Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

Hinweis: Diese Methode wurde in der Forschung Artikel berichtet in Medler, S und Ansari, A. 2 verwendet. 1. Die Anzucht und Ernte der Zellen <ol><li> Starten einer 5 ml - Kultur von Zellen in YPD - Medium (10 g / L Hefeextrakt, 20 g / l Pepton, 2% Dextrose) von einer frisch ausgestrichenen Platte Saccharomyces cerevisiae. </li><li> Wachsen die Zellen über Nacht in einem Orbitalschüttler bei 30 ° C und 250 Umdrehungen pro Minute. </li><li> Verdünnen Sie die über Nacht gewachsenen Kultur 100-mal auf ein endgültiges Volumen von 100 ml in YPD-Medium in einem 250 ml Schikanekolben. HINWEIS: Es wurden insgesamt 100 ml Kultur pro TRO Reaktion benötigt; Wenn mehrere Reaktionen benötigt werden, muss ein größeres Volumen der Kultur verwendet werden. </li><li> Wachsen die Zellen bis zu einer optischen Dichte von 0,8-1,0 bei 600 nm (A 600 ~ 0,8-1,0). </li><li> Ernte der Zellen durch Zentrifugation bei 820 xg für 5 min bei 4 ° C in einem sterilen 50 ml konischen Röhrchen. </li><li> Resuspendieren der Zellen in 10 ml eiskaltem TMN buffer (10 mM Tris-HCl pH 7,5, 5 mM MgCl 2, 100 mM NaCl) gegeben und 5 min auf Eis inkubieren. </li><li> Zentrifuge bei 820 × g für 5 min bei 4 ° C um die Zellen zu pelletieren. Entfernen Sie vorsichtig den Überstand durch Absaugen. </li></ol> 2. permeabilisierend und Vorbereitung Zellen für die Run-on-Test <ol><li> Resuspendieren der Zellen in 1 ml 0,6% Sarkosyl Lösung durch Auf- und Abpipettieren sanft ein verkürztes P 1000 Spitze verwenden. Übertragen die Zellsuspension auf eine gekühlte 1,5 ml Mikrozentrifugenröhrchen. </li><li> Schütteln, um die Zellen vorsichtig bei 4 ° C für 25 min auf einem Plattformschüttler. HINWEIS: Reaktionsgefäße sollten mit Eis in einem 50 ml konischen Röhrchen verpackt werden, um eine kalte Temperatur zu halten, was die Möglichkeit einer neuen Einleitung Ereignisse zu vermeiden an den Promotor in diesem Stadium auftreten. </li><li> Zentrifugieren der Zellen bei 1200 × g für 6 Minuten bei 4 ° C einer Tischkühlzentrifuge verwendet wird. </li><li> Den Überstand vorsichtig absaugen überschüssige Flüssigkeit aus dem pro entfernenmeabilized Zellpellet. </li></ol> 3. Die Transkription Run-on-Reaktion <ol><li> Zugabe von 150 &amp; mgr; l Transkriptions run-on - Puffer (50 mM Tris-HCl pH 7,5, 100 mM KCl, 10 mM MgCl 2, 2 mM DTT (Dithiothreit), 0,75 mM jeweils von ATP, CTP, GTP und BrUTP, 200 U RNase Inhibitor) auf die permeabilisierten Zellpellet. </li><li> Vorsichtig mischen durch Pipettieren nach oben und unten ein verkürztes P 200 Spitze mit. HINWEIS: Wenn mehrere Proben verarbeiten, alles auf Eis zu halten, bis alle Proben fertig sind und dann mit dem nächsten Schritt fortfahren. </li><li> Inkubieren für 5 min bei 30 ° C in einem Wasserbad. HINWEIS: Stellen Sie die Zeit der Inkubation zwischen 1 bis 5 min optimale Einbindung von BrUTP in die im Entstehen begriffenen RNA zu gewährleisten. </li><li> Die Reaktion durch Zugabe von 500 &amp; mgr; l kaltem ready-to-use-RNA-Isolierung Reagenz. Inkubieren für 5 min bei Raumtemperatur. </li></ol> 4. RNA-Extraktion <ol><li> In 200 ul Säure gewaschenen Glasperlen in die Zelle Schutzsperreauf (3.4 Schritt), und in einem Vortex-Mischer bei 4 ° C für 20 min kräftig schütteln. </li><li> Stechen Sie den Boden des Mikrozentrifugenröhrchen eine heiße 22 G-Nadel und legen Sie es auf der Spitze eines 15-ml sterilen konischen Röhrchen. </li><li> Zentrifuge bei 300 × g für 1 min bei 4 ° C, um das Zelllysat zu sammeln. Übertragen das Zelllysat in ein 1,5 ml Mikrozentrifugenröhrchen. </li><li> Hinzufügen 500 ul kaltem RNA Isolation Reagenz und 200 &amp; mgr; l Chloroform zu dem Zelllysat. Mischen Sie den Inhalt auf einem Vortex-Mixer und Zentrifuge bei 16.168 xg für 20 min bei 4 ° C. </li><li> Übertragen Sie die obere wässrige Phase in ein neues Mikrozentrifugenröhrchen. </li><li> Ein gleiches Volumen von kaltem Phenol / Chloroform / Isoamylalkohol (125: 24: 1) pH 4-5. Kräftig schütteln auf einem Vortex-Mischer und Zentrifuge bei 16.168 × g für 15 min bei 4 ° C. </li><li> Übertragen Sie die obere wässrige Phase, die RNA auf ein neues Mikrozentrifugenröhrchen. Wiederholen Sie Schritt 4.6 zwei weitere Male. </li><li> Um die endgültige RNA-haltige wässrige Phase, fügen 5 M NaCl stock eine Endkonzentration von 0,3 M zu erhalten, das Volumen von kaltem Ethanol In 3 mal die RNA auszufällen. <ol><li> Inkubieren für 1 h oder über Nacht bei -20 ° C. HINWEIS: Führen Sie die Schritte 4,9-4,11, während die Anti-BrdU-Perlen zum Blockieren inkubiert werden (siehe Schritt 5.3). </li></ol></li><li> Zentrifuge bei 16.168 xg für 20 min bei 4 ° C. Entfernen Sie den Überstand und resuspendieren RNA-Pellet in 100 ul DEPC (Diethylpyrocarbonat) Wasser. </li><li> Verwenden Sie eine RNA-Isolierung Mini-Kit, um die RNA aus den unincorporated BrUTP Nukleotide zu trennen. Eluieren der RNA von der Säule mit 100 &amp; mgr; l RNase-freiem Wasser. </li><li> Inkubieren Sie die RNA in einem 65 ° C Wasserbad für 5 min und dann übertragen auf Eis für mindestens 2 min. </li></ol> 5. Affinitätsreinigung von BrUTP-markierten RNA <ol><li> Bis 25 &amp; mgr; l Anti-BrdU besiedelt beads, 500 &amp; mgr; l 0,25x SSPE (Natrium Saline Phosphate EDTA) Bindungspuffer (20x SSPE: 3 M NaCl, 0,2 M NaH 2 PO 4 </sub&gt;, 0,02 M EDTA, pH 7,4, 1 mM EDTA, 0,05% Tween, 37,5 mM NaCl). Zentrifuge bei 200 × g für 30 s bei 4 ° C und entfernt den Überstand. </li><li> Wiederholen Sie Schritt 5.1 dreimal. </li><li> In 500 l Blocking-Puffer (1x Bindungspuffer, 0,1% Polyvinylpyrrolidon, 1 mg ultrareinem Rinderserumalbumin (BSA)) zu den Perlen und leicht schütteln mit 1 - 2 h bei 4 ° C auf einem Plattformschüttler. </li><li> Waschen der Kügelchen zweimal mit 500 ul Bindungspuffer, wie in Schritt 5.1 beschrieben. </li><li> In 400 &amp; mgr; l Bindungspuffer an die Kügelchen. </li><li> Transfer von 100 &amp; mgr; l RNA (aus Schritt 4.11) direkt an die Kügelchen. Inkubiere unter leichtem Schütteln für 1 - bei 4 ° C 2 h auf einem Plattformschüttler. </li><li> Waschen der Kügelchen nacheinander mit 500 ul Bindungspuffer, 500 &amp; mgr; l Puffer mit niedrigem Salz (0,2X SSPE, 1 mM EDTA, 0,05% Tween), 500 ul Hochsalzpuffer (0,25x SSPE, 1 mM EDTA, 0,05% Tween, 100 mM NaCl) und zweimal mit 500 ul TET-Puffer (1x TE, 0,05% Tween), Verspinnen bei200 xg für 30 s bei 4 ° C zwischen jedem Waschen. </li><li> Eluieren die BrUTP-markierte RNA aus Perlen nacheinander zweimal mit 150 &amp; mgr; l und einmal mit 200 &amp; mgr; l Elutionspuffer (20 mM DTT, 150 mM NaCl, 50 mM Tris-HCl pH 7,5, 1 mM EDTA, 0,1% SDS), durch Inkubieren für 4 min bei 42 ° C in einem Wasserbad mit einer kurzen Spin gefolgt Perlen von dem Überstand zu trennen. </li></ol> 6. Fällung von BrUTP Beschriftete RNA <ol><li> Fügen 500 ul kaltem Phenol / Chloroform / Isoamylalkohol (125: 24: 1) pH 4 - 5 an den affinitätsgereinigten BrUTP markierte RNA. Mit Hilfe eines Vortex-Mixer und Zentrifuge bei 16.168 × g für 15 min bei 4 ° C. </li><li> Übertragen Sie die obere wässrige Phase in ein neues Mikrozentrifugenröhrchen. </li><li> Zugabe von 5 M NaCl Lager um eine Endkonzentration von 0,3 M und 3-fachen Volumen von kaltem Ethanol zu erhalten, die RNA auszufällen. </li><li> Inkubieren bei -20 ° C über Nacht. </li><li> Sammeln des ausgefällten RNA durch Zentrifugation bei 16.168 xg für 30 min bei 4 ° C. &lt;/ Li&gt; <li> Entfernen Sie den Überstand und lassen Sie das Pellet an der Luft trocknen für 10 min. </li><li> Resuspendieren RNA-Pellet in 26 &amp; mgr; l DEPC-Wasser. </li><li> Bestimmen die endgültige RNA-Konzentration durch Absorption bei 260 nm unter Verwendung eines Spektrophotometers gemessen wird. Außerdem bestimmen die 260/280 Verhältnis. Ein Verhältnis ~ 2 ist kennzeichnend für eine reine RNA Probe. </li><li> Speichern die RNA-Proben in Aliquots bei -80 ° C bis zur cDNA-Synthese