The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.

1. Vorlage Vorbereitung Hinweis: alle genomischen DNA-Matrize mit Verdacht auf einen der sieben Eimeria-Spezies, die Hühner infizieren abgeleitete DNA enthalten, können als Matrize für LAMP-basierten Eimeriaspezies Identifizierung verwendet werden. Darmgewebeproben für Feld diagnostische Analyse sollten bei der routinemäßigen post-mortem wie hier beschrieben gesammelt werden. <ol><li> Wählen Sie den Abschnitt (oder Abschnitte) des Darms zu prüfen. Siehe Tabelle 1 für einen Führer zu Probe Standortwahl und die Eimeria-Spezies am wahrscheinlichsten 18 und 1 für die Spezies-spezifische Bereich der Verteilung und Lage der Probenahmestellen zu sein. Hinweis: Dies ist von zentraler Bedeutung, da Eimeria sind insbesondere Host-Site-spezifisch. Jede Art, die Hühner infiziert wird durch die Darmbereich, die es zielt auf 19 festgelegt. Die Entscheidung kann durch die bisherigen Erfahrungen der Farm, Interesse an einem oder mo beeinflusst werdenre spezifische Eimeria-Arten oder andere Diagnose-Anzeigen 6. </li><li> Verbrauch 5 cm oder mehr Längen der Darmabschnitt (en), ausgewählt für Eimeria mit sterilen Schere oder einem Skalpell zu testen. Optional, lagern die Proben für eine anschließende Analyse in einem Fixiermittel, wie beispielsweise in RNAlater 18 oder 95% Ethanol. HINWEIS: Wenn die Speicherung in Ethanol die Probe sollte in sterilem, Tris-Ethylendiamintetraessigsäure gewaschen werden (TE) Puffer vor der Verwendung. </li><li> Schneiden Sie die Probe in Längsrichtung offen, die meisten Darminhalt zu entfernen (falls vorhanden) und kratzen Zellen von der Schleimschicht frei entweder mit dem Rand eines sterilen Glasobjektträger oder eine Ethanol / Flamme sterilisiert Scherenblatt. Wahlweise für eine Sammelprobe sind Zellen, die aus allen vier der artspezifischen Darm-Websites in einer einzigen Röhre. </li><li> Legen Sie die Abstreifgut in ein steriles 1,5 ml Schraubverschluss-Mikroröhrchen mit 100 ul sterilem TE-Puffer mit 1(W / v) Chelex 100-Harz 0%. </li><li> Schütteln Sie jede Probe 1 min kräftig. Stellen Sie sicher, dass der Schraubdeckel sorgfältig verschlossen und dann in einem kochenden Wasserbad inkubiert für 10 min. </li><li> Nach Kochen ermöglichen jede Probe bei Umgebungstemperatur für 1-2 min abkühlen. </li><li> Zentrifuge jede Probe unter Verwendung einer Mikrozentrifuge bei Höchstgeschwindigkeit (zB ~ 10.000 × g) für 1 min. </li><li> Sammel 2 ul des erhaltenen Überstands werden Vorlage in jeder Lampe Assay durchgeführt werden. Optional bündeln mehrere Darmstelle in einem einzigen Rohr, einen Multi-Site-Assay bereitzustellen. </li></ol> 2. Eimeria LAMP Primer Vorbereitung (Pre-Test) <ol><li> Bereiten Eimeria LAMP Primer Aktien ausreichend für 100 Tests: <ol><li> Den Inhalt jeder lyophilisierten Eimeria LAMP Primer durch Zugabe von Wasser molekularen Grad bis zu einer Konzentration von 100 uM (nach Angaben des Herstellers). Wenn nicht angegeben, berechnet das Volumen der molekularen reines Wasser erforderlich using die physikalischen und Molekulargewichte von jedem Primer. </li><li> Pipette 60 ul molekular reines Wasser in einem separaten 0,5 ml Flip-Top-Mikrozentrifugenröhrchen für jede Eimeria-Arten, die untersucht werden. </li><li> Hinzufügen Primer FIP, BIP, F3, B3, LF und LB für die Ziel Eimeriaspezies zum Wasser unter Verwendung der in Tabelle 2 gezeigten Mengen, wodurch eine Reihe von sieben artspezifischen Primer Mischungen. </li><li> Vortexen mischen die Primerlösung, dann Impulsmikrozentrifuge und einfrieren, bis sie benötigt. </li></ol></li><li> Bereiten Sie eine LAMP Reaktion Mastermix für jeweils Eimeria-Arten, die untersucht werden. Multiplizieren Sie die in Tabelle 3 gezeigten Mengen mit der Anzahl der Proben und fügen Sie drei bis Positivkontrolle Negativkontrolle und Pipettieren Ersatz. Pipette in ein 0,5 oder 1,5 ml Flip-Top-Mikrozentrifugenröhrchen. </li></ol> 3. Eimeria LAMP Assay <ol><li> Pipette 23 ul Eimeria artspezifischen Bst DNA-Polymerase / LAMP Mastermix in einen 0.5 ml Mikrozentrifugenröhrchen. </li><li> Add 2 ul DNA-Template (in Abschnitt 1 hergestellt), eine endgültige Reaktionsvolumen von 25 ul. </li><li> Add 2 ul Eimeria artspezifischen genomische DNA zu einem Reaktions (positive Kontrolle). Add 2 ul Wasser molekularen Grad an Reaktion (Negativkontrolle). HINWEIS: Wenn artspezifischen genomischer DNA ist nicht verfügbar, eine frühere positive LAMP oder Standard-PCR-Produkt können stattdessen verwendet werden. </li><li> Inkubieren in einem Wasserbad oder Heizblock bei 62 ° C für 30 min. Optional de-aktivieren Bst DNA-Polymerase durch Erhitzen auf 80 ° C für 10 Minuten, wenn die Reaktion nicht sofort gelesen werden. </li></ol> 4. LAMP Assay Auslese <ol><li> Am Ende der Inkubation beurteilen die Farbe jedes Reaktion durch Auge unter Raumbeleuchtung. Negative Ergebnisse erscheinen in der Farbe rosa bis violett erscheinen positive Ergebnisse Himmelblau 20. </li><li> Wahlweise bestätigen die LAMP Untersuchungsergebnis in einer laboratory, indem 5 ul LAMP-Reaktionsprodukt mit 1 ul DNA-Gelbeladungspuffer für Agarose-Gelelektrophorese unter Verwendung eines 2% igen Agarosegel in 1 x Tris / Borat / EDTA (TBE) -Puffer: vorgefärbter Verwendung eines Nukleinsäurefarbstoff (5 ul pro 50 ml Agarose). In 5 ul einer 1 Kb Molekülgröße DNA-Leiter in Spur 1 des Gels auf Fragmentgröße Berechnung ermöglichen. </li></ol>

