue, Drosophila S2 cells10 were used, which provide a simple in vitro system for Notch-ligand interaction studies11,12. S2 cells do not express endogenous Notch receptor and Delta ligand11 and express a low level of Serrate13, which does not affect Notch-ligand aggregation experiments8. Therefore, S2 cells can be stably or transiently transfected by Notch and/or individual ligands (Delta or Serrate) to generate cells that exclusively express the Notch receptor or one of its ligands, or a combination of them. Mixing of Notch-expressing S2 cells with ligand-expressing S2 cells results in the formation of heterotypic aggregates mediated by receptor-ligand binding11,12,14. Quantification of the aggregate formation provides a measure of trans-binding between Notch and its ligands15 (Figure 1). Similarly, S2 cells can be co-transfected with Notch and Delta or Serrate ligands (i.e. cis-ligands). Cis-ligands in these Notch-expressing S2 cells abrogate the binding of Notch with trans-ligands and result in decreased aggregate formation8,12,14. The relative decrease in aggregate formation caused by cis-ligands provides a measure of the inhibitory effect of cis-ligands on binding between Notch and trans-ligands (Figure 2). Accordingly, cell aggregation assays were utilized to examine the effect of loss of xylosylation on trans- and cis-interactions between Notch and its ligands.
Here, we present a detailed protocol for cell aggregation assays aimed to evaluate the binding of Notch with trans-ligands and its inhibition by cis-ligands using Drosophila S2 cells. As an example, we provide the data that allowed us to determine the effect of Notch xylosylation on binding between Notch and trans-Delta8. These straightforward assays provide a semi-quantitative assessment of Notch-ligand interactions in vitro and help determine the molecular mechanisms underlying the in vivo effects of Notch pathway modifiers.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="22">
			<td height="22" style="height:23px;width:415px;">BioWhittaker Schneider&#8217;s Drosophila medium, Modified</td>
			<td style="width:187px;">Lonza</td>
			<td style="width:131px;">04-351Q</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:415px;">HyClone Penicillin-Streptomycin 100X solution</td>
			<td style="width:187px;">GE Healthcare lifescience&#160;</td>
			<td style="width:131px;">SV30010</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">CELLSTAR 6 well plate</td>
			<td style="width:187px;">Greiner Bio-One</td>
			<td style="width:131px;">657 160</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">CELLSTAR 24 well plate</td>
			<td style="width:187px;">Greiner Bio-One</td>
			<td style="width:131px;">662160</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">VWR mini shaker</td>
			<td style="width:187px;">Marshell Sceintific</td>
			<td>12520-956</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Hemocytometer</td>
			<td style="width:187px;">Fisher Sceintific&#160;</td>
			<td>267110</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">FuGENE HD Transfection Reagent</td>
			<td style="width:187px;">Promega</td>
			<td style="width:131px;">E2311</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">MEGAscrip T7 Transcription Kit</td>
			<td style="width:187px;">Ambion</td>
			<td style="width:131px;">AM1334</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:415px;">Quick-RNA MiniPrep (RNA purification Kit)</td>
			<td style="width:187px;">Zymo Research</td>
			<td style="width:131px;">R1054</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">VistaVision Inverted microscope</td>
			<td>VWR</td>
			<td style="width:131px;"></td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:415px;">9MP USB2.0 Microscope Digital Camera + Advanced Software</td>
			<td style="width:187px;">AmScope</td>
			<td style="width:131px;">MU-900</td>
			<td style="width:396px;">Image acquisition using ToupView software</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:21px;width:415px;">PureLink Quick Gel Extraction Kit</td>
			<td style="width:187px;">Invitrogen</td>
			<td style="width:131px;">K210012</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:415px;">Fetal Bovine Serum</td>
			<td style="width:187px;">GenDepot</td>
			<td style="width:131px;">F0600-050</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Methotrexate</td>
			<td style="width:187px;">Sigma-Aldrich</td>
			<td style="width:131px;">A6770-10</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Hygromycin B</td>
			<td style="width:187px;">Invitrogen</td>
			<td style="width:131px;">HY068-L6</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:22px;width:415px;">Copper sulphate</td>
			<td style="width:187px;">Macron Fine Chemicals</td>
			<td style="width:131px;">4448-02</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">S2 cells</td>
			<td style="width:187px;">Invitrogen</td>
			<td style="width:131px;">R69007</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:21px;width:415px;">S2-SerrateTom cells</td>
			<td style="width:187px;"></td>
			<td style="width:131px;"></td>
			<td style="width:396px;">Gift from R. Fleming (Fleming et al, Development, 2013)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">S2-Delta cells</td>
			<td style="width:187px;">DGRC</td>
			<td style="width:131px;">152</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">S2-Notch cells</td>
			<td style="width:187px;">DGRC</td>
			<td style="width:131px;">154</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">pMT-Delta vector</td>
			<td style="width:187px;">DGRC</td>
			<td style="width:131px;">1021</td>
			<td style="width:396px;">Gift from S. Artavanis-Tsakonas</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:21px;width:415px;">pMT-Serrate vector</td>
			<td style="width:187px;"></td>
			<td style="width:131px;"></td>
			<td style="width:396px;">Gift from Ken Irvine (Okajima et al, JBC, 2003)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">pMT-Notch vector</td>
			<td style="width:187px;">DGRC</td>
			<td style="width:131px;">1022</td>
			<td style="width:396px;">Gift from S. Artavanis-Tsakonas</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">pAc5.1-EGFP</td>
			<td style="width:187px;"></td>
			<td style="width:131px;"></td>
			<td style="width:396px;">Gift from Hugo Bellen</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TaqMan RNA-to-Ct 1-Step Kit</td>
			<td style="width:187px;">Applied Biosystem</td>
			<td style="width:131px;">1611091</td>
			<td style="width:396px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TaqMan Gene Expression Assay for CG9996 (Shams)</td>
			<td style="width:187px;">Applied Biosystem</td>
			<td>Dm02144576_g1&#160;</td>
			<td style="width:396px;">with FAM-MGB dye</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TaqMan Gene Expression Assay for CG7939 (RpL32)</td>
			<td style="width:187px;">Applied Biosystem</td>
			<td>Dm02151827_g1</td>
			<td style="width:396px;">with FAM-MGB dye</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Applied Biosystems 7900HT Fast Real-Time PCR system</td>
			<td style="width:187px;">Applied Biosystem</td>
			<td style="width:131px;">4351405</td>
			<td style="width:396px;">96-well Block module</td>
		</tr>
	</tbody>
</table>