benötigt wird. </li></ol> 7. reverse Transkription von BrUTP markierte RNA <ol><li> Stellen Sie die RNA-Konzentration auf 100 ng / &amp; mgr; l mit DEPC Wasser. Verwenden Sie 0,5 ug RNA für jede cDNA-Synthesereaktion. HINWEIS: Die Konzentration der RNA-Matrize 0,5 bis 1,0 &amp; mgr; g variieren kann optimal cDNA-Synthese zu erreichen. </li><li> Reverse Transkription der RNA unter Verwendung von mehreren Rückwärtsprimer konstruiert stromabwärts des Poly (A) -Stelle (Terminationsstelle) , wie in 3A gezeigt. </li><li> Zu jeder reverse Transkriptionsreaktion, fügen Sie 5 ul RNA template (0,5 ug), 1 ul dNTP - Mix (jeweils 10 mM), 2 &amp; mgr; l reverse Primer C, D, E, F oder G (50 &amp; mgr; M jeweils) und nukleasefreiem Wasser (siehe 3A). Das endgültige Reaktionsvolumen in jedem Röhrchen 13 &amp; mgr; l. HINWEIS: Die Anzahl der reversen Transkriptionsreaktionen werden für die cDNA-Synthese verwendet, von der Anzahl der Rückwärtsprimer abhängen. Zum Beispiel für ASC1 fünf Reverse - Primer verwendet wurden und daher fünf Reverse Transkriptionsreaktionen wurden eingerichtet. Beschriften der Rohre als C, D, E, F und G auf der Basis der Reverse-Primer für die cDNA-Synthese verwendet. </li><li> Inkubieren der Röhrchen RNA-Matrize, dNTP-Mix und Primern in einem Thermocycler bei 65 ° C für 5 min mit einer beliebigen sekundären strukturellen Konformation zu entfernen, und dann Abkühlen auf 4 ° C für mindestens 2 min. </li><li> 1 ul reverse Transkriptase (200 U / &amp; mgr; l), 4 &amp; mgr; l Puffer und 2 ul 0,1 M DTT in jedes Röhrchen, enthaltend die RNA-Matrize und Primer (Schritt 7.4). Mix von sanft bis Pipettieren und ab. </li><li> Führen der reversen Transkription, indem die Reaktionsmischung in einem Thermocycler bei 42 ° C inkubiert für 60 min. </li><li> Inaktivierung der reversen Transkriptase bei 65 ° C für 20 min. </li><li> Lagern Sie die cDNA bei -20 ° C oder fahren Sie mit dem nächsten Schritt. </li></ol> 8. Amplification of cDNA <ol><li> Führen Sie die PCR - Reaktion zur Amplifikation von jeder cDNA - Präparation ( mit der Bezeichnung C, D, E, F und G für ASC1) aus Schritt 7.8 wie folgt: 3,0 &amp; mgr; l cDNA - Matrize aus Schritt 7.8 und 1.0 &amp; mgr; l Vorwärts - Primer B (10 &amp; mgr; M), 1,0 &amp; mgr; l Rückwärtsprimer C oder D oder E oder F oder G (10 uM), 2,5 ul 10x - Polymerase PCR - Puffer, 0,5 ul dNTP - Mix (jeweils 10 mM), 1,0 &amp; mgr; l MgCl 2 (2,5 mM) 15,5 &amp; mgr; l PCR-Wasser, und 0,5 ul thermostabile Polymerase-Enzym. HINWEIS: Verschiedene Verdünnungen von cDNA-Matrize im Bereich von 1: 5 bis 1: 100 getestet werden sollte, die PCR Produktausbeute zu optimieren. Ein einzelner Promotor-proximalen Vorwärts-Primer werden verwendet, um cDNA zu verstärkenmit verschiedenen Reverse-Primer erhalten. So wurde beispielsweise für ASC1 in Kombination mit fünf Rückwärtsprimer von C bis G ein einziger Vorwärtsprimer B in der Nähe des Promotors verwendet. BC, BD, BE, BF und BG in Rohren als C, D, E, F und G jeweils gekennzeichnet sind, verwendet wurden , wie in 3A gezeigt. </li><li> Führen Sie die PCR die folgenden thermischen Zyklus Parametern: 1 Zyklus 95 ° C für 2 min (Hot-Start für die Aktivierung der Polymerase), 30 - 40 Zyklen 95 ° C für 30 s (Denaturierung), 54 ° C für 15 s (Annealing) , 68 ° C für 1 min (Verlängerung) und 1 Zyklus 68 ° C für 5 min (final Extension). HINWEIS: Die Glühtemperatur auf den spezifischen Primern variieren je verwendet wird und die Verlängerungszeit in Abhängigkeit von der erwarteten Produktgröße variieren. </li><li> Trenne die PCR-Produkts durch Elektrophorese auf 0,8%, 1,5% bzw. 2% Agarose-Gelen auf der erwarteten Größe des Produkts abhängig. </li><li> Quantifizierung der PCR - Produkt wie in El Kaderi et al. 2012 11. HINWEIS: Alternativ können Sie Echtzeit-RT-qPCR-Strategie die Menge der im Entstehen begriffenen Transkripte zu quantifizieren. </li></ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

