Name: selection-dependent and independent generation of crispr/cas9-mediated gene knockouts in mammalian cells
Uploaded: 2017-06-16T15:00:00.000+00:00
Duration: 11 min 35 s
Description: Watch this Scientific Journal Video about Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells at JoVE.com

Die Autoren möchten Gissell Sanchez, Megan Lee und Jason Estep für experimentelle Hilfe und Weifeng Gu und Xuemei Chen für den Austausch von Reagenzien anerkennen.

1. Identifizierung von Homologieregionen um die gewünschte Löschung HINWEIS: Nur bei selektionsbasierter Bearbeitung erforderlich. <ol><li> Wähle zwei Regionen, anfänglich 1,5-2 kb, auf beiden Seiten des gewünschten Löschorts, die als Homologiearme in der HDR-Schablone dienen (Abbildung 1A ). Identifizieren Sie Regionen, die BsaI-Erkennungsstellen auf beiden Strang (GGTCTC) fehlen, um das Klonen zu erleichtern. Wenn BsaI-Stellen unvermeidbar sind, verwenden Sie ein alternatives IIs-Restriktionsenzym (BsmBI, SapI, BbsI) und modifizieren die entsprechenden Stellen im Empfängerplasmid (pUC19-BsaI), Resistenzmarker-Donor-Plasmid (pGolden-Neo oder pGolden-Hygro) und Homologie Arm PCR Produkt Überhänge. </li></ol> 2. Erzeugung von Cas9-sgRNA-Expressionsplasmiden <ol><li> Definiere die Zielstelle (n) für die Mutagenese. Für die Single-Cut, Selektions-freie Methode, Ziel 5 &#39;proximale Codierung Exons, um die Wahrscheinlichkeit einer Nicht-FU zu erhöhenNationale Mutation. Für die Zwei-Cut-Methode, wählen Sie zwei Standorte, die so viel von dem Gen wie nötig überspannen. HINWEIS: Nach unserer Erfahrung werden Löschungen bis zu 53 kb effizient erstellt. </li><li> Geben Sie 200 bis 300 bp der Ziel-Sequenz in das crispr.mit.edu-Design-Tool ein. Zur selektionsbasierten Klonierung verwenden Sie 200-300 bp der identifizierten Homologieregionen, die proximal zum Deletionsort sind (Abbildung 1A ). Wählen Sie 2-3 der höchstrangigen sgRNAs pro Zielregion aus, um Unterschiede in ihrer Aktivität zu berücksichtigen und unabhängige Klone zu isolieren, die nicht die gleichen potentiellen Off-Target-Effekte teilen. </li><li> Um duplexierte Oligonukleotide mit geeigneten Überhängen für die Insertion in das Expressionsplasmid zu entwerfen, weglassen sie die endgültige PAM-Sequenz (NGG) und hängen einen 5&#39;-CACC-Überhang an, gefolgt von einem G zum Top-Strang-Oligo. Für den unteren Strang-Oligo, hängen Sie einen 5&#39;-AAAC-Überhang auf die umgekehrt-ergänzte Zielsequenz, gefolgt von einem 3&#39;-C, als ilLustriert unten: <img alt="Sequenz 1" src="/files/ftp_upload/55903/55903seq01.jpg" /></li><li> Insert synthetische Oligonukleotide entsprechend den sgRNAs in das pSpCas9 (BB) Plasmid unter Verwendung der Golden Gate Klonierung 28, wie in dem Zhang Laborprotokoll 29 beschrieben. </li></ol> 3. Erzeugung von Homologie-gerichteten Reparatur-Template-Plasmiden HINWEIS: Nur bei selektionsbasierter Bearbeitung erforderlich. Das homologiegesteuerte Reparaturschablonenplasmid besteht aus einer Arzneimittelresistenzkassette, die von zwei Regionen flankiert ist, die komplementär zum Genom gerade außerhalb der beiden sgRNA-Zielstellen sind ( 1B ). <ol><li> Aus den in Schritt 1.1 identifizierten breiteren Homologie-Regionen wählen Sie 800-1000 bp 26 nicht mehr als 5-10 bp weg von den entworfenen Cas9-Schnittorten, um als Homologie-Arme zu dienen (Abbildung 1A ). Achten Sie darauf, die sgRNA nicht einzuschließenZiel-Site und seine PAM in der Homologie Arme, da dies wird dazu führen, dass CRISPR / Cas9 Spaltung der Vorlage Plasmid selbst. Wenn die Homologiearme interne BsaI-Standorte enthalten, verwenden Sie alternative sgRNA-Stellen. </li><li> PCR amplifiziert Homologiearme aus genomischer DNA unter Verwendung einer hochauflösenden DNA-Polymerase nach den Anweisungen des Herstellers unter Verwendung von Vorwärts- und Rückwärtsprimern mit einer zusätzlichen 5&#39;-Sequenz, die BsaI-Stellen (GGTCTC) und einzigartige Überhänge an beiden Enden der Homologieregion einführt. Die Überhänge müssen korrekte Sequenzen enthalten, um eine korrekte Montageordnung und Orientierung zu erzeugen, wie unten beschrieben (Abbildung 1B ): Linker Homologiearm FP-Überhang: 5 &#39;GGGTCTCA GGCC Linker Homologiearm RP-Überhang: 5 &#39;GGGTCTCT CACG Recht Homologie Arm FP Überhang: 5 &#39;GGGTCTCA GTCC Recht Homologie Arm RP Überhang: 5 &#39;GGGTCTCT CCAC </li><li> Überprüfen Sie die Homologiearme für den entsprechenden VerstärkerÜber die Gelelektrophorese vor dem Fortfahren. </li><li> Montieren Sie die rechte und linke Homologiearmregionen mit der Resistenzkassette in ein HDR Template Plasmid von Golden Gate Cloning 28 . Verwenden Sie pGolden-Neo oder pGolden-Hygro-Plasmide 30 als Quelle für loxP-flankierte Resistenzkassetten (loxP-PGK-Neo-pA-loxP oder loxP-PGK-Hyg-pA-loxP). Verwenden Sie pUC19-BsaI, ein modifiziertes pUC19 mit BsaI-Stellen in der multiplen Klonierungsregion und eliminiert BsaI-Stellen an anderer Stelle als den Empfängervektor (auf Anfrage erhältlich). Verwenden Sie für die drei Einsätze und den Vektor ein Verhältnis von 1: 1: 1: 1. <ol><li> Vorbereitung der folgenden Reaktionsmischung 30 : <table><tbody><tr><td> Richtige Homologie Arm PCR Produkt </td><td> 0,06 pmol (30-40 ng) </td></tr><tr><td> Linkes Homologiearm PCR Produkt </td><td> 0,06 pmol (30-40 ng) </td></tr><tr><td> PGolden-Neo-Plasmid (100 ng / &amp; mgr; l) </td><td> 1 &amp;# 181; L </td></tr><tr><td> PUC19-BsaI-Plasmid (100 ng / &amp; mgr; l) </td><td> 1 &amp; mgr; l </td></tr><tr><td> 2x T7 DNA-Ligasepuffer </td><td> 5 &amp; ​​mgr; l </td></tr><tr><td> BsaI (10 U / &amp; mgr; l) </td><td> 0,75 &amp; mgr; l </td></tr><tr><td> T7-DNA-Ligase (3000 U / &amp; mgr; l) </td><td> 0,25 &amp; mgr; l </td></tr><tr><td> Wasser </td><td> Bis zu 10 μl </td></tr></tbody></table></li><li> Verwenden Sie folgende Thermocycler-Parameter: 37 ° C für 5 min, 20 ° C für 5 min. Wiederholen Sie für 30 Zyklen. </li><li> Behandeln Sie das Klonprodukt mit einer Exonuklease nach den Anweisungen des Herstellers, um jede verbleibende linearisierte DNA zu verdauen. </li><li> Umwandlung der Reaktionsmischung in einen kompetenten E. coli- Stamm gemäß dem mit den Zellen gelieferten Protokoll und Platte auf Ampicillin-haltigen Schalen. </li></ol></li><li> Um Klone mit der richtigen Schablonenanordnung zu identifizieren, Bakterien ausführenAl Kolonie PCR, um die Homologiearm-Teilbereiche des zusammengebauten Einsatzes zu verstärken (da der gesamte Einsatz zu groß sein kann, um zuverlässig zu verstärken). Verwenden Sie eine Primerglühung für die flankierende Plasmidsequenz und einen zweiten Primer, der komplementär zum Rand der Resistenzkassette ist (Abbildung 1B , die Sequenz ist sowohl für Neo- als auch Hygro-Insertionen üblich), wodurch ein assemblierungsabhängiges Produkt erzeugt wird, das etwa 200 bp länger ist als Der enthaltene Homologiearm: PUC19-Bsal-Links: 5 &#39;GGCTCGTATGTTGTGTGGAATTGTGAG Widerstand-Links: 5 &#39;AAAAGCGCCTCCCCTACCC PUC19-BsaI-rechts: 5 &#39;GCTATTACGCCAGCTGGCGAAA Widerstands-rechts: 5 &#39;AAGACAATAGCAGGCATGCTGGG <ol><li> Pick-Bakterien-Kolonien mit sterilen Zahnstochern und suspendieren die Bakterien in 20 μl Wasser. Bei 95 ° C für 15 min erhitzen und in einer Tischzentrifuge bei maximaler Geschwindigkeit für 5 min abreiben. Legen Sie sofort auf Eis. </li><li> Vorbereitung der folgenden PCR-Mischung 31 &lt;/ Sup&gt;: <table><tbody><tr><td> Kolonievorlage verdünnen </td><td> 1,25 &amp; mgr; l </td></tr><tr><td> 10x Taq-Reaktionspuffer </td><td> 1,25 &amp; mgr; l </td></tr><tr><td> 20mM dNTPs </td><td> 0,25 &amp; mgr; l </td></tr><tr><td> 10 μM Vorwärtsprimer </td><td> 0,25 &amp; mgr; l </td></tr><tr><td> 10 μM Rückwärtsprimer </td><td> 0,25 &amp; mgr; l </td></tr><tr><td> Taq-Polymerase </td><td> 0,25 &amp; mgr; l </td></tr><tr><td> Wasser </td><td> 9 &amp; mgr; l </td></tr></tbody></table></li><li> Verwenden Sie die folgenden Thermocycler-Parameter: 95 ° C für 30 s, (95 ° C 30 s, 61 ° C für 30 s, 72 ° C für 1 min / kb), wiederholen Sie für 25 Zyklen, 72 ° C für 2 min. </li><li> Kontrollieren Sie das PCR-Produkt auf korrekte Amplikongröße durch Agarose-Gelelektrophorese. </li><li> Optional können Miniprep-Plasmid-DNA aus einzelnen Kolonien mit korrekter Insert-Größe und Sequenz thE-Homologie-Armregionen durch Sanger-Sequenzierung mit den oben erwähnten Amplifikations-Primern. </li></ol></li></ol> 4. Transfektion von CRISPR-Komponenten in kultivierte Zellen <ol><li> Vor der Transfektion: Kultur-T-REx293-Zellen in DMEM-Medien, ergänzt mit 10% FBS bei 37 ° C und 5% CO 2 . </li><li> Tafeln Sie Zellen auf 6-Well-Platten und wachsen auf etwa 70% Konfluenz. Füge einen Brunnen für eine untransfizierte Kontrolle ein. </li><li> Transfektion von Zellen mit 2,5 μg Gesamtplasmid unter Verwendung eines kommerziellen Transfektionsprotokolls. Parallel dazu die untransfizierte Kontrolle beibehalten. HINWEIS: Transfektionsmethode und Effizienz variieren je nach Zelltyp. Bestimmen Sie die geeignete Transfektionsmethode für das System vor dem Experiment. <ol><li> Für die Transfektion von Zellen mit Selektion verwenden Sie 0,75 μg Cas9-sgRNA 1 (links geschnitten), 0,75 μg Cas9-sgRNA 2 (rechts geschnitten) und 1,0 μg homologe Rekombinationsschablone. </li><li> Für transfectiVon Zellen ohne Selektion, verwenden Sie 2,5 μg Cas9-sgRNA Plasmid. </li></ol></li></ol> 5. Drug Selection <ol><li> 48 h nach der Transfektion behandeln die Zellen mit dem entsprechenden Medikament (Neomycin / Hygromycin). Führen Sie die Selektion durch, bis alle Zellen in der nicht transfizierten Kontrolldüse (typischerweise 3-5 Tage für Neo, 7-14 Tage für Hygro). HINWEIS: Verwenden Sie Konzentrationen von 500 μg / ml und 10 μg / ml für Neomycin bzw. Hygromycin für T-REx293-Zellen. Für andere Zelltypen kann es nützlich sein, eine vorherige Titration des Arzneimittels auf nicht transfizierten Zellen durchzuführen, um die wirksame Konzentration zu bestimmen. </li></ol> 6. Isolierung von Klonpopulationen <ol><li> Wachsen Sie Zellen zu 100% Konfluenz in der ursprünglichen gut nach Auswahl. Seed-Zellen in 96-Well-Platten mit einer Dichte von 0,33 Zellen pro Vertiefung. HINWEIS: Das Samen von drei Platten mit 96 Vertiefungen ist ein guter Ausgangspunkt, um die Isolierung von mehr als einem korrekten Klon zu gewährleisten, aber mehr oder weniger kann erforderlich seinEnden auf sgRNA und HDR effizienzen. </li><li> Beobachten Sie Kolonien über einen Zeitraum von 2-4 Wochen, bis Kolonien für das Auge sichtbar sind. Sehe sichtbare Kolonien mit einer sterilen Pipettenspitze auf und setze in neuen Brunnen ein, um das Monolayer-Wachstum zu fördern. Bei der Verwendung von Suspensionszellen können sogar niedrigere Saatdichten verwendet werden, um einen größeren Anteil an Einzelkolonien-Vertiefungen zu gewährleisten. </li></ol> 7. Screening Kandidaten <ol><li> Screening Kandidaten ohne die Verwendung von Auswahl: Dot Blot <ol><li> Wachsen Sie einzelne Klone zu 50-100% Konfluenz. Die Monoschicht der Zellen durch Pipettieren innerhalb des Brunnens auslöschen </li><li> Aliquotieren Sie 90 μl des 100 μl Gesamtvolumens zu einem sauberen Mikrozentrifugenröhrchen. 