JoVE Logo

Sign In

A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Results
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

Abstract

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

Introduction

THP-1 is a human monocyte-derived cell line isolated from a patient suffering from acute leukemia (AML), which displays phenotypic features closely resembling those of primary monocytes1. As compared to primary monocyte-derived macrophages, which do not divide and display both limited lifespan and inter-/intra-donor variability in phenotype, THP-1 cells can be cultured virtually forever and have a more homogeneous behavior that favors results reproducibility2,3,4,5,6. Notably, THP-1 cells can be differentiated towards a macrophage-like phenotype with phorbol-12-myristate 13-acetate (PMA), making them a widely used in vitro model to investigate the responses of monocytes/macrophages to inflammatory signals7,8,9,10,11,12,13 or infection by clinically relevant human pathogens, including HIV14,15,16. The possibility to genetically engineer THP-1 cells is of interest across many biology-related research areas.

Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR associated protein 9 (CRISPR-Cas9) is a prokaryotic adaptive immune system relaying on RNA-guided nuclease to degrade invading viral genomes, which has been reprogrammed as a genetic engineering tool17. The process of genome editing proceeds in three steps: recognition, cleavage, and repair. A single-guide RNA (sgRNA) recruits the Cas9 nuclease to a specific genomic locus through base pairing with its 20-bp guide sequence. The presence of a Protospacer Adjacent Motif (PAM) sequence directly 3' of the 20-bp genomic target sequence triggers the Cas9-mediated unwinding and cleavage on both DNA strands between positions 17 and 18 (3-bp 5' of the PAM). The resulting double-strand break (DSB) is processed by two major repair pathways. In the absence of a repair template bearing homology with the damaged locus, the error-prone Non-Homologous End Joining (NHEJ) pathway will introduce random nucleotide insertions and/or deletions (indels), potentially leading to frameshift mutations and/or the introduction of premature termination codons (PTC). In turn, PTC-containing mRNAs are targeted by degradation by the nonsense-mediated mRNA decay (NMD) pathway, ultimately disrupting protein expression/function18,19,20. Alternatively, the template-dependent Homology-Directed Repair (HDR) pathway can operate and faithfully repair the DSB. This mechanism has been harnessed to achieve precise gene editing, including knock-ins and base substitutions. It is worth noting that the cell cycle status is an important factor influencing the choice of DSB repair pathway. Indeed, NHEJ is active at all stages of the cell cycle, while HDR is mainly restricted to the S/G2 phases21.

THP-1 cells grow in suspension and are notoriously difficult to transfect with plasmid DNA, a procedure that possibly also alters their viability and/or differentiation capacity22,23. Transduction with HIV-1-based lentiviral vectors encoding both Cas9 and the sgRNA is often employed to knockout (KO) a gene of interest24. Integration of the Cas9/sgRNA cassette into the cellular genome ensures prolonged expression and efficient KO, but is also a persistent source of off-target effects25. Alternatively, the pre-assembled Cas9:sgRNA ribonucleoproteins (RNPs) are delivered by electroporation, a method involving the temporary formation of pores in both the plasma and nuclear membranes upon application of electric impulses. Preserving cell viability is an important challenge when undertaking this approach.

Here, a THP-1 cell line stably expressing GFP (THP-1_GFP) was produced to serve as a tool to establish a protocol to achieve efficient CRISPR-Cas9-based editing. After designing a strategy to inactivate the EGFP gene using three sgRNAs simultaneously (multi-guide approach), KO efficiency among several electroporation conditions was determined using GFP expression as a readout. Cell proliferation was monitored in parallel. Gene editing was confirmed by both a T7 endonuclease I (T7EI) assay and Sanger sequencing, followed by analysis with the Inference of CRISPR Edits (ICE) algorithm26. Parameters that yielded up to 95% GFP expression decrease, with THP-1 cells recovering normal growth rates after electroporation, were successfully employed to inactivate an endogenous gene (SAMHD1) and produce single-cell THP-1 clones.

Access restricted. Please log in or start a trial to view this content.

Protocol

The details of the reagents and the equipment used in this study are listed in the Table of Materials.