Die strangspezifischen TRO hier verwendete Protokoll wurde aus dem Protokoll für GRO-Seq (Global Run On-Sequenzierung) Analyse in Säugetierzellen 12 verwendet angepasst. Wir modifizierten erfolgreich das Protokoll in Bäckerhefe im Entstehen begriffenen Transkription zu studieren. Um insbesondere die Transkriptionsterminierungs Defekt zu analysieren, passten wir das Protokoll weiter, indem sie von der RNA-Hydrolyse Schritt befreien. Dies ermöglichte es uns, um speziell die volle Länge im Ents...

Die eukaryotischen Transkription Zyklus besteht aus drei Hauptschritten; Initiation, Elongation und Termination. Die Beendigung der Transkription durch RNA - Polymerase II besteht aus zwei verschiedenen, voneinander abhängigen Schritten 3. Der erste Schritt beinhaltet die Spaltung, die Polyadenylierung und die Freisetzung von mRNA aus der Vorlage, und wird sofort durch den zweiten Schritt, gekennzeichnet durch Ausrücken der Polymerase aus der Vorlage. Ordnungsgemäße Beendigung ist entscheidend für die Wiederverwertung der Polymerase während der Initiierung / Reinitiierung der Transkription, für eine Interferenz mit der Transkription der nachgeschalteten Gene zu verhindern, und für aberrant Transkription unter Kontrolle zu halten , indem die Transkription des Begrenzens pervasive nicht-codierende RNA 4, 5. Trotz der jüngsten Fortschritte ist Kündigung bei weitem am wenigsten verstandenen Schritt der RNA-Polymerase II Transkriptionszyklus. Eine zuverlässige Abschlusstest ist von wesentlicher Bedeutung für die Untersuchung des Mechanismus Sekundärmarkg Termination der Transkription durch RNA - Polymerase II in vivo. Eine Reihe von experimentellen Ansätze werden verwendet, um die Beendigung Defekt in einem aktiv transkribierten Gen unter physiologischen Bedingungen zu erfassen. Dazu zählen Northern Blot, Terminationsfaktor ChIP (Chromatin Immunopräzipitation) und die traditionelle TRO-Test. Jede dieser Techniken haben einige Vorteile und Nachteile. Die traditionelle TRO - Assay verwendet werden , um verlässliche und sensibles Vorgehen zum Nachweis eines Transkriptionsterminierungs Defekt in vivo 1. Dieser Assay lokalisiert die transkriptionell aktive Polymerase-Moleküle auf den verschiedenen Regionen eines Gens in der Zelle. Unter normalen Bedingungen zeigt der Assay transkriptionell Eingriff Polymerasemoleküle streng zwischen dem Promotor und Terminator - Region des Gens (1A) verteilt. Nach Beendigung defekte, jedoch ist die Polymerase nicht in der Lage das Beendigungssignal zu lesen,und in dem Bereich stromabwärts des 3&#39; - Endes des Gens (1B) detektiert. Eine Transkriptions - Terminationssequenz Defekt in Gegenwart eines Sinnes Transkribieren Polymerase manifestiert , die aus der Promotor-proximalen Bereich eingeleitet, und nicht in der Lage das Beendigungssignal zu lesen, setzt die Region stromabwärts von dem 3&#39; - Ende eines Gens transkribiert , wie in Abbildung gezeigt 2A. Mit der Erkenntnis , dass die eukaryotische Genom es überwältigend Pervasive Transkription in Sinn sowie Antisense - Richtungen in und um ein Gen , 6, 7, 8, 9, 10, wurde bald klar zeigt , dass die traditionelle TRO - Test nicht , wenn die Polymerase - Signal erkennen kann stromabwärts eines Gens stellt einen Promotor initiierte Transkript (2A) oder eine anomale RNA , die som initiiertewhere in der Mitte des Gens , oder stromabwärts des Terminators Element (2B) oder der Polymerase - Transkription in der anti-sense - Richtung vom 3&#39; - Ende des Gens (Figur 2C). Die strangspezifischen TRO-Assay unter Verwendung BrUTP hier beschriebenen unterscheiden, wenn die beobachtete Überlesen Polymerase Signal Promotor initiierte erweiterten Sinne mRNA oder ein Antisense-Transkript darstellt, die stromabwärts des Gens unter Prüfung eingeleitet. Wir haben diesen Ansatz erfolgreich verwendet in Bäckerhefe 2 die Rolle der Kin28 Kinase in Termination der Transkription zu demonstrieren. Der Einsatz der Ansatz hier zeigen wir , dass Rna14 für die Beendigung der Transkription von ASC1 in Bäckerhefe erforderlich ist.