5 Minuten lang bei 6000 U / min abspülen, Medium entfernen und Zellpellet in 10 μl 1x Lysepuffer oder 1x SDS-Beladungspuffer (5x: 250 mM Tris-Cl pH 6,8, 8% SDS, 0,1% Bromphenolblau, 40% Glycerin, 100 mM DTT). Fügen Sie 90 μl neue Medien in den Rest der Zellen in der welIch bleibe weiter fortpflanzen. </li><li> 1 &amp; mgr; l Zelllysat auf eine trockene Nitrozellulosemembran pipettieren, um einen Punkt zu bilden. Blot jede Probe zweimal auf zwei getrennten Membranen, die Schaffung von zwei identischen Muster von Proben. </li><li> Blockieren Sie die Membranen in 5% Milch in TBST (Tris gepufferte Salzlösung + 0,01% Tween 20: 8 g NaCl, 0,2 g KCl, 3 g Tris-Base, bis zu 1 l destilliertem Wasser, pH 7,4) 31 für 1 h bei Raumtemperatur ( Mit Schaukeln, hier und während des ganzen Verfahrens). </li><li> Blot unter Verwendung des primären Antikörpers gegen das Zielprotein auf einer Membran und der primäre Antikörper für ein Kontrollprotein (Tubulin, GAPDH oder irgendein anderes Protein, das sich nicht ändern wird) auf der anderen Seite. Verwenden Sie die empfohlene primäre Antikörperverdünnung (0,2 μg / ml für ELAVL1 und 0,1 μg / ml für Pum2 in diesem Fall) in TBST + 5% Milch. 1 h bei Raumtemperatur inkubieren. </li><li> 3 mal mit TBST für 5 min waschen. </li><li> Inkubieren Sie jede Membran mit einem geeigneten HRP-konjugierten sekundären Antikörper in TBST + 5% Milch für 1 h bei Raumtemperatur. </li><li> 3 mal mit TBST für 5 min waschen. </li><li> Die Chemilumineszenz-Substratlösung (siehe Werkstofftabelle) nach den Anweisungen des Herstellers auftragen und die blotted Membran auf einen digitalen Chemilumineszenz-Imager auftragen. </li><li> Quantifizierung der Punktintensitäten für die Ziel- und Kontrollproteine ​​mit der entsprechenden Software. </li><li> Eliminieren Sie Kandidaten mit niedrigem Kontrollproteinsignal und berechnen Sie Hintergrund-subtrahierte Verhältnisse von Ziel, um Proteinintensitäten für die verbleibenden Kandidaten zu kontrollieren. Wählen Sie die Kandidaten mit den niedrigsten Verhältnissen für Passage und weitere Validierung durch Western Blot. </li></ol></li><li> Screening Kandidaten mit der Verwendung von Auswahl: Kolonie PCR <ol><li> Sammle das Zelllysat unter Verwendung eines DNA- Präparats (siehe Materialtabelle ). <ol><li> Duplizieren Sie einzelne Kolonien in einem neuen 96 Brunnen und wachsen bis 100% Konfluenz. </li><li> Medien aus einem Satz der Klone entfernen, aNd die Zellen in 30 μl Extraktionspuffer aus dem Kit resuspendieren. Überführung in ein sauberes 1,5 mL Mikrozentrifugenröhrchen. </li><li> Die Lösung 15 Minuten lang auf 96 ° C erhitzen und auf Raumtemperatur abkühlen lassen. </li><li> Füge 30 μl Stabilisierungspuffer aus dem Kit hinzu. Gut mischen. </li></ol></li><li> Identifizierung von Wildtyp- und Monoallelic / Biallelic-Mutantenlinien durch Kolonie-PCR. <ol><li> Entwerfen Sie zwei getrennte Sätze von PCR-Primern (für die linke und rechte Seite des Zielortes), um Regionen um die Homologiearme zu verstärken, die entweder auf einer erfolgreichen oder erfolglosen Integration der Widerstandskassette basieren (Abbildung 2C ). Auf jeder Seite eine gemeinsame Grundierung (rot) verwenden, die außerhalb des Homologiearms anhebt. Verwenden Sie es mit einem entsprechenden gepaarten Primer, der komplementär zur endogenen Sequenz ist, die den Homologiebereich (blau) überspannt, um das Wildtyp-Allel zu testen. Verwenden Sie einen anderen gepaarten Primer, komplementär zur eingesetzten Resistenzkassette (siehe Primer im Abschnitt2.3), um die gewünschte Mutation zu testen. </li><li> (Empfohlen) Validieren der Primersätze unter Verwendung von Zelllysat aus der ursprünglichen ausgewählten Bulkzellpopulation, da sie eine Mischung aus sowohl WT als auch mutanten Allelen enthält (Abbildung 2D ). </li><li> Vorbereitung der folgenden Reaktionsmischung: <table><tbody><tr><td> Zelllysat </td><td> 0,5 &amp; mgr; l </td></tr><tr><td> 10x KOD Puffer </td><td> 1,25 &amp; mgr; l </td></tr><tr><td> 25mM MgSO4 </td><td> 0,75 &amp; mgr; l </td></tr><tr><td> 2 mM dNTPs </td><td> 1,25 &amp; mgr; l </td></tr><tr><td> 10 μM Vorwärtsprimer </td><td> 0,375 &amp; mgr; l </td></tr><tr><td> 10 μM Rückwärtsprimer </td><td> 0,375 &amp; mgr; l </td></tr><tr><td> KOD-Polymerase </td><td> 0,25 &amp; mgr; l </td></tr><tr><td> Wasser </td><td> 7,75 &amp; mgr; l </td></tr></tbody></table></li><li> Verwenden Sie die folgenden Thermocycler-Bedingungen: 95 ° C für 2 min, (95 ° C für 20 s, Primer Tm für 10 s, 70 ° C für 20 s / kb) Wiederholen für 25 Zyklen. </li><li> Das PCR-Produkt durch Agarose-Gelelektrophorese visualisieren. </li></ol></li><li> Wiederholen Sie die Kolonie-PCR-Tests für jede Seite der vorhergesagten Integration. Auswählen und Erweitern von Kandidaten, die Vorhandensein von Integration und kein endogenes Sequenzprodukt für die gelöschte Region zeigen. </li><li> Validieren Sie positive Kandidaten durch Western-Blot und / oder RT-qPCR. </li></ol></li></ol> 8. Überprüfen Sie die genomische Mutation durch Sequenzierung <ol><li> Isolieren Sie genomische DNA aus mutanten Zelllinien durch Phenol-Chloroform-Extraktion 31 . </li><li> PCR amplifizieren die sgRNA-Zielregion unter Verwendung von Primern mit 5&#39;-Überhängen, die BsaI-Restriktionsstellen zu jedem Ende hinzufügen. HINWEIS: Für Klone, die mit HDR bearbeitet wurden, wo beide Allele identisch sein können, kann das PCR-Produkt direkt sequenziert werden. </li><li> Klone die verstärkte Region in pUC19-BsaI durch Golden Gate Klonen. </li><li> Umwandlung der Reaktionsmischung in einen kompetenten E. coli- Stamm. </li><li> Miniprep-Plasmid-DNA aus 6-10 einzelnen Kolonien und Sequenz der klonierten Region durch Sanger-Sequenzierung. </li></ol>

