This work is supported by the National Natural Science Foundation of China (82060341,81560304) and by the Academician Innovation Platform Scientific Research Project of Hainan Province (YSPTZX202134).

NOTE: A total of five samples of C. megacephala samples were used in this protocol-three fresh samples (Fresh 1, Fresh 2, and Fresh 3), one sample stored in alcohol for 2 years (Old 1), and one sample stored in dry sealed storage for 2 years protected from light only (Old 2). Samples must be labeled according to the experimental requirements.
1. General sample storage and preparations
<ol>
	<li>Sample selection and preparation 
	NOTE: Be sure to work in the fume hood when applying ethyl acetate to execute necrophagous flies. Remove the liquid from the surface of the fly before weighing.
	<ol>
		<li>Fresh samples: Place three collected fly samples in gas vials after killing them with ethyl acetate. Weigh and name the samples as Fresh 1, Fresh 2, and Fresh 3 and use them immediately in experiments. 
		NOTE: The fresh fly samples in this protocol had masses of 56.8 mg, 49.3 mg, and 52.1 mg.</li>
		<li>Old sample 1: Take out fly samples killed by ethyl acetate and stored in alcohol-filled centrifuge tubes for 2 years in airtight containment, protected from light at room temperature. Weigh the sample after adsorbing the surface liquid with filter paper; call it Old 1. 
		NOTE: The mass of Old 1 was 42.3 mg in this protocol.</li>
		<li>Old sample 2: Take out the fly sample killed by ethyl acetate and stored in a centrifuge tube for 2 years in airtight containment, protected from light at room temperature. Weigh and call it Old 2.</li>
	</ol>
	</li>
	<li>Preparation before extraction
	<ol>
		<li>Add a small amount of liquid nitrogen to cool a stainless steel container; wait until all liquid nitrogen has evaporated.</li>
		<li>Put a fly sample in the container; pour in the liquid nitrogen slowly to prevent the liquid nitrogen from splashing and impacting the insect sample.</li>
		<li>Freeze the samples in liquid nitrogen. Remove samples after the liquid nitrogen evaporates.</li>
		<li>Separate the thorax individually, place in a 2 mL centrifuge tube, and cut into the smallest possible slices. 
		NOTE: Cut the sample into small pieces so that it can be fully cleaved, and DNA can be released in large quantities.</li>
		<li>Repeat the above steps for each fly, individually freeze, and then remove to a new centrifuge tube to prevent DNA cross-contamination.</li>
	</ol>
	</li>
</ol>
2. DNA extraction
NOTE: All centrifugation steps must be carried out at room temperature (15-25 &#176;C) in a microcentrifuge. All steps must be performed in strict adherence to the principles of asepsis and to avoid cross-contamination.
<ol>
	<li>Tissue lysis
	<ol>
		<li>Add 180 &#181;L of tissue lysis buffer to a 2 mL centrifuge tube containing a clipped sample.</li>
		<li>Add 20 &#181;L of proteinase K. Mix thoroughly by vortexing at 3 000 rpm for 10 s and incubate at 56 &#176;C until the insect tissues are completely lysed. 
		NOTE: Add more Proteinase K should be if the tissue is not fully digested. Lysis is usually complete in 1-3h, also can extend lysis time overnight.</li>
	</ol>
	</li>
	<li>DNA precipitation
	<ol>
		<li>Vortex at 3,000 rpm for 15 s. Add 200 &#181;L lysis buffer to the sample, and mix thoroughly by vortexing at 3,000 rpm for 15 s.</li>
		<li>Add 200 &#181;L of ethanol (96-100%) and mix again thoroughly by vortexing at 3,000 rpm for 15 s. 
		NOTE: Lysis buffer and ethanol can be preadded together in one step to save time. A white precipitate may form on the addition of lysis buffer and ethanol.</li>
	</ol>
	</li>
	<li>Pipet the mixture into the DNA adsorption column placed in a 2 mL collection tube. Centrifuge at 6,000 &#215; g for 1 min. Discard flowthrough and collection tube.</li>
	<li>Place the DNA adsorption column from the previous step in a new 2 mL collection tube, add 500 &#181;L of protein removal buffer, and centrifuge at 6,000 &#215; g for 1 min. Discard flowthrough and collection tube.</li>