<ol>
	<li>Chapman, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+selective+review+of+advances+in+coccidiosis+research.">A selective review of advances in coccidiosis research.</a> Adv Parasitol. 83, 93-171 (2013).</li><li>Shirley, M. W., Smith, A. L., Tomley, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+avian+Eimeria+with+an+emphasis+on+their+control+by+vaccination.">The biology of avian Eimeria with an emphasis on their control by vaccination.</a> Adv Parasitol. 60, 285-330 (2005).</li><li>Fornace, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Occurrence+of+Eimeria+species+parasites+on+small-scale+commercial+chicken+farms+in+Africa+and+indication+of+economic+profitability.">Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability.</a> PLoS ONE. 8 (12), e84254 (2013).</li><li>Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+analysis+of+Eimeria+spp.+populations+in+relation+to+performance+levels+of+broiler+chicken+farms+in+Arkansas+and+North+Carolina.">Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina.</a> J Parasitol. 95 (4), 871-880 (2009).</li><li>Peek, H. W., Landman, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coccidiosis+in+poultry:+anticoccidial+products,+vaccines+and+other+prevention+strategies.">Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies.</a> Vet Q. 31 (3), 143-161 (2011).</li><li>Johnson, J., Reid, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anticoccidial+drugs:+lesion+scoring+techniques+in+battery+and+floor-pen+experiments+with+chickens.">Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens.</a> Exp Parasitol. 28 (1), 30-36 (1970).</li><li>Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+survey+of+the+economic+impact+of+subclinical+Eimeria+infections+in+broiler+chickens+in+Norway.">A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway.</a> Avian Pathol. 37 (3), 333-341 (2008).</li><li>Procunier, J., Fernando, M., Barta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+and+strain+differentiation+of+Eimeria+spp.+of+the+domestic+fowl+using+DNA+polymorphisms+amplified+by+arbitrary+primers.">Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers.</a> Parasitology Research. 79 (2), 98-102 (1993).</li><li>Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+diagnostic+PCR+assay+for+the+detection+and+discrimination+of+four+pathogenic+Eimeria+species+of+the+chicken.">Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken.</a> Avian Pathol. 27 (5), 490-497 (1998).</li><li>Vrba, V., Blake, D. P., Poplstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+real-time+PCR+assays+for+detection+and+quantification+of+all+seven+Eimeria+species+that+infect+the+chicken.">Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken.</a> Vet Parasitol. 174 (3-4), 183-190 (2010).</li><li>Morris, G. M., Gasser, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotechnological+advances+in+the+diagnosis+of+avian+coccidiosis+and+the+analysis+of+genetic+variation+in+Eimeria.">Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria.</a> Biotechnol Adv. 24 (6), 590-603 (2006).</li><li>Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Investing in animal health research to alleviate poverty. , (2002).</li><li>Nagamine, K., Hase, T., Notomi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accelerated+reaction+by+loop-mediated+isothermal+amplification+using+loop+primers).">Accelerated reaction by loop-mediated isothermal amplification using loop primers).</a> Mol Cell Probes. 16 (3), 223-229 (2002).</li><li>Notomi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+of+DNA.">Loop-mediated isothermal amplification of DNA.</a> Nucleic Acids Res. 28 (12), E63 (2000).</li><li>Kaneko, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+enterotoxigenic+Clostridium+perfringens+in+meat+samples+by+using+molecular+methods.">Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.</a> Appl Environ Microbiol. 77 (21), 7526-7532 (2011).</li><li>Karanis, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+preliminary+evaluation+of+a+loop-mediated+isothermal+amplification+procedure+for+sensitive+detection+of+cryptosporidium+oocysts+in+fecal+and+water+samples.">Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples.</a> Appl Environ Microbiol. 73 (17), 5660-5662 (2007).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+Infectious+bursal+disease+virus+by+reverse+transcription+loop-mediated+isothermal+amplification+assay.">Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay.</a> J Vet Diagn Invest. 21 (6), 841-843 (2009).</li><li>Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+(LAMP)+assays+for+the+species-specific+detection+of+Eimeria+that+infect+chickens.">Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.</a> BMC Vet Res. 7 (1), 67 (2011).</li><li>Long, P., Joyner, L., Millard, B., Norton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+laboratory+techniques+used+in+the+study+and+diagnosis+of+avian+coccidiosis.">A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis.</a> Folia Veterinaria Latina. 6 (3), 201-217 (1976).</li><li>Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colorimetric+detection+of+loop-mediated+isothermal+amplification+reaction+by+using+hydroxy+naphthol+blue.">Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.</a> BioTechniques. 46 (3), 167-172 (2009).</li><li>Arakawa, A., Baba, E., Fukata, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+tenella+infection+enhances+Salmonella+typhimurium+infection+in+chickens.">Eimeria tenella infection enhances Salmonella typhimurium infection in chickens.</a> Poult Sci. 60 (10), 2203-2209 (1981).</li><li>Blake, D. P., Smith, A. L., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplified+fragment+length+polymorphism+analyses+of+Eimeria+spp.:+an+improved+process+for+genetic+studies+of+recombinant+parasites.">Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites.</a> Parasitol Res. 90 (6), 473-475 (2003).</li><li>Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Campylobacter+spp.+in+chicken+fecal+samples+by+real-time+PCR.">Detection of Campylobacter spp. in chicken fecal samples by real-time PCR.</a> J Clin Microbiol. 42 (11), 5125-5132 (2004).</li><li>Raj, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR-based+quantification+of+Eimeria+genomes:+a+method+to+outweigh+underestimation+of+genome+numbers+due+to+PCR+inhibition.">Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition.</a> Avian Pathol. 42 (4), 304-308 (2013).</li><li>Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+maxima:+the+influence+of+host+genotype+on+parasite+reproduction+as+revealed+by+quantitative+real-time+PCR.">Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR.</a> Int J Parasitol. 36 (1), 97-105 (2006).</li><li>Beck, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+approaches+to+diversity+of+populations+of+apicomplexan+parasites.">Molecular approaches to diversity of populations of apicomplexan parasites.</a> Int J Parasitol. 39 (2), 175-189 (2009).</li></ol>