<ol>
	<li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+with+zinc-finger+nucleases.">Genome engineering with zinc-finger nucleases.</a> Genetics. 188 (4), 773-782 (2011).</li><li>Kim, Y. G., Cha, J., Chandrasegaran, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybrid+restriction+enzymes:+zinc+finger+fusions+to+Fok+I+cleavage+domain.">Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain.</a> Proc Natl Acad Sci U S A. 93 (3), 1156-1160 (1996).</li><li>Bibikova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stimulation+of+homologous+recombination+through+targeted+cleavage+by+chimeric+nucleases.">Stimulation of homologous recombination through targeted cleavage by chimeric nucleases.</a> Mol Cell Biol. 21 (1), 289-297 (2001).</li><li>Bibikova, M., Golic, M., Golic, K. G., Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+chromosomal+cleavage+and+mutagenesis+in+Drosophila+using+zinc-finger+nucleases.">Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases.</a> Genetics. 161 (3), 1169-1175 (2002).</li><li>Porteus, M. H., Cathomen, T., Weitzman, M. D., Baltimore, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+gene+targeting+mediated+by+adeno-associated+virus+and+DNA+double-strand+breaks.">Efficient gene targeting mediated by adeno-associated virus and DNA double-strand breaks.</a> Mol Cell Biol. 23 (10), 3558-3565 (2003).</li><li>Bogdanove, A. J., Voytas, D. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+effectors:+customizable+proteins+for+DNA+targeting.">TAL effectors: customizable proteins for DNA targeting.</a> Science. 333 (6051), 1843-1846 (2011).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat Biotechnol. 29 (2), 143-148 (2011).</li><li>Moscou, M. J., Bogdanove, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+cipher+governs+DNA+recognition+by+TAL+effectors.">A simple cipher governs DNA recognition by TAL effectors.</a> Science. 326 (5959), 1501 (2009).</li><li>Christian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+DNA+double-strand+breaks+with+TAL+effector+nucleases.">Targeting DNA double-strand breaks with TAL effector nucleases.</a> Genetics. 186 (2), 757-761 (2010).</li><li>Jiang, W., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas:+New+Tools+for+Genetic+Manipulations+from+Bacterial+Immunity+Systems.">CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems.</a> Annu Rev Microbiol. 69, 209-228 (2015).</li><li>Barrangou, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+provides+acquired+resistance+against+viruses+in+prokaryotes.">CRISPR provides acquired resistance against viruses in prokaryotes.</a> Science. 315 (5819), 1709-1712 (2007).</li><li>Karginov, F. V., Hannon, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR+system:+small+RNA-guided+defense+in+bacteria+and+archaea.">The CRISPR system: small RNA-guided defense in bacteria and archaea.</a> Mol Cell. 37 (1), 7-19 (2010).</li><li>Wiedenheft, B., Sternberg, S. H., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+genetic+silencing+systems+in+bacteria+and+archaea.">RNA-guided genetic silencing systems in bacteria and archaea.</a> Nature. 482 (7385), 331-338 (2012).</li><li>Mojica, F. J., Diez-Villasenor, C., Garcia-Martinez, J., Soria, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intervening+sequences+of+regularly+spaced+prokaryotic+repeats+derive+from+foreign+genetic+elements.">Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements.</a> J Mol Evol. 60 (2), 174-182 (2005).</li><li>Pourcel, C., Salvignol, G., Vergnaud, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+elements+in+Yersinia+pestis+acquire+new+repeats+by+preferential+uptake+of+bacteriophage+DNA,+and+provide+additional+tools+for+evolutionary+studies.">CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies.</a> Microbiology. 151 (Pt 3), 653-663 (2005).</li><li>Brouns, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+CRISPR+RNAs+guide+antiviral+defense+in+prokaryotes.">Small CRISPR RNAs guide antiviral defense in prokaryotes.</a> Science. 321 (5891), 960-964 (2008).</li><li>Deltcheva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+RNA+maturation+by+trans-encoded+small+RNA+and+host+factor+RNase+III.">CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III.</a> Nature. 471 (7340), 602-607 (2011).</li><li>Garneau, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas+bacterial+immune+system+cleaves+bacteriophage+and+plasmid+DNA.">The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA.</a> Nature. 468 (7320), 67-71 (2010).</li><li>Marraffini, L. A., Sontheimer, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+interference+limits+horizontal+gene+transfer+in+staphylococci+by+targeting+DNA.">CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA.</a> Science. 322 (5909), 1843-1845 (2008).</li><li>Gasiunas, G., Barrangou, R., Horvath, P., Siksnys, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas9-crRNA+ribonucleoprotein+complex+mediates+specific+DNA+cleavage+for+adaptive+immunity+in+bacteria.">Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria.</a> Proc Natl Acad Sci U S A. 109 (39), E2579-E2586 (2012).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Davis, A. J., Chen, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+double+strand+break+repair+via+non-homologous+end-joining.">DNA double strand break repair via non-homologous end-joining.</a> Transl Cancer Res. 2 (3), 130-143 (2013).</li><li>Guirouilh-Barbat, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+the+KU80+pathway+on+NHEJ-induced+genome+rearrangements+in+mammalian+cells.">Impact of the KU80 pathway on NHEJ-induced genome rearrangements in mammalian cells.</a> Mol Cell. 14 (5), 611-623 (2004).</li><li>Moore, J. K., Haber, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+and+genetic+requirements+of+two+pathways+of+nonhomologous+end-joining+repair+of+double-strand+breaks+in+Saccharomyces+cerevisiae.">Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae.</a> Mol Cell Biol. 16 (5), 2164-2173 (1996).</li><li>Liang, F., Han, M., Romanienko, P. J., Jasin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homology-directed+repair+is+a+major+double-strand+break+repair+pathway+in+mammalian+cells.">Homology-directed repair is a major double-strand break repair pathway in mammalian cells.</a> Proc Natl Acad Sci U S A. 95 (9), 5172-5177 (1998).</li><li>Gratz, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+specific+and+efficient+CRISPR/Cas9-catalyzed+homology-directed+repair+in+Drosophila.">Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila.</a> Genetics. 196 (4), 961-971 (2014).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method+with+high+throughput+capability.">A one pot, one step, precision cloning method with high throughput capability.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nat Protoc. 8 (11), 2281-2308 (2013).</li><li>Luo, Y., Lin, L., Bolund, L., Sorensen, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+construction+of+rAAV-based+gene+targeting+vectors+by+Golden+Gate+cloning.">Efficient construction of rAAV-based gene targeting vectors by Golden Gate cloning.</a> Biotechniques. 56 (5), 263-268 (2014).</li><li>Green, M. R., Sambrook, J., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: a laboratory manual. , (2012).</li><li>Lin, S., Staahl, B. T., Alla, R. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+homology-directed+human+genome+engineering+by+controlled+timing+of+CRISPR/Cas9+delivery.">Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery.</a> Elife. 3, e04766 (2014).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Res. 24 (6), 1012-1019 (2014).</li></ol>