<table><tbody><tr><td>Phenol-chloroform-isoamyl alcohol mixture</td><td>Sigma-Aldrich</td><td>77619</td><td>pH 4-5</td></tr><tr><td>TRIzol reagent</td><td>Life technologies</td><td>15596-026</td><td></td></tr><tr><td>RNase Inhibitor, human placenta</td><td>New England Biolabs</td><td>M0307S</td><td></td></tr><tr><td>Anti-BrdU beads</td><td>Santa Cruz Biotechnology</td><td>sc-32323AC</td><td></td></tr><tr><td>Protoscript II</td><td>New England Biolabs</td><td>M03368L</td><td>or an equivalent enzyme</td></tr><tr><td>Advantage 2 polymerase Mix</td><td>Clontech</td><td>639201</td><td>or an equivalent enzyme</td></tr><tr><td>5-Bromouridine 5&#039; triphosphate sodium salt</td><td>Santa Cruz Biotechnology</td><td>sc-214314A</td><td></td></tr><tr><td>RNeasy Mini kit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>ATP</td><td>New England Biolabs</td><td>N0451AA</td><td></td></tr><tr><td>CTP</td><td></td><td>N0454AA</td><td></td></tr><tr><td>GTP</td><td></td><td>N0452AA</td><td></td></tr><tr><td>Ultra-pure bovine serum albumin (BSA)</td><td>MC Labs</td><td>UBSA-100</td><td></td></tr><tr><td>Asc1 B</td><td></td><td></td><td>AGATTCGTCGGTCACAAGTCC</td></tr><tr><td>Asc1 C</td><td></td><td></td><td>GAACTTTATACATATTCTTAGTT&lt;br/&gt; AGCAGTC</td></tr><tr><td>Asc1 D</td><td></td><td></td><td>TGTACATATGTATTTTCGCAGCA</td></tr><tr><td>Asc1 E</td><td></td><td></td><td>GCCAAGGAGACTGAATTTAATG</td></tr><tr><td>Asc1 F</td><td></td><td></td><td>CTATGGAATGGGGGTTTTAAG</td></tr><tr><td>Asc1 G</td><td></td><td></td><td>GGTTATGGCAGACATGCCAC</td></tr><tr><td>5s cDNA</td><td></td><td></td><td>AGATTGCAGCACCTGAGT</td></tr><tr><td>5&amp;rsquo; 5s reverse</td><td></td><td></td><td>GGTTGCGGCCATATCTAC</td></tr><tr><td>3&amp;rsquo; 5s reverse</td><td></td><td></td><td>TGAGTTTCGCGTATGGTC</td></tr></tbody></table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

Dieses Manuskript beschreibt ein Protokoll Transkriptionsterminierungs Defekt in vivo zu erkennen. Die strangspezifischen TRO-Protokoll BrUTP hier beschrieben ist eine leistungsfähige experimentelle Ansatz für die Transkriptionsterminierungs Defekt unter physiologischen Bedingungen zu analysieren. Wie das traditionelle TRO - Assay beruht auf der Gegenwart einer transkriptionell aktiven Polymerase über das 3&#39; - Ende des Gens als ein Indikator für eine Transkriptions - Terminationssequenz Defekt 1. Es überwindet zwei große Probleme mit dem traditionellen TRO-Test festgestellt. Erstens kann sie erkennen, ob der Polymerase durch das Endsignal liest die ist, die Transkription von dem Promotor-proximalen initiiert Region oder wenn es einfach ist, die eine pervasively Transkribieren Polymerase, die unspezifisch von irgendwo in dem Körper eingeleitet bzw. das 3&#39; Ende des Gens. Zweitens kann es zu unterscheiden, ob die transcriptionsaktive Polymerase-Signal über dieTerminatorregion ist wirklich die Readthrough Sense-mRNA transkribiert Polymerase oder ein Terminator-initiierte nicht-codierende anti-sense RNA-Signal. Kurz gesagt umfasst das Protokoll die exponentiell wachsenden Hefezellen durchdringbar, so dass die Transkripte , die in Gegenwart des BrUTP Nukleotid zu verlängern in vivo initiierten BrUTP-markierte RNA durch die Affinität Ansatz Reinigung in umgekehrter gereinigter naszierende RNA und Amplifizieren der cDNA unter Verwendung Transkribieren strangspezifischen Primern den Promotor und die Terminator - Regionen des 2 - Gens flankieren.

Um die Anwendbarkeit des BrUTP strangspezifische TRO Verfahren bei der Erkennung eines Transkriptionsterminierungs Defekt zeigen, haben wir eine Beendigung-defekt, temperaturempfindliche Mutante von RNA14 rna14-1 genannt. Die Rolle der Rna14 in Beendigung der Transkription durch RNA - Polymerase II wurde mit der traditionellen TRO - Test gezeigt , dass RNA in der Terminator-proximalen Bereich ausgewählter Gene 1 nachgewiesen. Der Nachweis von RN...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

Die Analyse der Beendigung der Transkription unter Verwendung von BrUTP strangspezifische Transkription Run-on (TRO) Ansatz

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Research

JoVE Journal

Genetics

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

9.8K Aufrufe.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

Serie: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

Toeprinting Analyse der Übersetzung Einleitung Komplexbildung auf Säugetier-mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

Forschung

Biochemie

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3&#8217;-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.
In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

Künstliche RNA-Polymerase II-Dehnungskomplexe zur Sezieren von co-transkriptionellen RNA-Verarbeitungsereignissen

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

Genetik

Identification of RNA Fragments Resulting from Enzymatic Degradation using MALDI-TOF Mass Spectrometry