The authors declare that they have no competing financial interests.

The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~&#163;0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment. 
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25. 
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.

Globale Hühnerproduktion Zehnfache über den letzten 50 Jahren mit den Entwicklungsländern Hosting fast viermal die Expansion in den Industrieländern erlebt erhöht <a href="http://www.faostat.org">(www.faostat.org)</a> . Da die Bedeutung der Hühnerproduktion zur Welternährungssicherheit hat sich so hat auch das Profil von Erregern, die schwere Krankheit bei Hühnern verursachen können. Ein gutes Beispiel sind die Eimeria-Arten, allgegenwärtigen einzellige Parasiten, die die Darmerkrankung Kokzidiose 1 führen können. Wo immer Hühnern gezüchtet werden ein oder mehrere Eimeria-Spezies wahrscheinlich gemeinsame 2-4 sein. In der entwickelten Welt Eimeria werden vor allem von Chemoprophylaxe kontrolliert und beschäftigt Shuttle oder Rotationsprogramme, die Auswirkungen der Widerstand 5 zu minimieren. Lebendimpfstoffe sind auch in Systemen, in denen Vogel Wert ist ausreichend, um die Kosten zu rechtfertigen (zB, Zuchttiere, Schichten und einige Broilern 5). Als result dieser Maßnahmen klinischen Kokzidiose wird oft gut kontrolliert, auch wenn subklinische Infektion ist häufig 5. In den Entwicklungsländern die Impfung ist selten und Drug Application häufig weniger gut informiert. Als Folge subklinischen und klinischen Kokzidiose ist häufiger und übt eine erhebliche wirtschaftliche Auswirkungen 3. Diagnose von Eimeria-Infektion traditionell auf Läsion Scoring post-mortem, obwohl auch die Autoren der am häufigsten verwendeten Bewertungssystem kommentierte, dass für einige Arten &quot;es erscheint zweifelhaft, ob eine solche Regelung sollte in jedem, aber mittelschweren Infektionen versucht werden&quot; 6. Ergänzende Hinweise können durch mikroskopische Nachweis des umweltbeständig Oozyste Lebenszyklusphase in Fäkalien oder Wurf Proben gesammelt werden, auch wenn sich überlappenden Morphologie können alle, aber die Experten 6,7 verwechseln. Molekulare Alternativen mittels Polymerase-Kettenreaktion (PCR), Zufalls amplification polymorpher DNA PCR (RAPD-PCR) und die quantitative PCR-Technologien wurden für bis zu 20 Jahre 8-10 zur Verfügung, aber sie bislang gescheitert populär geworden. Relative Kosten und der Bedarf an Fachlaborgeräte oder Verarbeitung ihre Aufnahme beschränkt, trotz der oft subjektiv und technisch anspruchsvolle Art des älteren pathology- und Mikroskopie-basierte Ansätze 10,11. Eine solche Beschränkung kann in vielen der ärmeren Regionen der Welt, wie Südostasien, wo die Auswirkungen der Kokzidiose auf die Armut kann proportional größer 12 sein übertrieben werden. Als Antwort gibt es einen klaren Bedarf an neuen unkompliziert und empfindlich, aber kostengünstiger, Eimeria-Spezies-spezifische diagnostische Tests. Loop-vermittelte isothermische Amplifikation (LAMP) ist ein leicht zu DNA-Polymerase-angetriebene Technik, die zur Amplifikation großer Mengen an DNA herzustellen. Am wichtigsten ist, verwendet LAMP eine Bst DNA polymerase anstelle der Taq-DNA-Polymerase die üblicherweise in PCR verwendet werden, die DNA-Amplifizierung bei einer einzigen konstanten Temperatur ermöglicht, ohne das Erfordernis der thermischen Zyklen 13,14. Leuchte kann selbst in den rudimentären Labor oder im Feld zugänglich Anwendung sein. Durch eine relative Beständigkeit gegenüber vielen PCR-Inhibitoren, hohe Empfindlichkeit und Spezifität Charakterisiert wurden LAMP-Assays für ein breites Spektrum von Krankheitserregern einschließlich Virus der infektiösen Bursitis, Clostridium perfringens und Cryptosporidium 15-17 entwickelt. In Reaktion auf neue kosteneffektive Eimeriaspezies spezifische Diagnose ein Panel von spezifisch jede der sieben Eimeria-Spezies, die Hühner infizieren LAMP-Assays entwickelt worden, 18 verlangen. Anwendungen für die neuen Tests umfassen die Überwachung Parasiten Auftreten, von besonderem Wert, da die Zuordnung der Arten wie Eimeria maxima oder Eimeria necatrix mit schlechten wirtschaftlichen performance 3,4. Weitere Anwendungen sind die Beurteilung der Wirksamkeit von Antikokzidium Strategie eines Bauernhof, Diagnose subklinische Infektion oder klinischen Erkrankung und Bewertung von Risiken durch Eimeria zu einem Bauernhof gestellt.