	<li>Transfer the DNA adsorption column to a new 2 mL collection tube, add 500 &#181;L of desalination buffer, and centrifuge at 20,000 &#215; g for 3 min to dry the DNA adsorption column membrane. Discard flowthrough and collection tube. 
	NOTE: This centrifugation step ensures the removal of any residual ethanol before the following elution. If there is any carryover of ethanol, centrifuge again at 20,000 &#215; g for 1 min.</li>
	<li>Place the DNA adsorption column in a clean 2 mL microcentrifuge tube, directly pipet 100 &#181;L of DNA elution buffer onto the column membrane, incubate at room temperature for 1 min, and then centrifuge at 6,000 &#215; g for 1 min to elute. 
	NOTE: Elution with 100 &#181;L (instead of 200 &#181;L) increases the final DNA concentration in the eluate but also decreases the overall DNA yield. To maximize the DNA yield, repeat elution once as described in step 2.8.</li>
	<li>Store the DNA samples at 4 &#176;C (up to 1 week) or -80 &#176;C for long-term storage.</li>
</ol>
3. DNA concentration detection
<ol>
	<li>Determine the values of OD 260 and OD 280 to compare DNA purity and nucleic acid concentration by microplate reader. Repeat three times on each sample.</li>
	<li>Determine the concentration of the extracted DNA by fluorometer using its companion kit, with three replicates for each sample.
	<ol>
		<li>Take 190 &#181;L of working solution into two 0.5 mL centrifuge tubes, take 10 &#181;L each of Standard #1 and Standard #2, add them to the working solutions, and keep them away from light for not less than 15 min. 
		NOTE: Standard #1 and Standard #2 are accurately calibrated for a certain concentration of DNA. Standard solutions should be accurately configured to ensure the formation of an accurate standard curve. Standard #1 is a 0.2 ng/&#181;L double-stranded DNA (dsDNA) sample; standard #2 is 2,000 ng/&#181;L. The working solution is a dye that binds specifically to dsDNA.</li>
		<li>Take 2 &#181;L of test DNA and mix it with 198 &#181;L of working solution in a 0.5 mL centrifuge tube, and keep away from light for not less than 15 min. 
		NOTE: If the DNA concentration is low, add 5 &#181;L of test DNA with 195 &#181;L of working solution.</li>
		<li>After 15 min, turn on the instrument and select dsDNA Concentration Measurement | Long Range. First, test Standard #1, and then, Standard #2 to obtain the standard curve. 
		NOTE: The standard solution must be used on the same day after it is configured; leaving it for too long will result in a large error in the standard curve.</li>
		<li>Place the samples to be tested in the assay wells one by one, adjust the DNA spiking volume to 2 &#181;L, repeat the measurement three times, take the average value, and record.</li>
	</ol>
	</li>
</ol>
4. PCR and electrophoretic detection
NOTE: The mitochondrial CO <img alt="Equation 1" src="/files/ftp_upload/66737/66737eq01v2.jpg" style="margin: auto;" /> gene sequence with a length of 278 bp was taken for PCR amplification with forward primer C1-J-2495: CAGCTACTTTATGAGCTTTAGG, and reverse primer C1-N-2800: CATTTCAAGCTGTGTAAGCATC8, and then 2% agarose gel electrophoresis done to verify the amplification effect and amplification products&#39; length was verified.
<ol>
	<li>Set up 20 &#181;L of the PCR amplification system by adding 10 &#181;L of 2x Taq mix, 1 &#181;L of each primer, 5 &#181;L of ddH2O, and 3 &#181;L of template DNA; mix well for 10 s in a centrifuge.</li>
	<li>Use the following PCR cycling parameters: predenaturation 95 &#176;C for 10 min; denaturation 95 &#176;C for 30 s, annealing 48 &#176;C for 30 s, extension 72 &#176;C for 45 s for a total of 40 cycles; and final extension 72 &#176;C for 10 min.</li>
	<li>Subject the products after PCR to 2% agarose gel electrophoresis, and after electrophoresis, place them on a gel imaging system for photo analysis.</li>
</ol>