RNA is a biopolymer present in all domains of life, and its interactions with other molecules and/or reactive species, e.g., DNA, proteins, ions, drugs, and free radicals, are ubiquitous. As a result, RNA undergoes various reactions that include its cleavage, degradation, or modification, leading to biologically relevant species with distinct functions and implications. One example is the oxidation of guanine to 7,8-dihydro-8-oxoguanine (8-oxoG), which may occur in the presence of reactive oxygen species (ROS). Overall, procedures that characterize such products and transformations are largely valuable to the scientific community. To this end, matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry is a widely used method. The present protocol describes how to characterize RNA fragments formed after enzymatic treatment. The chosen model uses a reaction between RNA and the exoribonuclease Xrn-1, where enzymatic digestion is halted at oxidized sites. Two 20-nucleotide long RNA sequences [5&#39;-CAU GAA ACA A(8-oxoG)G CUA AAA GU] and [5&#39;-CAU GAA ACA A(8-oxoG)(8-oxoG) CUA AAA GU] were obtained via solid-phase synthesis, quantified by UV-vis spectroscopy, and characterized via MALDI-TOF. The obtained strands were then (1) 5&#39;-phosphorylated and characterized via MALDI-TOF; (2) treated with Xrn-1; (3) filtered and desalted; (4) analyzed via MALDI-TOF. This experimental setup led to the unequivocal identification of the fragments associated with the stalling of Xrn-1: [5&#39;-H2PO4-(8-oxoG)G CUA AAA GU], [5&#39;-H2PO4-(8-oxoG)(8-oxoG) CUA AAA GU], and [5&#39;-H2PO4-(8-oxoG) CUA AAA GU]. The described experiments were carried out with 200 picomols of RNA (20 pmol used for MALDI analyses); however, lower amounts may result in detectable peaks with spectrometers using laser sources with more power than the one used in this work. Importantly, the described methodology can be generalized and potentially extended to product identification for other processes involving RNA and DNA, and may aid in the characterization/elucidation of other biochemical pathways.

MALDI-TOF was used to characterize fragments obtained from the reactivity between oxidized RNA and the exoribonuclease Xrn-1. The present protocol describes a methodology that can be applied to other processes involving RNA and/or DNA.

Identifizierung von RNA-Fragmenten aus dem enzymatischen Abbau mittels MALDI-TOF-Massenspektrometrie

RNA is a biopolymer present in all domains of life, and its interactions with other molecules and/or reactive species, e.g., DNA, proteins, ions, drugs, ...

PAR-CliP - A Method to Identify Transcriptome-wide the Binding Sites of RNA Binding Proteins

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) that are often expressed in a cell-type dependently. To understand how the interplay of these RNA-binding factors affects the regulation of individual transcripts, high resolution maps of in vivo protein-RNA interactions are necessary1.
A combination of genetic, biochemical and computational approaches are typically applied to identify RNA-RBP or RNA-RNP interactions. Microarray profiling of RNAs associated with immunopurified RBPs (RIP-Chip)2 defines targets at a transcriptome level, but its application is limited to the characterization of kinetically stable interactions and only in rare cases3,4 allows to identify the RBP recognition element (RRE) within the long target RNA. More direct RBP target site information is obtained by combining in vivo UV crosslinking5,6 with immunoprecipitation7-9 followed by the isolation of crosslinked RNA segments and cDNA sequencing (CLIP)10. CLIP was used to identify targets of a number of RBPs11-17. However, CLIP is limited by the low efficiency of UV 254 nm RNA-protein crosslinking, and the location of the crosslink is not readily identifiable within the sequenced crosslinked fragments, making it difficult to separate UV-crosslinked target RNA segments from background non-crosslinked RNA fragments also present in the sample.
We developed a powerful cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs that we term PAR-CliP (Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation) (see Fig. 1A for an outline of the method). The method relies on the incorporation of photoreactive ribonucleoside analogs, such as 4-thiouridine (4-SU) and 6-thioguanosine (6-SG) into nascent RNA transcripts by living cells. Irradiation of the cells by UV light of 365 nm induces efficient crosslinking of photoreactive nucleoside-labeled cellular RNAs to interacting RBPs. Immunoprecipitation of the RBP of interest is followed by isolation of the crosslinked and coimmunoprecipitated RNA. The isolated RNA is converted into a cDNA library and deep sequenced using Solexa technology. One characteristic feature of cDNA libraries prepared by PAR-CliP is that the precise position of crosslinking can be identified by mutations residing in the sequenced cDNA. When using 4-SU, crosslinked sequences thymidine to cytidine transition, whereas using 6-SG results in guanosine to adenosine mutations. The presence of the mutations in crosslinked sequences makes it possible to separate them from the background of sequences derived from abundant cellular RNAs.
Application of the method to a number of diverse RNA binding proteins was reported in Hafner et al.18

RNA transcripts are subject to extensive posttranscriptional regulation that is mediated by a multitude of trans-acting RNA-binding proteins (RBPs). Here we present a generalizable method to identify precisely and on a transcriptome-wide scale the RNA binding sites of RBPs.

PAR-Clip - Ein Verfahren zur Transkriptom-weiten die Bindungsstellen des RNA-bindende Proteine ​​Identifizieren

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ...

Biologie

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

Substrat Generation für Endonukleasen der CRISPR / Cas-Systeme

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes precursor mRNA beyond the end of mature RNAs, and an active process of endonuclease activity is required at a specific site. Cleavage of the precursor RNA normally occurs 10-30 nt downstream from the consensus polyA site (AAUAAA) after the CA dinucleotides. Proteins from the cleavage complex, a multifactorial protein complex of approximately 800 kDa, accomplish this specific nuclease activity. Specific RNA sequences upstream and downstream of the polyA site control the recruitment of the cleavage complex. Immediately after cleavage, pre-mRNAs are polyadenylated by the polyA polymerase (PAP) to produce mature stable RNA messages.
Processing of the 3&#8217; end of an RNA transcript may be studied using cellular nuclear extracts with specific radiolabeled RNA substrates. In sum, a long 32P-labeled uncleaved precursor RNA is incubated with nuclear extracts in vitro, and cleavage is assessed by gel electrophoresis and autoradiography. When proper cleavage occurs, a shorter 5&#8217; cleaved product is detected and quantified. Here, we describe the cleavage assay in detail using, as an example, the 3&#8217; end processing of HIV-1 mRNAs.