<table border="0" cellpadding="0" cellspacing="0" width="889">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Name</td>
			<td style="width:161px;">Company</td>
			<td style="width:139px;">Catalogue number</td>
			<td style="width:295px;">Comments</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNAlater</td>
			<td style="width:161px;">Ambion</td>
			<td style="width:139px;">AM7024</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ethanol</td>
			<td style="width:161px;">VWR Chemicals</td>
			<td style="width:139px;">20821.321</td>
			<td style="width:295px;">Caution, highly flammable</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">100 x Tris-EDTA (TE) buffer concentrate</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">T9285</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Chelex 100 resin</td>
			<td style="width:161px;">Bio-Rad</td>
			<td style="width:139px;">142-1253</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Molecular grade water</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">10977035</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTAACATTTCGCTTCACGGAC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATGAGCAAGTGGAACACCTTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TAAGGTTACACCCGTGGAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCATGCACAAAGCGACTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GGCCATCAAGTTCCATGAGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCAACCTCCTGAGTGTGGTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAACGCTCGAACATGGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CTTCTCCACAGACCCAGAGGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACTACGGAAAAGTGCGTAGCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTTCCTCCCTTCTGAAAACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAGTCACTGCTGATGTACCAAA 
			AG-GAACTATGCCGCTTTCCCCTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CAAGCCTACGCGGACATC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TTATGCAGCTGGGTCAACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACGATAGCCAAGACACGTAAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCCCGTGATAAGAGTAGGAACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCGGGTCGTGAGATTTAAATT 
			AT-GGAAGATCAGGACGGGCACT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTCAGTTGATGAACAAGCGA 
			GA-TGCGCCTCTAGAATCAAGACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCCATGCATCCCCTTGTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGTGGGCACAGATTGATTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TGGCTTTCCCGCGTACC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGGCCCAACACAAAGACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCTTGAGTTTTAAGCTATGCA 
			CA-GACCCAAGCAGCTCACCAA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCTGTAACTTGGGACGTTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAACAGCCGGAGCCTCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCCTTGTATGTTGCTGTTTCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCGCACGAATCTGAATCACAC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATCTCCTCAAAGACTTTCGCGT 
			A-GCGCTTGGCTATATCCATAGG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAATAGCATTGCCAGGTGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCCACTGTCATTAATATTGC 
			TGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTTGTGAAGGTCAGCGTG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTGAGTCCATACGTACTTCCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCACTGCTATGGAAAGTCAC 
			AC-CATAACTGGCATGCAGGGGT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTGGCCCGAAAGTTGTGAA 
			GA-CGTCAGAAATTGCTGCCCAAT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCATGTGCAGTTGAAGACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCAAATGTATCTGCTAGTTATA 
			TTAACAAG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x ThermoPol reaction buffer</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">B9004S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:295px;">MgSO4</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">M7506</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">dNTPs</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">U1330</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Betaine solution (5 M)</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">B0300</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Bst polymerase</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">M0275S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Hydroxynaphthol blue</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">33936</td>
			<td style="width:295px;">Dissolved in molecular grade water.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">UltraPure agarose</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">16500-500</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x Tris/Borate/EDTA (TBE) buffer</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">AM9863</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Blue/Orange DNA loading dye (x6)</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">G1881</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">GeneRuler 1Kb DNA ladder</td>
			<td style="width:161px;">Thermo Scientific</td>
			<td style="width:139px;">SM0313</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SafeView nucleic acid stain</td>
			<td style="width:161px;">NBS Biologicals</td>
			<td style="width:139px;">NBS-SV</td>
			<td style="width:295px;"></td>
		</tr>
	</tbody>
</table>

loop-mediated isothermal amplification (lamp) assays for the species-specific detection of eimeria that infect chickens

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm&#8217;s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