Assessing DNA Purity and Concentration in Fresh and Old Necrophilic Fly Samples

<ol>
	<li>Amendt, J., Richards, C. S., Campobasso, C. P., Zehner, R., Hall, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forensic+entomology:+applications+and+limitations.">Forensic entomology: applications and limitations.</a> Forensic Sci Med Pathol. 7 (4), 379-392 (2011).</li><li>Wydra, J., Matuszewski, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+optimal+post-eclosion+interval+while+estimating+the+post-mortem+interval+based+on+an+empty+puparium.">The optimal post-eclosion interval while estimating the post-mortem interval based on an empty puparium.</a> Forensic Sci Med Pathol. 17 (2), 192-198 (2021).</li><li>Mazzanti, M., Alessandrini, F., Tagliabracci, A., Wells, J. D., Campobasso, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+degradation+and+genetic+analysis+of+empty+puparia:+genetic+identification+limits+in+forensic+entomology.">DNA degradation and genetic analysis of empty puparia: genetic identification limits in forensic entomology.</a> Forensic Sci Int. 195 (1-3), 99-102 (2010).</li><li>Odeniran, P. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=molecular+identification+and+distribution+of+Trypanosome-transmitting+Dipterans+from+cattle+settlements+in+Southwest+Nigeria.">molecular identification and distribution of Trypanosome-transmitting Dipterans from cattle settlements in Southwest Nigeria.</a> Acta Parasitol. 66 (1), 116-128 (2021).</li><li>Wells, J. D., Stevens, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+DNA-based+methods+in+forensic+entomology.">Application of DNA-based methods in forensic entomology.</a> Annu Rev Entomol. 53, 103-120 (2008).</li><li>Kotrba, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+barcoding+in+forensic+entomology-establishing+a+DNA+reference+library+of+potentially+forensic+relevant+arthropod+species.">DNA barcoding in forensic entomology-establishing a DNA reference library of potentially forensic relevant arthropod species.</a> J Forensic Sci. 64 (2), 593-601 (2019).</li><li>Weedon, M. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+SNP+chips+to+detect+rare+pathogenic+variants:+Retrospective,+population+based+diagnostic+evaluation.">Use of SNP chips to detect rare pathogenic variants: Retrospective, population based diagnostic evaluation.</a> BMJ. 372, 214 (2021).</li><li>Cai, J. -. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+availability+of+mitochondrial+DNA+cytochrome+oxidasegene+for+the+distinction+of+forensically+important+flies+in+China.">The availability of mitochondrial DNA cytochrome oxidasegene for the distinction of forensically important flies in China.</a> Acta Entomologica Sinica. 48 (3), 380-385 (2005).</li><li>Khayrova, A., Lopatin, S., Varlamov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obtaining+chitin,+chitosan+and+their+melanin+complexes+from+insects.">Obtaining chitin, chitosan and their melanin complexes from insects.</a> Int J Biol Macromol. 167, 1319-1328 (2021).</li><li>Guo, Y. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+DNA+extracting+methods+from+different+parts+of+common+necrophagous+flies.">Comparison of three DNA extracting methods from different parts of common necrophagous flies.</a> J Henan Univ Sci Tech (Med Sci). 36 (02), 130-133 (2018).</li><li>Du, H., Xie, H., Ma, M., Igarashi, Y., Luo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modified+methods+obtain+high-quality+DNA+and+RNA+from+anaerobic+activated+sludge+at+a+wide+range+of+temperatures.">Modified methods obtain high-quality DNA and RNA from anaerobic activated sludge at a wide range of temperatures.</a> J Microbiol Methods. 199, 106532 (2022).</li><li>Sukumaran, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concentration+determination+of+nucleic+acids+and+proteins+using+the+micro-volume+BioSpec-nano-spectrophotometer.">Concentration determination of nucleic acids and proteins using the micro-volume BioSpec-nano-spectrophotometer.</a> J Vis Exp. (48), e2699 (2011).</li><li>Masago, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+between+fluorimetry+(Qubit)+and+spectrophotometry+(NanoDrop)+in+the+quantification+of+DNA+and+RNA+extracted+from+frozen+and+FFPE+tissues+from+lung+cancer+patients:+A+real-world+use+of+genomic+tests.">Comparison between fluorimetry (Qubit) and spectrophotometry (NanoDrop) in the quantification of DNA and RNA extracted from frozen and FFPE tissues from lung cancer patients: A real-world use of genomic tests.</a> Medicina (Kaunas). 57 (12), 1375 (2021).</li><li>Ponti, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+value+of+fluorimetry+(Qubit)+and+spectrophotometry+(NanoDrop)+in+the+quantification+of+cell-free+DNA+(cfDNA)+in+malignant+melanoma+and+prostate+cancer+patients.">The value of fluorimetry (Qubit) and spectrophotometry (NanoDrop) in the quantification of cell-free DNA (cfDNA) in malignant melanoma and prostate cancer patients.</a> Clin Chim Acta. 479, 14-19 (2018).</li><li>Adams, Z. J., Hall, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+used+for+the+killing+and+preservation+of+blowfly+larvae,+and+their+effect+on+post-mortem+larval+length.">Methods used for the killing and preservation of blowfly larvae, and their effect on post-mortem larval length.</a> Forensic Sci Int. 138 (1-3), 50-61 (2003).</li><li>Fliegerova, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+DNA+extraction+and+sample+preservation+method+on+rumen+bacterial+population.">Effect of DNA extraction and sample preservation method on rumen bacterial population.</a> Anaerobe. 29, 80-84 (2014).</li><li>Rodrigues, B. L., Galati, E. A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+taxonomy+of+phlebotomine+sand+flies+(Diptera,+Psychodidae)+with+emphasis+on+DNA+barcoding:+A+review.">Molecular taxonomy of phlebotomine sand flies (Diptera, Psychodidae) with emphasis on DNA barcoding: A review.</a> Acta Trop. 238, 106778 (2023).</li></ol>

The authors declare that they have no competing financial interests.