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

RNA polymerase II synthesizes a precursor RNA that extends beyond the 3' end of the mature mRNA. The end of the mature RNA is generated cotranscriptionally, at a site dictated by RNA sequences, via the endonuclease activity of the cleavage complex. Here, we detail the method to study cleavage reactions in vitro.

Die Analyse der RNA-Prozessierung Reaktionen mit Handy Free Systems: 3 &#39;Ende Spaltung von prä-mRNA-Substrate<em&gt; In-vitro-</em

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes ...

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

Fluorescence based primer extension (FPE) is a molecular method to determine transcriptional starting points or processing sites of RNA molecules. This is achieved by reverse transcription of the RNA of interest using specific fluorescently labeled primers and subsequent analysis of the resulting cDNA fragments by denaturing polyacrylamide gel electrophoresis. Simultaneously, a traditional Sanger sequencing reaction is run on the gel to map the ends of the cDNA fragments to their exact corresponding bases. In contrast to 5&#39;-RACE (Rapid Amplification of cDNA Ends), where the product must be cloned and multiple candidates sequenced, the bulk of cDNA fragments generated by primer extension can be simultaneously detected in one gel run. In addition, the whole procedure (from reverse transcription to final analysis of the results) can be completed in one working day. By using fluorescently labeled primers, the use of hazardous radioactive isotope labeled reagents can be avoided and processing times are reduced as products can be detected during the electrophoresis procedure.
In the following protocol, we describe an in vivo fluorescent primer extension method to reliably and rapidly detect the 5&#39; ends of RNAs to deduce transcriptional starting points and RNA processing sites (e.g., by toxin-antitoxin system components) in S. aureus, E. coli and other bacteria.

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

We here describe a fluorescence based primer extension method to determine transcriptional starting points from bacterial transcripts and RNA processing in vivo using an automated gel sequencer.

Fluoreszenzbasierten Primer Extension-Technik, um Transkriptionsstartpunkte und Schnittstellen von RNasen Bestimmen<em&gt; In Vivo</em

Fluorescence based primer extension (FPE) is a molecular method to determine transcriptional starting points or processing sites of RNA molecules. This is ...

Rapid Verification of Terminators Using the pGR-Blue Plasmid and Golden Gate Assembly

The goal of this protocol is to allow for the rapid verification of bioinformatically identified terminators. Further, the plasmid (pGR-Blue) is designed specifically for this protocol and allows for the quantification of terminator efficiency. As a proof of concept, six terminators were bioinformatically identified in the mycobacteriophage Bernal13. Once identified, terminators were then made as oligonucleotides with the appropriate sticky ends and annealed together. Using Golden Gate Assembly (GGA), terminators were then cloned into pGR-Blue. Under visible light, false positive colonies appear blue and positively transformed colonies are white/yellow. After induction of an arabinose inducible promoter (pBad) with arabinose, colony strength can be determined by measuring the ratio of green fluorescent protein (GFP) produced to red fluorescent protein (RFP) produced. With pGR-Blue, the protocol can be completed in as little as three days and is ideal in an educational setting. Additionally, results show that this protocol is useful as a means for understanding in silico predictions of terminator efficiency related to the regulation of transcription.

This protocol utilizes Golden Gate Assembly and the plasmid pGR-blue to rapidly quantify the strength of terminators found in silico.

Schnelle Überprüfung von Terminatoren Mit PGR-Blau Plasmide und Golden Gate Assembly

The goal of this protocol is to allow for the rapid verification of bioinformatically identified terminators. Further, the plasmid (pGR-Blue) is designed ...

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

Genome duplication is orchestrated by replisome proteins, including helicases, which unwind double-stranded DNA into individual antiparallel single strands, each requiring distinct modes of replication: continuous (leading) and discontinuous (lagging). Understanding the interactions of chromatin-associated proteins with replicating DNA strands in vivo is crucial for elucidating the mechanisms of chromatin assembly and DNA repair coupled to DNA replication. This protocol presents the enrichment and sequencing of protein-associated nascent DNA (eSPAN) method, designed to quantify relative protein levels on nascent leading and lagging DNA strands at replication forks. The eSPAN procedure starts with chromatin immunoprecipitation (ChIP, in yeast) or cleavage under targets and tagmentation (CUT&amp;Tag; in mammalian cells) of a protein of interest, followed by enrichment of the protein-associated nascent DNA by bromodeoxyuridine (BrdU) immunoprecipitation. Strand-specific next-generation sequencing is applied to isolated ssDNA. This technique can be used to determine whether a protein is enriched at leading or lagging replication forks. The eSPAN provides genome-wide strand-preference of chromatin-associated proteins, including histones at replication forks.

Enrichment and sequencing of protein-associated nascent DNA (eSPAN) was developed to detect the relative abundance of a chromatin-associated protein on two replicating DNA strands, thereby revealing molecular insight into chromatin replication and its coupled processes. This protocol describes eSPAN procedures in yeast and mouse embryonic stem (ES) cells.