Die Autoren erklären, dass sie keine konkurrierenden finanziellen Interessen haben.

Das CRISPR / Cas9-System ermöglicht eine effiziente Erzeugung stabiler genomischer Modifikationen, die eine konsistentere Alternative zu anderen transienten Manipulationsverfahren bieten. Hier haben wir zwei Methoden zur schnellen Identifizierung von CRISPR / Cas9-Gen-Knockouts in Säugetierzelllinien vorgestellt. Beide Methoden erfordern wenig zelluläres Material, so dass Tests in frühen Stadien der Klonalkultur durchgeführt werden können, spart Zeit und Reagenzien. Um die Effizienz beider Methoden zu erhöhen, em...

<html> Stabile genetische Veränderungen bieten einen Vorteil gegenüber transienten Methoden der zellulären Störung, die in ihrer Effizienz und Dauer variabel sein können. Die genomische Bearbeitung ist in den letzten Jahren aufgrund der Entwicklung von zielspezifischen Nukleasen, wie z. B. Zinkfinger-Nukleasen 1 , 2 , 3 , 4 , 5 , Transkriptionsaktivator-ähnliche Effektor-Nukleasen (TALENs) 6 , 7 , 8 , 9 immer häufiger geworden Und RNA-geführte Nukleasen, die aus dem geclusterten, regelmäßig verteilten kurzen palindromischen Wiederholungssystem (CRISPR) 10 gewonnen wurden . Die CRISPR / Cas9-Bearbeitungsmaschinen werden von einem Immunsystem angepasst, das Bakterien und Archaea zur Verteidigung gegen Virusinfektionen verwendenAss = &quot;xref&quot;&gt; 11 , 12 , 13 . In diesem Prozess werden kurze, 20-30 nt-Fragmente der eindringenden Virussequenz in einen genomischen Locus als &quot;Spacer&quot; eingebaut, die von den Wiederholungseinheiten 14 , 15 flankiert sind. Nachfolgende Transkriptions- und RNA-Verarbeitung erzeugt kleine CRISPR-assoziierte RNAs 16 (crRNAs), die zusammen mit einer transaktivierenden crRNA 17 (tracrRNA) mit der Effektor-Cas9-Endonuklease zusammensetzen. Die crRNAs bieten somit eine Spezifität für das Cas9-Targeting, die den Komplex leitet, um komplementäre virale DNA-Sequenzen zu spalten und weitere Infektionen zu verhindern 18 , 19 . Jede &quot;Protospacer&quot; -Sequenz in der Ziel-DNA kann als Quelle der crRNA dienen, solange sie direkt 5 &#39;zu einem kurzen Protospacer benachbarten Motiv (PAM), NGG im Fall von S. pyogenes Cas9 ist <sUp class = &quot;xref&quot;&gt; 20 Die Abwesenheit der PAM-Sequenz nahe dem Spacer im CRISPR-Locus des Hosts unterscheidet zwischen Selbst und Nicht-Selbst und verhindert das Targeting des Hosts. Wegen seiner Universalität und Flexibilität ist dieses biologische System mächtig für die genomische Bearbeitung angepasst worden, so dass nahezu jede PAM-benachbarte DNA-Stelle gezielt werden kann. In dieser Version fusionierte eine weitere Modifikation die crRNA und tracrRNA zu einer einzigen RNA (sgRNA) -Komponente, die in das Cas9-Protein 21 geladen wurde. Bei der Expression von Cas9 und einer sgRNA in eukaryotischen Zellen spaltet das Cas9-Protein beide DNA-Stränge am Zielort. In Abwesenheit einer geeigneten Region der homologen Sequenz fixiert die Zelle diesen Bruch über eine nicht homologe Endverbindung (NHEJ) 22 , 23 , 24 , die typischerweise kleine Deletionen oder selten Insertionen einführt. Bei der Ausrichtung auf eine offeneLeserahmen, führt die Reparatur wahrscheinlich zu einer translationalen Frameshift, die ein nicht-funktionelles Proteinprodukt produziert. Im Gegensatz dazu kann die Zelle, wenn sie mit einer exogenen Schablone mit großen Regionen der Homologie versehen ist, die doppelsträngige Pause durch homologisch gerichtete Reparatur 25 , 26 fixieren. Dieser Weg ermöglicht größere präzise Deletionen, Ersetzungen oder Insertionen im Genom, gepaart mit der Einführung von ausfahrbaren Selektionsmarkern 27 . Hier stellen wir Protokolle zur Erzeugung von Knockout-Zelllinien durch eine dieser beiden CRISPR / Cas9-Verfahren vor (Abbildung 1A ). Der NHEJ-Ansatz nutzt eine einzelne sgRNA-Cut-Site und selektionsunabhängiges Screening und erfordert daher eine geringe Vorwärtspräparation. Bei der Verwendung dieser Methode müssen RNAs, die komplementär zu Exons in der Nähe des 5&#39;-Endes des Transkripts sind, die am ehesten ein Knockout produzieren, entworfen werden. Seit dem modifikatIonen zum Genom in diesem Fall