DNA extraction is the most critical link in the molecular identification of necrophilous flies, and its extraction method and the quality of the extracted DNA directly affect subsequent detection. In this experiment, we successfully extracted DNA from necrophilous flies by using a common blood kit, without the need to purchase a special insect DNA extraction kit, which makes insect DNA extraction easier to accomplish.
The surface of flies is rich in chitin, especially in the larval and pupal s...

<a href="https://app.jove.com/t/6604">This corrects</a> the article <a href="https://dx.doi.org/10.3791/66737">10.3791/66737</a>

An erratum was issued for:&#160;<a href="https://www.jove.com/t/66737">DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples</a>. The Authors section was updated.

Erratum: DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples

The inference of the time of death has always been one of the key and difficult issues to be resolved in judicial practice. In the practice of forensic science, for a criminal case, determining postmortem interval plays a crucial role in deducing the time of the crime, locking in the suspect, and narrowing the scope of the investigation. Traditional methods of inferring the time of death are based primarily on early postmortem phenomena, which can generally only be used to infer the time of death within 24 h. However, the long time of death cannot be determined by postmortem phenomena. It is now generally recognized in the forensic science community that forensic entomology has the potential to be an effective method of inferring a longer time of death.
Necrophagous insects are named for their larvae that feed on corpses. Among them, whenever a corpse is present, the adult necrophilous flies will be the first to reach the corpse and lay their eggs or larvae. The larvae feed on corpse tissue and mature into pupae, which fledge into adults. Necrophilic flies play a huge role in the practice of forensic science because of their regular life cycle and geographic distribution, for example, deducting the time of death and determining the place of death1,2. However, the barrier to the use of necrophilous flies in forensic practice is species identification. Morphological methods are still used as the authoritative method for species identification of necrophilous flies. However, morphological species identification requires a high degree of insect integrity. If the flies were in different developmental stages, or due to morphological changes caused by environmental choices, those all make morphological examination more difficult. In particular, the morphology of pupae and pupal shells, which are most often found at the crime scene, is barely recognizable. This, together with the scarcity of morphological experts, makes huge difficulty to the identification of species morphologically. Therefore, the application of molecular biology methods for species identification of flies has emerged, which reduces the difficulty of morphological identification and is independent of developmental stage3,4,5,6,7.
The first step in species identification of necrophilous flies based on molecular biology methods is the efficient extraction of DNA, while specialized kits for insect DNA extraction are not commonly available currently. And how to use common blood kits for DNA extraction of necrophilic flies becomes more forensically relevant. Necrophilic flies found at crime scenes are often mutilated or have undergone decay and DNA degradation. Fly samples are not immediately available for DNA extraction after acquisition, or if possible, complete samples need to be retained due to evidence preservation requirements. Based on the above requirements, in this study, we applied the blood DNA kit based on proteinase K digestion, and selected three fresh Chrysomya megacephala (Diptera, Lepidoptera) samples (Figure 1), one old C. megacephala sample placed in alcohol for two years, and one C. megacephala sample placed in light-protected storage for two years, weighed each of the five samples, elected the insect thorax tissue for DNA extraction. Comparing the quality and purity of DNA extracted from the old and new samples, PCR amplification and electrophoresis of the extracted DNA were performed with necrophilic fly-specific primers located in the mitochondrial CO <img alt="Equation 1" src="/files/ftp_upload/66737/66737eq01v2.jpg" style="margin: auto;" /> gene sequence.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Buffer AE</td>
			<td>Qiagen</td>
			<td>172026832</td>
			<td>DNA elution buffer</td>
		</tr>
		<tr>
			<td>Buffer AL</td>
			<td>Qiagen</td>
			<td>172028374</td>
			<td>lysis buffer</td>
		</tr>
		<tr>
			<td>Buffer ATL</td>
			<td>Qiagen</td>
			<td>172028162</td>
			<td>tissue lysis buffer</td>
		</tr>
		<tr>
			<td>Buffer AW1</td>
			<td>Qiagen</td>
			<td>172028760</td>
			<td>protein removal buffer</td>
		</tr>
		<tr>
			<td>Buffer AW2</td>
			<td>Qiagen</td>
			<td>57203108</td>
			<td>desalination buffer</td>
		</tr>
		<tr>
			<td>C1-J-2495</td>
			<td>Taihe Biotechnology</td>
			<td>TW21109216</td>
			<td>forword primer</td>
		</tr>
		<tr>
			<td>C1-N-2800</td>
			<td>Taihe Biotechnology</td>
			<td>TW21109217</td>
			<td>reverse primer</td>
		</tr>
		<tr>
			<td>D2000 DNA ladder</td>
			<td>Real-Times(Beijing) Biotechnology</td>
			<td>RTM415</td>
			<td>Measure the position of electrophoretic bands</td>
		</tr>
		<tr>
			<td>DNeasy Mini spin column</td>
			<td>Qiagen</td>
			<td>166050343</td>
			<td>DNA adsorption column</td>
		</tr>
		<tr>
			<td>Dry Bath Incubator</td>
			<td>Miulab</td>
			<td>DKT200-2D</td>
			<td>used for heating</td>
		</tr>
		<tr>
			<td>MIX-30S Mini Mixer</td>
			<td>Miulab</td>
			<td>MUC881206</td>
			<td>oscillatory action</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Qiagen</td>
			<td>172026218</td>
			<td>Inactivation of intracellular nucleases and other proteins</td>
		</tr>
		<tr>
			<td>Qubit 3.0 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>2321611188</td>
			<td></td>
		</tr>
		<tr>
			<td>Speed Micro-Centrifuge</td>
			<td>Scilogex</td>
			<td>9013001121</td>
			<td>centrifuge</td>
		</tr>
		<tr>
			<td>Standard#1</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
		<tr>
			<td>Standard#2</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
		<tr>
			<td>Tanon 3500R Gel Imager</td>
			<td>Tanon</td>
			<td>16T5553R-455</td>
			<td>gel imaging</td>
		</tr>
		<tr>
			<td>Taq Mix Pro</td>
			<td>Monad</td>
			<td>00007808-140534</td>
			<td>PCR Mix</td>
		</tr>
		<tr>
			<td>Taq Mix Pro</td>
			<td>Monad</td>
			<td>00007808-140534</td>
			<td>PCR Mix</td>
		</tr>
		<tr>
			<td>Thermo Cycler</td>
			<td>Zhuhai Hema</td>
			<td>VRB020A</td>
			<td>ordinary PCR</td>
		</tr>
		<tr>
			<td>Working Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
	</tbody>
</table>