cell aggregation assays to evaluate the binding of the drosophila notch with trans-ligands and its inhibition by cis-ligands

Notch signaling is an evolutionarily conserved cell-cell communication system used broadly in animal development and adult maintenance. Interaction of the Notch receptor with ligands from neighboring cells induces activation of the signaling pathway (trans-activation), while interaction with ligands from the same cell inhibits signaling (cis-inhibition). Proper balance between trans-activation and cis-inhibition helps establish optimal levels of Notch signaling in some contexts during animal development. Because of the overlapping expression domains of Notch and its ligands in many cell types and the existence of feedback mechanisms, studying the effects of a given post-translational modification on trans- versus cis-interactions of Notch and its ligands in vivo is difficult. Here, we describe a protocol for using Drosophila S2 cells in cell-aggregation assays to assess the effects of knocking down a Notch pathway modifier on the binding of Notch to each ligand in trans and in cis. S2 cells stably or transiently transfected with a Notch-expressing vector are mixed with cells expressing each Notch ligand (S2-Delta or S2-Serrate). Trans-binding between the receptor and ligands results in the formation of heterotypic cell aggregates and is measured in terms of the number of aggregates per mL composed of &#62;6 cells. To examine the inhibitory effect of cis-ligands, S2 cells co-expressing Notch and each ligand are mixed with S2-Delta or S2-Serrate cells and the number of aggregates is quantified as described above. The relative decrease in the number of aggregates due to the presence of cis-ligands provides a measure of cis-ligand-mediated inhibition of trans-binding. These straightforward assays can provide semi-quantitative data on the effects of genetic or pharmacological manipulations on the binding of Notch to its ligands, and can help deciphering the molecular mechanisms underlying the in vivo effects of such manipulations on Notch signaling.