sind klein, das Screening auf Knockout-Klone basiert auf Punkt-Blots, wo das Protein-Produkt in einer Hochdurchsatz-Weise beurteilt wird. Wir verwenden die Generation von ELAV-ähnlichen 1 Protein (ELAVL1) Knockout Linien als Beispiel. Der zweite Ansatz beruht auf homologisch gerichteter Reparatur (HDR) und verwendet zwei sgRNA-Cut-Stellen, die das Gen oder die Region von Interesse überspannen, was eine Deletionen von zehn kb ermöglicht. Ein Plasmid mit zwei Regionen der Homologie, die die Spaltstellen flankieren, liefert eine Ersatzschablone (Abbildung 1B ), die einen wählbaren Resistenzmarker einführt, der die Effizienz der Knockout-Erzeugung erhöht. Diese Methode kann auch angepasst werden, um Genmodifikationen mit richtig entworfenen Homologiearmen einzuführen. In diesem Fall ermöglicht die Integration eines neuen DNA-Fragments ein PCR-basiertes Screening (Abbildung 1C ). Hier verwenden wir die Generierung von Pumilio RNA Bindung Familienmitglied 2 (PUM2) Knockout Linien als Beispiel.

<table><tbody><tr><td>Competent &lt;em&gt;E. coli&lt;/em&gt; cells</td><td></td><td></td><td></td></tr><tr><td>plasmid prep kit</td><td></td><td></td><td></td></tr><tr><td>pSpCas9(BB) plasmid</td><td>Addgene</td><td>42230</td><td>Ran &lt;em&gt;et al.&lt;/em&gt; 2013, cloning sgRNAs</td></tr><tr><td>BbsI enzyme</td><td>ThermoFisher</td><td>FD1014</td><td>Ran &lt;em&gt;et al.&lt;/em&gt; 2013, cloning sgRNAs</td></tr><tr><td>T7 DNA ligase</td><td>NEB</td><td>M0318L</td><td>Ran &lt;em&gt;et al.&lt;/em&gt; 2013, cloning sgRNAs</td></tr><tr><td>Tango Buffer</td><td>ThermoFisher</td><td>BY5</td><td>Ran &lt;em&gt;et al.&lt;/em&gt; 2013, cloning sgRNAs</td></tr><tr><td>PlasmidSafe exonuclease</td><td>Epicentre</td><td>E3105K</td><td>Ran &lt;em&gt;et al.&lt;/em&gt; 2013, cloning sgRNAs</td></tr><tr><td>Q5 hot start high fidelity polymerase</td><td>NEB</td><td>M0494A</td><td>HA amplification</td></tr><tr><td>pUC19-BsaI</td><td></td><td></td><td>Modified pUC19 plasmid, mutated existing BsaI site and inserted two outward facing BsaI sites after BamHI/EcoRI digestion</td></tr><tr><td>pGolden-Neo</td><td>Addgene</td><td>51422</td><td>Resistance cassette</td></tr><tr><td>pGolden-Hygro</td><td>Addgene</td><td>51423</td><td>Resistance cassette</td></tr><tr><td>BsaI enzyme</td><td>NEB</td><td>R3535S</td><td>Homology arm contruction</td></tr><tr><td>T7 DNA ligase</td><td>NEB</td><td>M0318L</td><td></td></tr><tr><td>PlasmidSafe exonuclease</td><td>Epicentre</td><td>E3105K</td><td></td></tr><tr><td>Toothpicks</td><td></td><td></td><td>bacterial PCR</td></tr><tr><td>Taq polymerase</td><td></td><td></td><td>bacterial colony PCR</td></tr><tr><td>HEK293 human cells</td><td></td><td></td><td></td></tr><tr><td>DMEM</td><td>Corning</td><td>10-013-CV</td><td></td></tr><tr><td>FBS</td><td>Corning</td><td>MT35010CV</td><td></td></tr><tr><td>Penicillin-Strep (opt.)</td><td>Gibco</td><td>15140-122</td><td></td></tr><tr><td>6 well plates</td><td>BioLite</td><td>12556004</td><td></td></tr><tr><td>TransIT-LTI Transfection Reagent</td><td>Mirus</td><td>MIR2300</td><td>for lipofection only</td></tr><tr><td>Opti-MEM</td><td>ThermoFisher</td><td>31985062</td><td>for lipofection only</td></tr><tr><td>G418 (Neomycin)</td><td>Sigma Aldrich</td><td>A1720-5G</td><td></td></tr><tr><td>Hygromycin</td><td>Sigma Aldrich</td><td>H3274-250MG</td><td></td></tr><tr><td>96 well plates</td><td>ThermoFisher</td><td>12556008</td><td></td></tr><tr><td>Passive Lysis Buffer, 5x</td><td>Promega</td><td></td><td></td></tr><tr><td>1x SDS loading buffer</td><td></td><td></td><td>recipe decribed in protocol</td></tr><tr><td>Nitrocellulose Membrane</td><td>Bio-Rad</td><td>162-0115</td><td></td></tr><tr><td>TBST</td><td></td><td></td><td>recipe decribed in protocol</td></tr><tr><td>Dehydrated milk</td><td></td><td></td><td></td></tr><tr><td>SuperSignal West Dura Extended Duration Substrate</td><td>ThermoFisher</td><td>34075</td><td>for HRP-conjugated secondary antibodies</td></tr><tr><td>Extracta DNA prep for PCR</td><td>Quantabio</td><td>95091-025</td><td></td></tr><tr><td>KOD polymerase</td><td>Novagen</td><td>71316</td><td></td></tr></tbody></table>