dna extraction and comparison between old and fresh necrophilic fly samples

A total of five samples of Chrysomya megacephala samples - three fresh samples, one sample stored in alcohol for 2 years, and one sample stored in dry sealed storage for 2 years protected from light only - were selected to investigate whether a blood DNA extraction kit could extract DNA from necrophilous flies and to determine whether alcohol could prolong the preservation of necrophilous flies&#39; DNA. First, the blood DNA extraction kit was used to extract DNA from their thorax tissues. Then, the DNA purity and concentration were examined using a microplate reader and a fluorometer. Finally, PCR amplification and electrophoresis of the extracted DNA were done with necrophilic fly-specific primers located in the mitochondrial CO I gene sequence. The results showed that the DNA purity of all samples was greater than 2.0. The DNA concentration was observed to be of the following order: fresh samples &#62; alcohol-preserved old samples &#62; untreated, old samples. All samples had specific electrophoretic bands after PCR amplification. In conclusion, a blood DNA extraction kit can be used to extract DNA from necrophilic flies successfully, and the DNA concentration of fresh fly samples is greater than that of old fly samples. The flies can be stored in alcohol for a long time.

We used a microplate reader to measure the values of OD260 and OD280 of the extracted DNA solution and then obtained the OD260/OD280 values to evaluate the purity of the DNA. The OD260/OD280 of all fresh samples and old sample 1 was greater than 2. The OD260/OD280 of old sample 2 had a maximum value of 2.187 although the average was 1.753, and its three measurements fluctuated greatly due to the small (&#8804;0.01) values of both its OD280 and OD280 (Table 1). Based on the value of OD260 obtained, we est...

Read this Scientific Article Protocol about DNA Extraction and Comparison between Old and Fresh Necrophilic Fly Samples at JoVE.com

Author Spotlight: Advancing DNA Extraction from Necrophilic Fly Samples using Simple Technique

This article describes a protocol for fresh and old necrophilic fly DNA extraction using a modified common DNA extraction kit.

DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples

A total of five samples of Chrysomya megacephala samples - three fresh samples, one sample stored in alcohol for 2 years, and one sample stored in dry ...

dna-extraction-comparison-between-old-fresh-necrophilic-fly

Research

JoVE Journal

Medicine

334 Views.  Hainan Medical University, Hainan Provincial Academician Workstation (tropical forensic medicine). This article describes a protocol for fresh and old necrophilic fly DNA extraction using a modified common DNA extraction kit.