Assay-Validierung Während der Überprüfung wurde jede Eimeria artspezifischen LAMP-Test unter Verwendung einer Reihe von reinen DNA-Proben, die alle sieben Eimeria-Arten, die den Hühner sowie Huhn genomischer DNA als Hoststeuer infizieren getestet. Agarose-Gelelektrophorese wurde verwendet, um jeden Test zu lösen und zeigte absolute Artspezifität ohne Host Kreuzreaktivität 18. Als nächstes erstellt eine zehnfache Verdünnungsreihe mit gereinigtem Eimeria tenella genomischen DNA ergab ein Assay Empfindlichkeitsgrenze zwischen einem und zehn Genomkopien 18. Keine Obergrenze wurde mit bis zu positive Ergebnisse erzielt und mit der höchsten Konzentration (100.000 Genomkopien) 18 bestimmt. Anwendung mit Feldproben Die Proben für die Untersuchung gewonnen Eimeria dürften von Hühner tot abgeleitet werden, als Folge der p gekeultoor Gesundheit oder für Sentinel Gesundheitsüberwachung gekeult, was auf eine eher Probengröße von zwischen einem und drei als Teil einer Routine. Testen drei Vögel von einem US-Hähnchenmastanlage im Rahmen eines Überwachungsprogramms gesammelt ergab drei Sätze von Darmproben. Gezielte Anwendung der artspezifischen LAMP Assays Priorisieren der bevorzugten Darmstellen für jede Eimeria-Spezies (Tabelle 1), erlaubt eine visuelle Identifizierung von Eimeria-Infektion bei allen Tieren getestet, indem hydroxynaphthol Blau als Indikator (Figur 2A). Die mit einem negativen LAMP Reaktion bei Verwendung hydroxynaphthol blau erzielt Farbe von Violett bis hin zu rosa, aber ist immer verschieden von der durch ein positives Ergebnis erzielt blau. Bestätigung durch Agarosegelelektrophorese liefert vergleichbare Ergebnisse (2B). Während der Feldanwendung kann der Benutzer wählen, um den Vollbildmodus gegen alle sieben Arten gelten, oder das Ziel nur die Spezies als priorisiertwichtig oder bekannt ist, dass auf dem Hof ​​zirkulierenden oder die Umgebung. Das Versagen des PCR-basierte Ansätze als Diagnostika etablieren für das Auftreten von Eimeria unterstreicht das Erfordernis der Einfachheit in jedem neuen Test. Während LAMP bietet einfachere Zubereitung und Verarbeitung als PCR, bleibt die Forderung, mehrere Darmstellen pro Vogel testen entmutigend. Herstellung einer einzigen gepoolten DNA-Probe pro Vogel, die dann mit einem oder mehreren LAMP Assays getestet werden können, ist wahrscheinlich attraktiver. Das gleiche Ergebnis wie bei jeder Darm Website wurde getrennt verarbeitet werden (Abbildung 2 Verarbeitung einer Sammelprobe pro Tier, was von jedem der spezifischen Darm Standorten in Tabelle 1 mit allen sieben LAMP-Assays beschrieben und gebündelt vor DNA-Präparation, für die Prüfung gesammelten Materials vorausgesetzt verglichen mit Figur 3). <img alt="Figur 1" src=&quot;/files/ftp_upload/52552/52552fig1.jpg&quot; /&gt; Abbildung 1. Darmprobenahmestellen für LAMP Erfassung von Eimeria Parasiten, die Hühner infizieren. Wird die Darmabschnitten von je Eimeria-Arten gezielt durch die farbigen Linien markiert ist, mit den bevorzugten Standorten der Probenahme durch die Anzahl zwischen den gestrichelten schwarzen Linien angezeigt (E. acervulina: gelb / 1, E. Brunetti: pink / 2, E. maxima: blau / 3, E. mitis: orange / 4, E. necatrix: rot / 5, E. praecox: grün / 6 und E. tenella: grau / 7). <a href="https://www.jove.com/files/ftp_upload/52552/52552fig1large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.</a> <img alt="Abbildung 2" src="/files/ftp_upload/52552/52552fig2.jpg" /> Abbildung 2. LAMP Diagnose von Eimeria-Infektion herm drei kommerziellen Masthähnchen. LAMP Reaktionen gelöst mit (A) hydroxynaphthol blau, wo ein himmelblau-Reaktion war positiv und eine violette bis rosa Reaktion war negativ, und (B) Agarose-Gelelektrophorese. Die Darm Sites abgetastet wurden, wie in Tabelle 1 für jede Parasitenarten dargestellt. A = E. acervulina, B = E. brunetti, Ma = E. Maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox und T = E. tenella. Spur 1 enthielt die GeneRuler 1 Kb DNA-Leiter. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig2large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.</a> <img alt="Figur 3" src="/files/ftp_upload/52552/52552fig3.jpg" /> Abbildung 3. LAMP Diagnose einer Eimeria-Infektion unter Verwendung von drei verschiedenen kommerziellen Masthähnchen Sammelproben. LAMP reacgen gelöst mit hydroxynaphthol blau, wo ein himmelblau-Reaktion war positiv und violett bis rosa Reaktion war negativ. A = E. acervulina, B = E. brunetti, Ma = E. Maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox und T = E. tenella. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig3large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.</a> <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Beispielseite </td><td> Eimeriaspezies Assay (wahrscheinlich) </td></tr><tr><td> Duodenum (D) </td><td> E. acervulina, E. praecox </td></tr><tr><td> Jejunum / Ileum * (J / I) </td><td> E. maxima, E. necatrix </td></tr><tr><td> Caeca (C) </td><td> E. necatrix, E. tenella </td></tr><tr><td> Terminalen Ileum (TI) </td><td> E. Brunetti, E. mitis </td></tr&gt; <tr><td> Sammelprobe (P) </td><td> E. acervulina, E. Brunetti, E. maxima, E. mitis, E. necatrix, E. praecox E. tenella </td></tr></tbody></table> Tabelle 1 Intestinal regionsspezifische Auswahl von Kandidaten Eimeriaspezies Assays. Die Wahl der Region abgetastet variiert für jede Eimeria-Spezies, wie in Abbildung 1 veranschaulicht. Gepoolten Proben beinhalten aus allen vier spezifischen Stellen, die dann für die DNA-Präparat kombiniert wurden gesammelt Materials. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Primer * </td><td> Lizenz Konzentration (uM) </td><td> Volumen (ul) </td></tr><tr><td> Wasser </td><td> - </td><td> 60 </td></tr><tr><td> Vorwärtsprimer (FIP) </td><td> 100 </td><td> 40 </td></tr><tr><td> Rückwärts Inner Primer (BIP) </td><td> 100 </td><td> 40 </td></tr><tr><td> Zukunfts Outer Primer (F3) </td><td> 100 </td><td> 10 </td></tr><tr><td> Rückwärts Outer Primer (B3) </td><td> 100 </td><td> 10 </td></tr><tr><td> Loop-Forward (LF) </td><td> 100 </td><td> 20 </td></tr><tr><td> Loop Backward (LB) </td><td> 100 </td><td> 20 </td></tr><tr><td> Gesamt </td><td></td><td> 200 </td></tr></tbody></table> Tabelle 2. Herstellung eines LAMP Primer Vormischung. Die Komponenten und Proportionen erforderlich, um eine Primer-Vormischung zur LAMP vorzubereiten. Volumes gezeigt werden, sind 100 LAMP Reaktionen. * Primer Identitäten wie in den Materialien und gezeigt Barkway et al (2011) 18. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> Auf konz n </td><td> Schlussreaktion konz n </td><td> Volumen pro Reaktion (ul) </td></tr><tr><td> DDW </td><td> - </td><td> - </td><td> 10.1 </td></tr><tr><td> THERMOPOL Puffer </td><td> 10 x </td><td> 1 x </td><td> 2.5 </td></tr><tr><td> MgSO 4 </td><td> 100 mM </td><td> 2 mM </td><td> 0,5 </td></tr><tr><td> Primer Mix * </td><td colspan="2"> Tabelle 2 </td><td> 2.5 </td></tr><tr><td> dNTPs </td><td> 25 mM </td><td> 400 uM </td><td> 0.4 </td></tr><tr><td> Betain </td><td> 5 M </td><td> 1 M </td><td> 5 </td></tr><tr><td> Hydroxynaphthol blau </td><td> 3 mM </td><td> 120 &amp; mgr; M </td><td> 1 </td></tr><tr><td> Bst DNA-Polymerase </td><td> 8.000 U / ml </td><td> 8 U </td><td> 1 </td></tr><tr><td> Gesamt </td><td></td><td></td><td> 23 </td></tr></tbody></table> Tabelle 3. Herstellung einer LAMP Reaktion Mastermix. * Eimeria artspezifisch.