Our in vivo observations suggested that loss of the xylosyltransferase gene shams results in gain of Notch signaling due to increased Delta-mediated trans-activation of Notch without affecting the cis-inhibition of Notch by ligands8. To test this notion, in vitro cell aggregation assays were performed. First, shams expression in S2 cells was knocked down using shams dsRNA. EGFP dsRNA was used a...

Watch this Scientific Journal Video about Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands at JoVE.com

Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Complexity of in vivo systems makes it difficult to distinguish between the activation and inhibition of Notch receptor by trans- and cis-ligands, respectively. Here, we present a protocol based on in vitro cell-aggregation assays for qualitative and semi-quantitative evaluation of the binding of Drosophila Notch to trans-ligands vs cis-ligands.

Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Notch signaling is an evolutionarily conserved cell-cell communication system used broadly in animal development and adult maintenance. Interaction of the ...

cell-aggregation-assays-to-evaluate-binding-drosophila-notch-with

Research

JoVE Journal

Developmental Biology

7.4K Views.  Baylor College of Medicine. Complexity of in vivo systems makes it difficult to distinguish between the activation and inhibition of Notch receptor by trans- and cis-ligands, respectively. Here, we present a protocol based on in vitro cell-aggregation assays for qualitative and semi-quantitative evaluation of the binding of Drosophila Notch to trans-ligands vs cis-ligands.

Video: Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Production and Use of Lentivirus to Selectively Transduce Primary Oligodendrocyte Precursor Cells for In Vitro Myelination Assays

Myelination is a complex process that involves both neurons and the myelin forming glial cells, oligodendrocytes in the central nervous system (CNS) and Schwann cells in the peripheral nervous system (PNS). We use an in vitro myelination assay, an established model for studying CNS myelination in vitro. To do this, oligodendrocyte precursor cells (OPCs) are added to the purified primary rodent dorsal root ganglion (DRG) neurons to form myelinating co-cultures. In order to specifically interrogate the roles that particular proteins expressed by oligodendrocytes exert upon myelination we have developed protocols that selectively transduce OPCs using the lentivirus overexpressing wild type, constitutively active or dominant negative proteins before being seeded onto the DRG neurons. This allows us to specifically interrogate the roles of these oligodendroglial proteins in regulating myelination. The protocols can also be applied in the study of other cell types, thus providing an approach that allows selective manipulation of proteins expressed by a desired cell type, such as oligodendrocytes for the targeted study of signaling and compensation mechanisms. In conclusion, combining the in vitro myelination assay with lentiviral infected OPCs provides a strategic tool for the analysis of molecular mechanisms involved in myelination.

Production and Use of Lentivirus to Selectively Transduce Primary Oligodendrocyte Precursor Cells for In Vitro Myelination Assays

Here we present protocols that offer a flexible and strategic foundation for virally manipulating oligodendrocyte precursor cells to overexpress proteins of interest in order to specifically interrogate their role in oligodendrocytes via the in vitro model of central nervous system myelination.

Myelination is a complex process that involves both neurons and the myelin forming glial cells, oligodendrocytes in the central nervous system (CNS) and ...