Video: Author Spotlight: Advancing DNA Extraction from Necrophilic Fly Samples using Simple Technique

Mass-Rearing and Molecular Studies in Tortricidae Pest Insects

Tortricidae (Lepidoptera), commonly known as tortrix or leafroller moths, comprises many agricultural and forestry pests, which cause serious agricultural losses. To understand the biology of such pest moths, fundamental techniques have been in high demand. Here, methods for mass-rearing, observations, and molecular studies are developed using two tea tortrix, Homona magnanima and Adoxophyes honmai (Lepidoptera: Tortricidae). Insects were mass-reared with sliced artificial diet and maintained by inbreeding for over 100 generations by considering their biological characteristics. Insects have various sex dimorphisms; hence it is difficult to distinguish the sex during the developing stages, which have prevented subsequent assays. The present work highlighted that the sex of tortricids larvae could be determined by observing testes or lactic-acetic orcein staining to visualize the female-specific W chromosome. Moreover, using the sex determination methods, the present study enabled nucleic acid extractions from sex determined embryos and application toward high throughput sequencing. These tips are applicable for other pest insects and will facilitate further morphological and genetic studies.

The present protocol describes the rearing method of tortricid pest insects in the laboratories. The procedures to distinguish insects' sex and extract nucleic acids for high throughput sequencing are established using two tortricid pests.

Tortricidae (Lepidoptera), commonly known as tortrix or leafroller moths, comprises many agricultural and forestry pests, which cause serious agricultural ...

Environment

Mass Histology to Quantify Neurodegeneration in Drosophila

Progressive neurodegenerative diseases like Alzheimer&#39;s disease (AD) or Parkinson&#39;s disease (PD) are an increasing threat to human health worldwide. Although mammalian models have provided important insights into the underlying mechanisms of pathogenicity, the complexity of mammalian systems together with their high costs are limiting their use. Therefore, the simple but well-established Drosophila model-system&#160;provides an alternative for investigating the molecular pathways that are affected in these diseases. Besides behavioral deficits, neurodegenerative diseases are characterized by histological phenotypes such as neuronal death and axonopathy. To quantify neuronal degeneration and to determine how it is affected by genetic and environmental factors, we use a histological approach that is based on measuring the vacuoles in adult fly brains. To minimize the effects of systematic error and to directly compare sections from control and experimental flies in one preparation, we use the &#39;collar&#39; method for paraffin sections. Neurodegeneration is then assessed by measuring the size and/or number of vacuoles that have developed in the fly brain. This can either be done by focusing on a specific region of interest or by analyzing the entire brain by obtaining serial sections that span the complete head. Therefore, this method allows one to measure not only severe degeneration but also relatively mild phenotypes that are only detectable in a few sections, as occurs during normal aging.

Mass Histology to Quantify Neurodegeneration in Drosophila

Drosophila is widely used as a model system to study neurodegeneration. This protocol describes a method by which degeneration, as determined by vacuole formation in the brain, can be quantified. It also minimizes effects due to the experimental procedure by processing and sectioning control and experimental flies as one sample.

Progressive neurodegenerative diseases like Alzheimer&#39;s disease (AD) or Parkinson&#39;s disease (PD) are an increasing threat to human health ...

Neuroscience

Purification of Transcripts and Metabolites from Drosophila Heads

For the last decade, we have tried to understand the molecular and cellular mechanisms of neuronal degeneration using Drosophila as a model organism. Although fruit flies provide obvious experimental advantages, research on neurodegenerative diseases has mostly relied on traditional techniques, including genetic interaction, histology, immunofluorescence, and protein biochemistry. These techniques are effective for mechanistic, hypothesis-driven studies, which lead to a detailed understanding of the role of single genes in well-defined biological problems. However, neurodegenerative diseases are highly complex and affect multiple cellular organelles and processes over time. The advent of new technologies and the omics age provides a unique opportunity to understand the global cellular perturbations underlying complex diseases. Flexible model organisms such as Drosophila are ideal for adapting these new technologies because of their strong annotation and high tractability. One challenge with these small animals, though, is the purification of enough informational molecules (DNA, mRNA, protein, metabolites) from highly relevant tissues such as fly brains. Other challenges consist of collecting large numbers of flies for experimental replicates (critical for statistical robustness) and developing consistent procedures for the purification of high-quality biological material. Here, we describe the procedures for collecting thousands of fly heads and the extraction of transcripts and metabolites to understand how global changes in gene expression and metabolism contribute to neurodegenerative diseases. These procedures are easily scalable and can be applied to the study of proteomic and epigenomic contributions to disease.