selection-dependent and independent generation of crispr/cas9-mediated gene knockouts in mammalian cells

Das CRISPR / Cas9 Genom Engineering System hat die Biologie revolutioniert, indem es genaue Genombearbeitung mit wenig Aufwand ermöglicht. Geleitet von einer einzigen Guide-RNA (sgRNA), die Spezifität verleiht, spaltet das Cas9-Protein beide DNA-Stränge am Zielort. Der DNA-Bruch kann entweder nicht-homologe Endverbindungen (NHEJ) oder Homologie gerichtete Reparatur (HDR) auslösen. NHEJ kann kleine Deletionen oder Insertionen einführen, die zu Frame-Shift-Mutationen führen, während HDR größere und präzisere Störungen ermöglicht. Hier präsentieren wir Protokolle zur Erzeugung von Knockout-Zelllinien durch Kopplung von etablierten CRISPR / Cas9-Methoden mit zwei Optionen für die nachgeschaltete Auswahl / Screening. Der NHEJ-Ansatz nutzt eine einzelne sgRNA-Cut-Stelle und selektionsunabhängiges Screening, bei der die Proteinproduktion durch Dot-Immunoblot in einer Hochdurchsatz-Weise beurteilt wird. Der HDR-Ansatz verwendet zwei sgRNA-Cut-Stellen, die das Gen von Interesse überspannen. Zusammen mit einer bereitgestellten HDR-Vorlage kann diese Methode eine Löschung erreichenVon zehn kb, unterstützt durch die eingefügte wählbare Widerstandsmarkierung. Die entsprechenden Anwendungen und Vorteile jeder Methode werden diskutiert.

Für die Erzeugung von ELAVL1-Knockout-Linien war ein robuster Antikörper verfügbar, so dass die Bearbeitung mit einzelnen sgRNAs (Abbildung 1A , links) durchgeführt wurde, gefolgt von Punkt-Immunoblot. Drei sgRNAs wurden unabhängig transfiziert, um die Effizienz zu vergleichen und die Ziel-Effekte in den resultierenden Klonen auszuschließen. Nach dem Sammeln und Blotting von Zelllysaten aus klonalen Populationen auf zwei Nitrozellulosemembranen wurden ...

Watch this Scientific Journal Video about Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells at JoVE.com

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

Jüngste Fortschritte in der Fähigkeit, somatische Zelllinien genetisch zu manipulieren, haben großes Potenzial für grundlegende und angewandte Forschung. Hier präsentieren wir zwei Ansätze für CRISPR / Cas9-produzierte Knockout-Produktion und Screening in Säugetierzelllinien, mit und ohne Verwendung von selektierbaren Markern.

Selektionsabhängige und unabhängige Erzeugung von CRISPR / Cas9-vermittelten Gen-Knockouts in Säugetierzellen

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

selection-dependent-independent-generation-crisprcas9-mediated-gene

Research

JoVE Journal

Genetics

12.4K Aufrufe.  University of California, Riverside.  Jüngste Fortschritte in der Fähigkeit, somatische Zelllinien genetisch zu manipulieren, haben großes Potenzial für grundlegende und angewandte Forschung. Hier präsentieren wir zwei Ansätze für CRISPR / Cas9-produzierte Knockout-Produktion und Screening in Säugetierzelllinien, mit und ohne Verwendung von selektierbaren Markern. 

Serie: Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

Mit Hilfe eines Fluoreszenz-PCR-Kapillar-Gel-Elektrophorese-Technik CRISPR zum Genotyp / Cas9 vermittelte Knock-out Mutanten in einem Hochdurchsatz-Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

Forschung

Genetik

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development of a customizable platform to rapidly generate gene modifications in a wide variety of organisms, including zebrafish. CRISPR-based genome editing uses a single guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to a genomic DNA (gDNA) target of interest, where the Cas endonuclease generates a double-strand break (DSB). Repair of DSBs by error-prone mechanisms lead to insertions and/or deletions (indels). This can cause frameshift mutations that often introduce a premature stop codon within the coding sequence, thus creating a protein-null allele. CRISPR-based genome engineering requires only a few molecular components and is easily introduced into zebrafish embryos by microinjection. This protocol describes the methods used to generate CRISPR reagents for zebrafish microinjection and to identify fish exhibiting germline transmission of CRISPR-modified genes. These methods include in vitro transcription of sgRNAs, microinjection of CRISPR reagents, identification of indels induced at the target site using a PCR-based method called a heteroduplex mobility assay (HMA), and characterization of the indels using both a low throughput and a powerful next-generation sequencing (NGS)-based approach that can analyze multiple PCR products collected from heterozygous fish. This protocol is streamlined to minimize both the number of fish required and the types of equipment needed to perform the analyses. Furthermore, this protocol is designed to be amenable for use by laboratory personal of all levels of experience including undergraduates, enabling this powerful tool to be economically employed by any research group interested in performing CRISPR-based genomic modification in zebrafish.