Assaying Blood Cell Populations of the Drosophila melanogaster Larva

In vertebrates, hematopoiesis is regulated by inductive microenvironments (niches). Likewise, in the invertebrate model organism&#160;Drosophila melanogaster, inductive microenvironments known as larval Hematopoietic Pockets (HPs) have been identified as anatomical sites for the development and regulation of blood cells (hemocytes), in particular of the self-renewing macrophage lineage.&#160;HPs are segmentally repeated pockets between the epidermis and muscle layers of the larva, which also comprise sensory neurons of the peripheral nervous system. In the larva, resident (sessile) hemocytes are exposed to anti-apoptotic, adhesive and proliferative cues from these sensory neurons and potentially other components of the HPs, such as the lining muscle and epithelial layers. During normal development, gradual release of resident hemocytes from the HPs fuels the population of circulating hemocytes, which culminates in the release of most of the resident hemocytes at the beginning of metamorphosis. Immune assaults, physical injury or mechanical disturbance trigger the premature release of resident hemocytes into circulation. The switch of larval hemocytes between resident locations and circulation raises the need for a common standard/procedure to selectively isolate and quantify these two populations of blood cells from single Drosophila larvae. Accordingly, this protocol describes an automated method to release and quantify the resident and circulating hemocytes from single larvae. The method facilitates ex vivo approaches, and may be adapted to serve a variety of developmental stages of Drosophila and other invertebrate organisms.

Assaying Blood Cell Populations of the Drosophila melanogaster Larva

Drosophila blood cells, or hemocytes, cycle between resident sites and circulation. In the larva, resident (sessile) hemocytes localize to inductive microenvironments, the Hematopoietic Pockets, while circulating hemocytes move freely in the hemolymph. The goal of this protocol is the standardized isolation and quantification of these two, behaviorally distinct but interchanging, hemocyte populations.

In vertebrates, hematopoiesis is regulated by inductive microenvironments (niches). Likewise, in the invertebrate model organism&#160;Drosophila ...

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is the formation of fibroblastic foci, which is associated with the disease severity. Mesenchymal cells consisting of the fibroblastic foci are proposed to be derived from several cell sources, including originally resident intrapulmonary fibroblasts and circulating fibrocytes from bone marrow. Recently, mesenchymal cells that underwent epithelial-mesenchymal transition (EMT) have been also supposed to contribute to the pathogenesis of fibrosis. In addition, EMT can be induced by transforming growth factor &#946;, and EMT can be enhanced by pro-inflammatory cytokines like tumor necrosis factor &#945;. The gel contraction assay is an ideal in vitro model for the evaluation of contractility, which is one of the characteristic functions of fibroblasts and contributes to wound repair and fibrosis. Here, the development of a gel contraction assay is demonstrated for evaluating contractile ability of mesenchymal cells that underwent EMT.

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is ...

Methods to Examine the Lymph Gland and Hemocytes in Drosophila Larvae

Many parallels exist between the Drosophila and mammalian hematopoietic systems, even though Drosophila lack the lymphoid lineage that characterize mammalian adaptive immunity. Drosophila and mammalian hematopoiesis occur in spatially and temporally distinct phases to produce several blood cell lineages. Both systems maintain reservoirs of blood cell progenitors with which to expand or replace mature lineages. The hematopoietic system allows Drosophila and mammals to respond to and to adapt to immune challenges. Importantly, the transcriptional regulators and signaling pathways that control the generation, maintenance, and function of the hematopoietic system are conserved from flies to mammals. These similarities allow Drosophila to be used to genetically model hematopoietic development and disease.
Here we detail assays to examine the hematopoietic system of Drosophila larvae. In particular, we outline methods to measure blood cell numbers and concentration, visualize a specific mature lineage in vivo, and perform immunohistochemistry on blood cells in circulation and in the hematopoietic organ. These assays can reveal changes in gene expression and cellular processes including signaling, survival, proliferation, and differentiation and can be used to investigate a variety of questions concerning hematopoiesis. Combined with the genetic tools available in Drosophila, these assays can be used to evaluate the hematopoietic system upon defined genetic alterations. While not specifically outlined here, these assays can also be used to examine the effect of environmental alterations, such as infection or diet, on the hematopoietic system.

Methods to Examine the Lymph Gland and Hemocytes in Drosophila Larvae

Drosophila and mammalian hematopoietic systems share many common features, making Drosophila an attractive genetic model to study hematopoiesis. Here we demonstrate dissection and mounting of the major larval hematopoietic organ for immunohistochemistry. We also describe methods to assay various larval hematopoietic compartments including circulating hemocytes and sessile crystal cells.