Genome duplication is orchestrated by replisome proteins, including helicases, which unwind double-stranded DNA into individual antiparallel single ...

Transcription Attenuation in Prokaryotes

Transcriptional attenuation occurs when&#160;RNA transcription is prematurely terminated due to the formation of a terminator mRNA hairpin structure.&#160; Bacteria use these hairpins to regulate the transcription process and control the synthesis of several amino acids including histidine, lysine, threonine, and phenylalanine. Transcription attenuation takes place in the non-coding regions of mRNA.
There are several different mechanisms used to attenuate transcription. In ribosome mediated transcriptional attenuation, the movement of a ribosome on the transcript is stalled or proceeds forward depending upon the availability of the tRNAs charged with a specific amino acid. High amino acid concentrations allow the ribosome to move forward leading to the formation of the terminator structure; deficiency of the amino acid stalls the ribosome and causes formation of the anti-terminator structure. The trp operon in E. coli, discussed below, is a good example of this type of mechanism. tRNA mediated transcriptional attenuation, as observed in trp operon of Lactococcus lactis, depends on an RNA-RNA interaction. When uncharged tRNAs are present in sufficient numbers, they directly bind to the mRNA and stabilize the anti-terminator structure. Transcriptional attenuation is also known to be mediated by proteins as found in bgl (beta-glucoside) operon in E. coli.&#160; This involves an RNA&#8212;protein interaction where a protein binds to the transcript and regulates the formation of an anti-terminator structure. More recently, another transcriptional attenuation mechanism was discovered where small metabolites like thiamine were observed to regulate transcription by directly binding to the non-coding mRNA segments, also known as riboswitches. Riboswitches can form a terminator or an anti-terminator structure depending upon the concentration and nature of a metabolite.&#160;
Trp Operon
The trp operon in E. coli contains a 140 nucleotide leader sequence before its first structural gene. This leader sequence has four distinct segments &#8211; 1 through 4&#8211; and regulates the transcription of the downstream structural genes. Segment&#160; 1 can form a hairpin structure with segment&#160; 2. This 1-2 hairpin structure is known as a pause structure, as during transcription, it stalls RNA polymerase until the ribosome binds the newly transcribed RNA. This synchronizes transcription and translation in bacteria.&#160; When tryptophan concentrations are low, a hairpin structure forms between segments 2 and 3, known as the anti-terminator structure. This anti-terminator structure allows the continuous transcription of the downstream genes which produce enzymes for tryptophan synthesis. In contrast, when tryptophan concentrations are sufficient, a hairpin structure forms between segments 3 and 4, called the terminator structure. Along with a&#160; series of uracil bases that follow, the terminator structure causes RNA polymerase to dissociate from the RNA and template DNA strands, resulting in the termination of the transcription.

Die Analyse der Beendigung der Transkription unter Verwendung von BrUTP strangspezifische Transkription Run-on (TRO) Ansatz

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Toeprinting Analyse der Übersetzung Einleitung Komplexbildung auf Säugetier-mRNAs

Künstliche RNA-Polymerase II-Dehnungskomplexe zur Sezieren von co-transkriptionellen RNA-Verarbeitungsereignissen

Identifizierung von RNA-Fragmenten aus dem enzymatischen Abbau mittels MALDI-TOF-Massenspektrometrie

PAR-Clip - Ein Verfahren zur Transkriptom-weiten die Bindungsstellen des RNA-bindende Proteine Identifizieren

Substrat Generation für Endonukleasen der CRISPR / Cas-Systeme

Die Analyse der RNA-Prozessierung Reaktionen mit Handy Free Systems: 3 'Ende Spaltung von prä-mRNA-Substrate

Fluoreszenzbasierten Primer Extension-Technik, um Transkriptionsstartpunkte und Schnittstellen von RNasen Bestimmen

Schnelle Überprüfung von Terminatoren Mit PGR-Blau Plasmide und Golden Gate Assembly

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

Transkriptionsabschwächung in Prokaryoten

Die Analyse der Beendigung der Transkription unter Verwendung von BrUTP strangspezifische Transkription Run-on (TRO) Ansatz

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Toeprinting Analyse der Übersetzung Einleitung Komplexbildung auf Säugetier-mRNAs

Künstliche RNA-Polymerase II-Dehnungskomplexe zur Sezieren von co-transkriptionellen RNA-Verarbeitungsereignissen

Identifizierung von RNA-Fragmenten aus dem enzymatischen Abbau mittels MALDI-TOF-Massenspektrometrie

PAR-Clip - Ein Verfahren zur Transkriptom-weiten die Bindungsstellen des RNA-bindende Proteine ​​Identifizieren

Substrat Generation für Endonukleasen der CRISPR / Cas-Systeme

Die Analyse der RNA-Prozessierung Reaktionen mit Handy Free Systems: 3 'Ende Spaltung von prä-mRNA-Substrate

Fluoreszenzbasierten Primer Extension-Technik, um Transkriptionsstartpunkte und Schnittstellen von RNasen Bestimmen

Schnelle Überprüfung von Terminatoren Mit PGR-Blau Plasmide und Golden Gate Assembly

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

Transkriptionsabschwächung in Prokaryoten

PAR-Clip - Ein Verfahren zur Transkriptom-weiten die Bindungsstellen des RNA-bindende Proteine Identifizieren