Watch this Scientific Journal Video about Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens at JoVE.com

Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Loop-vermittelte isothermen Amplifikation (LAMP) Assays für die artspezifischen Nachweis von<em&gt; Eimeria</em&gt;, Die Hühner infizieren

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the ...

loop-mediated-isothermal-amplification-lamp-assays-for-species

Research

JoVE Journal

Immunology and Infection

Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

26.8K Aufrufe.  Royal Veterinary College, London. Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Serie: Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

Kombination von Klebstoff-tape-basierten Sampling und Fluoreszenz In situ Hybridisierung zum schnellen Nachweis von Salmonellen On Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

Forschung

Immunologie und Infektion

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART). 
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20. 
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.

Quantifying levels of HIV-1 RNA in plasma and sequencing single HIV-1 genomes from individuals with viral loads below the limit of detection (50-75 copies/ml) is difficult. Here we describe how to extract and quantify plasma viral RNA using a real time PCR assay that reliably measures HIV-1 RNA down to 0.3 copies/ml and how to amplify viral genomes by single genome sequencing, from samples with very low viral loads.

Verstärkung und Quantifizierung von HIV-1 RNA in HIV-infizierten Personen mit Viruslast unter der Nachweisgrenze von Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

Tests für die Identifizierung neuer Antivirale gegen Blauzungenvirus

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense against gram-negative bacterium Salmonella typhimurium. Salmonella establishes persistent infection in the intestine of C. elegans and results in early death of infected animals. A number of immunity mechanisms have been identified in C. elegans to defend against Salmonella infections. Autophagy, an evolutionarily conserved lysosomal degradation pathway, has been shown to limit the Salmonella replication in C. elegans and in mammals. Here, a protocol is described to infect C. elegans with Salmonella typhimurium, in which the worms are exposed to Salmonella for a limited time, similar to Salmonella infection in humans. Salmonella infection significantly shortens the lifespan of C. elegans. Using the essential autophagy gene bec-1 as an example, we combined this infection method with C. elegans RNAi feeding approach and showed this protocol can be used to examine the function of C. elegans host genes in defense against Salmonella infection. Since C. elegans whole genome RNAi libraries are available, this protocol makes it possible to comprehensively screen for C. elegans genes that protect against Salmonella and other intestinal pathogens using genome-wide RNAi libraries.

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

C. elegans has emerged as a new genetic model to study host-pathogen interactions. Here we describe a protocol to infect C. elegans with Salmonella typhimurium coupled with the double-strand RNAi interference technique to examine the role of host genes in defense against Salmonella infection.

Ein Protokoll zum Infect<em&gt; Caenorhabditis elegans</em&gt; Mit<em&gt; Salmonella typhimurium</em

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

Frühe das Eindringen des Virus-Assays für die Ermittlung und Bewertung von antiviralen Verbindungen

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods to screen for target enzymes prior to investing greater research effort and resources. The goal of this protocol is to demonstrate two complementary assays for conducting these initial evaluations. The microslide diffusion assay provides an initial or simple detection screen to enable the qualitative and rapid assessment of proteolytic activity against an array of both viable and heat-killed bacterial target substrates. As a counterpart, the increased sensitivity and reproducibility of the dye-release assay provides a quantitative platform for evaluating and comparing environmental influences affecting the hydrolytic activity of protein antimicrobials. The ability to label specific heat-killed cell culture substrates with Remazol brilliant blue R dye expands this capability to tailor the dye-release assay to characterize enzymatic activity of interest.

Here, we present protocols to rapidly screen and characterize enzymes for antimicrobial activity. The microslide diffusion assay and the dye-release assay utilize target bacterial substrates for qualitative and quantitative enzymatic activity evaluation.