Many parallels exist between the Drosophila and mammalian hematopoietic systems, even though Drosophila lack the lymphoid lineage that characterize ...

Stimulation of Notch Signaling in Mouse Osteoclast Precursors

Notch signaling is a key component of multiple physiological and pathological processes. The nature of Notch signaling, however, makes in vitro investigation of its varying and sometimes contradictory roles a challenge. As a component of direct cell-cell communication with both receptors and ligands bound to the plasma membrane, Notch signaling cannot be activated in vitro by simple addition of ligands to culture media, as is possible with many other signaling pathways. Instead, Notch ligands must be presented to cells in an immobilized state. 
Variations in methods of Notch signaling activation can lead to different outcomes in cultured cells. In osteoclast precursors, in particular, differences in methods of Notch stimulation and osteoclast precursor culture and differentiation have led to disagreement over whether Notch signaling is a positive or negative regulator of osteoclast differentiation. While closer comparisons of osteoclast differentiation under different Notch stimulation conditions in vitro and genetic models have largely resolved the controversy regarding Notch signaling and osteoclasts, standardized methods of continuous and temporary stimulation of Notch signaling in cultured cells could prevent such discrepancies in the future.
This protocol describes two methods for stimulating Notch signaling specifically in cultured mouse osteoclast precursors, though these methods should be applicable to any adherent cell type with minor adjustments. The first method produces continuous stimulation of Notch signaling and involves immobilizing Notch ligand to a tissue culture surface prior to the seeding of cells. The second, which uses Notch ligand bound to agarose beads allows for temporary stimulation of Notch signaling in cells that are already adhered to a culture surface. This protocol also includes methods for detecting Notch activation in osteoclast precursors as well as representative transcriptional markers of Notch signaling activation.

Notch signaling is a form of cellular communication that relies upon direct contact between cells. To properly induce Notch signaling in vitro, Notch ligands must be presented to cells in an immobilized state. This protocol describes methods for in vitro stimulation of Notch signaling in mouse osteoclast precursors.

Notch signaling is a key component of multiple physiological and pathological processes. The nature of Notch signaling, however, makes in vitro ...

Bioengineering of Humanized Bone Marrow Microenvironments in Mouse and Their Visualization by Live Imaging

Human hematopoietic stem cells (HSCs) reside in the bone marrow (BM) niche, an intricate, multifactorial network of components producing cytokines, growth factors, and extracellular matrix. The ability of HSCs to remain quiescent, self-renew or differentiate, and acquire mutations and become malignant depends upon the complex interactions they establish with different stromal components. To observe the crosstalk between human HSCs and the human BM niche in physiological and pathological conditions, we designed a protocol to ectopically model and image a humanized BM niche in immunodeficient mice. We show that the use of different cellular components allows for the formation of humanized structures and the opportunity to sustain long-term human hematopoietic engraftment. Using two-photon microscopy, we can live-image these structures in situ at the single-cell resolution, providing a powerful new tool for the functional characterization of the human BM microenvironment and its role in regulating normal and malignant hematopoiesis.

A method to create and live-image different humanized bone-marrow niches in mice is presented. Based on the supportive niche created by human mesenchymal cells, the addition of human endothelial cells induces the formation of human vessels, while the addition of rhBMP-2 induces the formation of human-mouse chimeric mature bone tissue.