Purification of Transcripts and Metabolites from Drosophila Heads

We describe here the procedures for the extraction and purification of mRNA and metabolites from Drosophila heads. We are applying these techniques to better understand the cellular perturbations underlying neuronal degeneration. These methodologies can be easily scaled and adapted for other "omic" projects.

For the last decade, we have tried to understand the molecular and cellular mechanisms of neuronal degeneration using Drosophila as a model organism. ...

Biology

Visualizing Synaptic Degeneration in Adult Drosophila in Association with Neurodegeneration

Drosophila serves as a useful model for assessing synaptic structure and function associated with neurodegenerative diseases. While much work has focused on neuromuscular junctions (NMJs) in Drosophila larvae, assessing synaptic integrity in adult Drosophila has received much less attention. Here we provide a straightforward method for dissection of the dorsal longitudinal muscles (DLMs), which are required for flight ability. In addition to flight as a behavioral readout, this dissection allows for the both DLM synapses and muscle tissue to be amenable to structural analysis using fluorescently labeled antibodies for synaptic markers or proteins of interest. This protocol allows for the evaluation of the structural integrity of synapses in adult Drosophila during aging to model the progressive, age-dependent nature of most neurodegenerative diseases.

Visualizing Synaptic Degeneration in Adult Drosophila in Association with Neurodegeneration

The goal of this procedure is to dissect the dorsal longitudinal muscle (DLM) tissue to assess the structural integrity of DLM neuromuscular junctions (NMJs) in neurodegenerative disease models using Drosophila melanogaster.

Drosophila serves as a useful model for assessing synaptic structure and function associated with neurodegenerative diseases. While much work has focused ...

Sonication-facilitated Immunofluorescence Staining of Late-stage Embryonic and Larval Drosophila Tissues In Situ

Studies performed in Drosophila melanogaster embryos and larvae provide crucial insight into developmental processes such as cell fate specification and organogenesis. Immunostaining allows for the visualization of developing tissues and organs. However, a protective cuticle that forms at the end of embryogenesis prevents permeation of antibodies into late-stage embryos and larvae. While dissection prior to immunostaining is regularly used to analyze Drosophila larval tissues, it proves inefficient for some analyses because small tissues may be difficult to locate and isolate. Sonication provides an alternative to dissection in larval Drosophila immunostaining protocols. It allows for quick, simultaneous processing of large numbers of late-stage embryos and larvae and maintains in situ morphology. After fixation in formaldehyde, a sample is sonicated. Sample is then subjected to immunostaining with antigen-specific primary antibodies and fluorescently labeled secondary antibodies to visualize target cell types and specific proteins via fluorescence microscopy. During the process of sonication, proper placement of a sonicating probe above the sample, as well as the duration and intensity of sonication, is critical. Additonal minor modifications to standard immunostaining protocols may be required for high quality stains. For antibodies with low signal to noise ratio, longer incubation times are typically necessary. As a proof of concept for this sonication-facilitated protocol, we show immunostains of three tissue types (testes, ovaries, and neural tissues) at a range of developmental stages.

Sonication-facilitated Immunofluorescence Staining of Late-stage Embryonic and Larval Drosophila Tissues In Situ

Immunostaining is an effective technique for visualizing specific cell types and proteins within tissues. By utilizing sonication, the protocol described here alleviates the need to dissect Drosophila melanogaster tissues from late-stage embryos and larvae before immunostaining. We provide an efficient methodology for the immunostaining of formaldehyde-fixed whole mount larvae.

Studies performed in Drosophila melanogaster embryos and larvae provide crucial insight into developmental processes such as cell fate specification and ...

Methods to Study Changes in Inherent Protein Aggregation with Age in Caenorhabditis elegans

In the last decades, the prevalence of neurodegenerative disorders, such as Alzheimer's disease (AD) and Parkinson's disease (PD), has grown. These age-associated disorders are characterized by the appearance of protein aggregates with fibrillary structure in the brains of these patients. Exactly why normally soluble proteins undergo an aggregation process remains poorly understood. The discovery that protein aggregation is not limited to disease processes and instead part of the normal aging process enables the study of the molecular and cellular mechanisms that regulate protein aggregation, without using ectopically expressed human disease-associated proteins. Here we describe methodologies to examine inherent protein aggregation in Caenorhabditis elegans through complementary approaches. First, we examine how to grow large numbers of age-synchronized C. elegans to obtain aged animals and we present the biochemical procedures to isolate highly-insoluble-large aggregates. In combination with a targeted genetic knockdown, it is possible to dissect the role of a gene of interest in promoting or preventing age-dependent protein aggregation by using either a comprehensive analysis with quantitative mass spectrometry or a candidate-based analysis with antibodies. These findings are then confirmed by in vivo analysis with transgenic animals expressing fluorescent-tagged aggregation-prone proteins. These methods should help clarify why certain proteins are prone to aggregate with age and ultimately how to keep these proteins fully functional.