Qualitative und quantitative Assays zur Detektion und Charakterisierung von Protein Antimikrobielle

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples. PCR requires specialized equipment and extensive end user training, and therefore, it is not suitable for routine work especially in a resource-constrained area. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of C. burnetii in patient samples. This method is performed at a single temperature around 60 &#176;C in a water bath or heating block. The sensitivity of this LAMP assay is very similar to PCR with a detection limit of about 25 copies per reaction. This report describes the preparation of the reaction using lyophilized reagents and visualization of results using hydroxynaphthol blue (HNB) or a UV lamp with fluorescent intercalating dye in the reaction. The LAMP reagents were lyophilized and stored at room temperature (RT) for one month without loss of detection sensitivity. This LAMP assay is particularly robust because the reaction mixture preparation does not involve complex steps. This method is ideal for use in resource-limited settings where Q fever is endemic.

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

We described here a simple loop-mediated isothermal amplification (LAMP) method using lyophilized reagents for the detection of C. burnetii in patient samples.

Die Entwicklung der Lyophilisierte Loop-mediated Isothermal Amplification Reagenzien zum Nachweis von<em&gt; Coxiella burnetii</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Assays for Studying the Role of Vitronectin in Bacterial Adhesion and Serum Resistance

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin acquisition at the bacterial cell surface plays in resistance to the host immune system. Flow cytometry experiments identified human plasma vitronectin as a ligand for the bacterial receptor outer membrane protein H of Haemophilus influenzae type f. An enzyme-linked immunosorbent assay was employed to characterize the protein-protein interactions between purified recombinant protein H and vitronectin, and binding affinity was assessed using bio-layer interferometry. The biological importance of the binding of vitronectin to protein H at the bacterial cell surface in evasion of the host immune response was confirmed using a serum resistance assay with normal and vitronectin-depleted human serum. The importance of vitronectin in bacterial adherence was analyzed using glass slides with and without vitronectin coating, followed by Gram staining. Finally, bacterial adhesion to human alveolar epithelial cell monolayers was investigated. The protocols described here can be easily adapted to the study of any bacterial species of interest.

This report describes protocols for characterizing interactions between bacterial outer membrane proteins and the human complement regulator vitronectin. The protocols can be used to study the binding reactions and biological function of vitronectin in any bacterial species.

Assays für die Untersuchung der Rolle von Vitronectin in bakterielle Adhäsion und Serum-Widerstand

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin ...

Detection of Antibodies That Neutralize the Cellular Uptake of Enzyme Replacement Therapies with a Cell-based Assay

The administration of enzyme replacement therapies (ERTs) and other biologic therapies to patients may elicit an anti-drug immune response. The characterization of these anti-drug antibodies (ADA), especially those that may neutralize the biological activity of the drug, termed neutralizing antibodies (NAbs), is crucial in understanding the effects of these antibodies on the drug&#39;s pharmacological profile. This protocol describes a cell-based flow cytometry method to detect factors that neutralize the cellular uptake of a representative lysosomal ERT in human matrix. The protocol consists of three procedures: screening, a confirmatory step, and titer assays to detect, identify, and establish the relative level of neutralizing antibody titer in subject samples.
In this method, samples are first mixed with the fluorophore-conjugated ERT product, then incubated with cells [e.g., human T lymphocytes (Jurkat cells)] that express a cell-surface cation-independent mannose 6-phosphate receptor (CI-M6PR), and finally, analyzed with a flow cytometer. A sample without NAbs will result in the uptake of the fluorophore-conjugated ERT product via CI-M6PR, whereas, the presence of NAbs will bind to the drug and interfere with the CI-M6PR binding and uptake. The amount of the fluorophore-conjugated ERT internalized by the Jurkat cells is measured by flow cytometry and evaluated as the percentage (%) signal inhibition compared to the response obtained in the presence of a representative drug-na&#239;ve matrix. In the confirmatory step, the samples are pre-incubated with ERT-conjugated magnetic beads to deplete drug-specific factors that bind to the drug (such as NAbs) prior to an incubation with cells. Samples that screen and confirm positive for drug-specific NAbs in the assay are then serially diluted to generate an antibody titer. Semi-quantitative antibody titers may be correlated with measurements of drug safety and efficacy.

Here we present a cell-based flow cytometry method to detect neutralizing antibodies or other factors that interfere with the cellular uptake of enzyme replacement therapies in a human matrix, such as cerebral spinal fluid (CSF) or human serum.

Nachweis von Antikörpern, die die zelluläre Aufnahme von Enzym-Ersatz-Therapien mit einem zellbasierte Assays neutralisieren

The administration of enzyme replacement therapies (ERTs) and other biologic therapies to patients may elicit an anti-drug immune response. The ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

Eine High-Throughput-Plattform für das Screening von Salmonella spp. /Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...