Human hematopoietic stem cells (HSCs) reside in the bone marrow (BM) niche, an intricate, multifactorial network of components producing cytokines, growth ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

Three-dimensional Rendering and Analysis of Immunolabeled, Clarified Human Placental Villous Vascular Networks

Nutrient and gas exchange between mother and fetus occurs at the interface of the maternal intervillous blood and the vast villous capillary network that makes up much of the parenchyma of the human placenta. The distal villous capillary network is the terminus of the fetal blood supply after several generations of branching of vessels extending out from the umbilical cord. This network has a contiguous cellular sheath, the syncytial trophoblast barrier layer, which prevents mixing of fetal blood and the maternal blood in which it is continuously bathed. Insults to the integrity of the placental capillary network, occurring in disorders such as maternal diabetes, hypertension and obesity, have consequences that present serious health risks for the fetus, infant, and adult. To better define the structural effects of these insults, a protocol was developed for this study that captures capillary network structure on the order of 1 - 2 mm3 wherein one can investigate its topological features in its full complexity. To accomplish this, clusters of terminal villi from placenta are dissected, and the trophoblast layer and the capillary endothelia are immunolabeled. These samples are then clarified with a new tissue clearing process which makes it possible to acquire confocal image stacks to z- depths of ~1 mm. The three-dimensional renderings of these stacks are then processed and analyzed to generate basic capillary network measures such as volume, number of capillary branches, and capillary branch end points, as validation of the suitability of this approach for capillary network characterization.

This study presents a protocol for the reversible tissue clearing, immunostaining, 3D-rendering and analysis of vascular networks in human placenta villi samples on the order of 1 - 2 mm3.

Nutrient and gas exchange between mother and fetus occurs at the interface of the maternal intervillous blood and the vast villous capillary network that ...

Probing Cell Mechanics with Bead-Free Optical Tweezers in the Drosophila Embryo

Morphogenesis requires coordination between genetic patterning and mechanical forces to robustly shape the cells and tissues. Hence, a challenge to understand morphogenetic processes is to directly measure cellular forces and mechanical properties in vivo during embryogenesis. Here, we present a setup of optical tweezers coupled to a light sheet microscope, which allows to directly apply forces on cell-cell contacts of the early Drosophila embryo, while imaging at a speed of several frames per second. This technique has the advantage that it does not require the injection of beads into the embryo, usually used as intermediate probes on which optical forces are exerted. We detail step by step the implementation of the setup, and propose tools to extract mechanical information from the experiments. By monitoring the displacements of cell-cell contacts in real time, one can perform tension measurements and investigate cell contacts&#39; rheology.

Probing Cell Mechanics with Bead-Free Optical Tweezers in the Drosophila Embryo

We present a setup of optical tweezers coupled to a light sheet microscope, and its implementation to probe cell mechanics without beads in the Drosophila embryo.

Morphogenesis requires coordination between genetic patterning and mechanical forces to robustly shape the cells and tissues. Hence, a challenge to ...

A Cell-based Assay to Investigate Non-muscle Myosin II Contractility via the Folded-gastrulation Signaling Pathway in Drosophila S2R+ Cells

We have developed a cell-based assay using Drosophila cells that recapitulates apical constriction initiated by folded gastrulation (Fog), a secreted epithelial morphogen. In this assay, Fog is used as an agonist to activate Rho through a signaling cascade that includes a G-protein-coupled receptor (Mist), a G&#945;12/13 protein (Concertina/Cta), and a PDZ-domain-containing guanine nucleotide exchange factor (RhoGEF2). Fog signaling results in the rapid and dramatic reorganization of the actin cytoskeleton to form a contractile purse string. Soluble Fog is collected from a stable cell line and applied ectopically to S2R+ cells, leading to morphological changes like apical constriction, a process observed during developmental processes such as gastrulation. This assay is amenable to high-throughput screening and, using RNAi, can facilitate the identification of additional genes involved in this pathway.

A Cell-based Assay to Investigate Non-muscle Myosin II Contractility via the Folded-gastrulation Signaling Pathway in Drosophila S2R+ Cells

Here we describe a contractility assay using Drosophila S2R+ cells. The application of an exogenous ligand, folded gastrulation (Fog), leads to the activation of the Fog signaling pathway and cellular contractility. This assay can be used to investigate the regulation of cellular contractility proteins in the Fog signaling pathway.

We have developed a cell-based assay using Drosophila cells that recapitulates apical constriction initiated by folded gastrulation (Fog), a secreted ...