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Targeted genome editing in the model system Danio rerio (zebrafish) has been greatly facilitated by the emergence of CRISPR-based approaches. Herein, we describe a streamlined, robust protocol for generation and identification of CRISPR-derived nonsense alleles that incorporates the heteroduplex mobility assay and identification of mutations using next-generation sequencing.

Effiziente Produktion und Kennzeichnung der CRISPR/Cas9 generiert gen Knockouts im Modellsystem Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Hocheffiziente gen Störung der murinen und menschlichen hämatopoetischen Vorläuferzellen von CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

Genom-Bearbeitung in Säugetieren Zelllinien mit CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Pooled CRISPR-Based Genetic Screens in Mammalian Cells

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian cells, this technology represents a novel means to perform genome-wide genetic screens for functional genomics studies. Libraries of guide RNAs (sgRNA) targeting all open reading frames permit the facile generation of thousands of genetic perturbations in a single pool of cells that can be screened for specific phenotypes to implicate gene function and cellular processes in an unbiased and systematic way. CRISPR-Cas screens provide researchers with a simple, efficient, and inexpensive method to uncover the genetic blueprints for cellular phenotypes. Furthermore, differential analysis of screens performed in various cell lines and from different cancer types can identify genes that are contextually essential in tumor cells, revealing potential targets for specific anticancer therapies. Performing genome-wide screens in human cells can be daunting, as this involves the handling of tens of millions of cells and requires analysis of large sets of data. The details of these screens, such as cell line characterization, CRISPR library considerations, and understanding the limitations and capabilities of CRISPR technology during analysis, are often overlooked. Provided here is a detailed protocol for the successful performance of pooled genome-wide CRISPR-Cas9 based screens.

CRISPR-Cas9 technology provides an efficient method to precisely edit the mammalian genome in any cell type and represents a novel means to perform genome-wide genetic screens. A detailed protocol discussing the steps required for the successful performance of pooled genome-wide CRISPR-Cas9 screens is provided here.

Gepoolte CRISPR-basierte genetische Screens in Säugetierzellen

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian ...

A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer

CRISPR/Cas9 technology has greatly improved the feasibility and speed of loss-of-function studies that are essential in understanding gene function. In higher eukaryotes, paralogous genes can mask a potential phenotype by compensating the loss of a gene, thus limiting the information that can be obtained from genetic studies relying on single gene knockouts. We have developed a novel, rapid cloning method for guide RNA (gRNA) concatemers in order to create multi-gene knockouts following a single round of transfection in mouse small intestinal organoids. Our strategy allows for the concatemerization of up to four individual gRNAs into a single vector by performing a single Golden Gate shuffling reaction with annealed gRNA oligos and a pre-designed retroviral vector. This allows either the simultaneous knockout of up to four different genes, or increased knockout efficiency following the targeting of one gene by multiple gRNAs. In this protocol, we show in detail how to efficiently clone multiple gRNAs into the retroviral CRISPR-concatemer vector and how to achieve highly efficient electroporation in intestinal organoids. As an example, we show that simultaneous knockout of two pairs of genes encoding negative regulators of the Wnt signaling pathway (Axin1/2 and Rnf43/Znrf3) renders intestinal organoids resistant to the withdrawal of key growth factors.

This protocol describes the steps for cloning multiple single guide RNAs into one guide RNA concatemer vector, which is of particular use in creating multi-gene knockouts using CRISPR/Cas9 technology. The generation of double knockouts in intestinal organoids is shown as a possible application of this method.

Ein Protokoll für mehrfache Gen-Knockout in Maus-Dünndarm-Organoiden mit einem CRISPR-Concatemer

CRISPR/Cas9 technology has greatly improved the feasibility and speed of loss-of-function studies that are essential in understanding gene function. In ...

Biotechnik

Construction of CRISPR Plasmids and Detection of Knockout Efficiency in Mammalian Cells through a Dual Luciferase Reporter System

Although highly efficient, modification of a genomic site by the CRISPR enzyme requires the generation of a sgRNA unique to the target site(s) beforehand. This work describes the key steps leading to the construction of efficient sgRNA vectors using a strategy that allows the efficient detection of the positive colonies by PCR prior to DNA sequencing. Since efficient genome editing using the CRISPR system requires a highly efficient sgRNA, a preselection of candidate sgRNA targets is necessary to save time and effort. A dual luciferase reporter system has been developed to evaluate knockout efficiency by examining double-strand break repair via single strand annealing. Here, we use this reporter system to pick up the preferred xCas9/sgRNA target from candidate sgRNA vectors for specific gene editing. The protocol outlined will provide a preferred sgRNA/CRISPR enzyme vector in 10 days (starting with appropriately designed oligonucleotides).

Here, we present a protocol describing a streamlined method for the efficient generation of plasmids expressing both the CRISPR enzyme and associated single guide RNA (sgRNAs). Co-transfection of mammalian cells with this sgRNA/CRISPR vector and a dual luciferase reporter vector that examines double-strand break repair allows evaluation of knockout efficiency.

Bau von CRISPR Plasmiden und Nachweis von Knockout-Effizienz in Säugetierzellen durch ein Dual Luciferase Reporter System

Although highly efficient, modification of a genomic site by the CRISPR enzyme requires the generation of a sgRNA unique to the target site(s) beforehand. ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

Generierung von Genomic Löschungen in Säugerzelllinien über CRISPR / Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

Biologie

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

Elektroporationsbasierter CRISPR-Cas9-vermittelter Gen-Knockout in THP-1-Zellen und Einzelzell-Klonisolierung

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

Immunologie und Infektion

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

<meta charset="utf8"></head><body>CRISPR-Cas9-vermittelte Gendeletion in humanen pluripotenten Stammzellen, die unter feederfreien Bedingungen kultiviert wurden

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

CRISPR-Cas9-vermittelte Gendeletion in humanen pluripotenten Stammzellen, die unter feederfreien Bedingungen kultiviert wurden

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...