Methods to Study Changes in Inherent Protein Aggregation with Age in Caenorhabditis elegans

The goal of the method presented here is to explore protein aggregation during normal aging in the model organism C. elegans. The protocol represents a powerful tool to study the highly insoluble large aggregates that form with age and to determine how changes in proteostasis impact protein aggregation.

In the last decades, the prevalence of neurodegenerative disorders, such as Alzheimer's disease (AD) and Parkinson's disease (PD), has grown. These ...

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to recognize a wide range of particles and destroy microbial pathogens. As organisms age, this process begins to decline, yet little is known about the underlying mechanisms or the genetic basis of immunosenescence. Here, an injection based in vivo phagocytosis assay is used to assess age related changes in different aspects of phagocytosis, such as binding, engulfment, and degradation of internalized particles, by quantifying phagocytic events in hemocytes in adult Drosophila. Drosophila melanogaster has become an ideal model to investigate age related changes in innate immune function for many reasons. For one, many genetic components and functions of the innate immune response, including phagocytosis, are evolutionarily conserved between Drosophila and mammals. Because of that, results obtained from using this protocol are likely to be widely relevant to understanding the age related changes in immune function in a variety of organisms. Additionally, we note that this method provides quantitative estimates of hemocyte phagocytic ability, which could be useful for a variety of research topics, and need not be limited to studies of aging.

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

This protocol describes an in vivo assay of phagocytosis used to assess and quantify the ability of young and aged Drosophila melanogaster hemocytes to phagocytose bacteria.

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to ...

Circadian Entrainment of Drosophila Melanogaster

Nearly universal among organisms, circadian rhythms coordinate biological activity to earth&#39;s orbit around the sun. To identify factors creating this rhythm and to understand the resulting outputs, entrainment of model organisms to defined circadian time-points is required. Here we detail a procedure to entrain many Drosophila to a defined circadian rhythm. Furthermore, we detail post-entrainment steps to prepare samples for immunofluorescence, nucleic acid, or protein extraction-based analysis.

Here, we detail how to synchronize Drosophila to a circadian day. This is the first, and most important step necessary for studying biological rhythms and chronobiology.

Nearly universal among organisms, circadian rhythms coordinate biological activity to earth&#39;s orbit around the sun. To identify factors creating this ...

High-Resolution Imaging and Analysis of Drosophila Eye Defects

A Rapid, Simple Workflow for Quantification of External Adult Drosophila Structures

The Drosophila compound eye is a precisely patterned tissue that has revealed molecular mechanisms and biological processes that drive morphogenesis. It is a simple structure of repeating unit eyes, termed ommatidia, that is used to characterize genetic interactions and gene functions. Mutations that affect eye architecture can be easily detected and analyzed; hence, this system is frequently used in under-resourced institutions. Further phenotypic analysis often includes a Scanning Electron Microscope (SEM) to generate high-magnification images suitable for quantitative analysis. However, SEMs are expensive and require costly reagents; sample preparation spans days; and, often, they need full-time staff for sample preparation and instrument maintenance. This limits their utility at under-resourced institutions or during budgetary austerity. In entomology, the use of high-resolution digital imaging technology is a common practice for the identification and characterization of species. This paper describes a method that combines strategies and allows for high-resolution digital imaging of adult Drosophila structures and quantitative analysis using the open software ImageJ. The workflow is a rapid and student-friendly alternative that remedies the limitations of underfunded and under-resourced research facilities with a cost-effective and rapid approach to quantitative phenotypic analysis.

Here, we present a rapid, low-cost, workflow for high-resolution imaging of adult Drosophila eyes to quantify patterning and growth defects. We describe our protocol for sample preparation by point-mounting, high-resolution image acquisition, and image analysis.

The Drosophila compound eye is a precisely patterned tissue that has revealed molecular mechanisms and biological processes that drive morphogenesis. It ...

Drosophila Late Pupa Indirect Flight Muscle (IFM) Dissection: A Method for High-Throughput Tissue Collection

Source: Kao, S. Y., et al. <a href="https://www.jove.com/video/60309/" target="_blank">Dissection of Drosophila melanogaster Flight Muscles for Omics Approaches</a>. J. Vis. Exp. (2019).
The Drosophila flight muscles are used as a model system for muscle development and physiology. This video describes the flight musculature of adults and highlights a protocol to dissect developing indirect flight muscles that are suitable for RNA sequencing from pupae.

Source: Kao, S. Y., et al. Dissection of Drosophila melanogaster Flight Muscles for Omics Approaches. J. Vis. Exp. (2019).
The Drosophila flight muscles ...