1. Guide design with CRISPOR (Figure 1.1)

NOTE: SnapGene Viewer software may be used in steps 4, 7, and 10 to annotate the editing target site and the location of the PCR primer hybridization within the gene of interest.

  1. Go to the Ensembl website (www.ensembl.org). In the Search box, select a species and enter the name of the gene of interest. Click on Go. Select the result that corresponds to the gene (not a transcript).
  2. Click on Show transcript table and then select the Transcript ID that corresponds to the gold labeled Protein coding in the Biotype column. Once on the transcript page, click on Exons in the left menu.
  3. Scroll down and click on Download sequence. Make sure the File format is FASTA. In Settings - Included Sequences, deselect everything except Genomic sequence.
    Enter the number "500" in Flanking sequence at either end of transcript box. Click on Preview, select the whole sequence (just the nucleotides without the header), and copy it (Ctrl+C).
  4. Open SnapGene Viewer and click on New > DNA file. Paste the sequence (Ctrl+V) into the Create a sequence box. Uncheck Detect common features and select Linear in Topology.
    Rename the file and click on Create. In the left menu, deselect Show enzymes (first icon). At the bottom of the window, select the Sequence tab.
    ​NOTE: This step allows retrieval of the complete gene sequence, including exons, introns, and 500 bp flanking sequences (optional). This latter information is useful for designing PCR primers for the amplification of a target site located within the first exon.
  5. Back on the Ensembl website, scroll up on the file preview and click Back. Now, change the File format to RTF. In Settings - Included Sequences, deselect everything except Exons. In Show variants, select No. Click on Download at the top of the page.
  6. Open the downloaded file (with Word), which contains the sequence of exons and shows the coding sequence in blue, starting with the initial ATG. Choose the exon to be targeted by the CRISPR-Cas9-directed editing (see below for recommendations), select it, and copy it (Ctrl+C).
    1. The targeted exon is either an early exon or an exon encoding a functionally important domain of the protein. It is worth noting that the establishment of a PTC in a late exon close to the 3' UTR will likely fail to elicit NMD, leading to the expression of a C-terminally truncated protein. Conversely, the introduction of a PTC in an early exon proximal to the native initiation site is associated with a risk of illegitimate translation (ITL, aka alternative translation initiation (ATI)), yielding the unexpected expression of an N-terminally truncated protein that begins at an in-frame translation initiation sites (TIS) downstream of the first ATG codon. To mitigate this latter risk, it is advised to assess the occurrence of alternative TIS using ATGpr27 (atgpr.dbcls.jp) and/or NetStart 1.028 (services.healthtech.dtu.dk/services/NetStart-1.0/).
    2. Ensure that the target exon contains a coding sequence. However, it might prove useful to choose a sgRNA annealing with the 5'UTR region upstream of the initial ATG to include it in the deleted fragment.
    3. Ideally, the targeted exon should be common to all the protein-coding transcript variants of the gene. Check if that is the case on the NCBI's Genome Data Viewer (www.ncbi.nlm.nih.gov/gdv/) by searching the gene of interest. 
      Clicking on the gene name (in green) on the display window will show the transcript variants (in purple). Exons are represented by a rectangle.
  7. In SnapGene Viewer, press Ctrl+F, Ctrl+V, and then Enter to search for the sequence of the exon. Press Ctrl+T to add a new feature, name it, change the type to "exon" and click on OK.
  8. Go to the CRISPOR website (http://crispor.gi.ucsc.edu/) and paste the exon sequence in Step 1. First, select a reference genome in Step 2 and then the type of PAM to target in Step 3, typically 20bp-NGG for SpCas9. Click on SUBMIT.
  9. Select two sgRNAs so that they are separated by up to 150 bp, then select a third sgRNA in between. Here are some guidelines for sgRNA selection:
    1. The MIT specificity score is related to off-target effects. A higher score indicates fewer potential off-targets. The right column displays three predicted off-target sites ranked from the most to the least likely, along with their locations (in an exon, an intron, or an intergenic region). The full list of predicted off-target sites can be accessed by clicking show all. If possible, select sgRNAs with an MIT score >80, prioritizing those without off-targets for 0, 1, or 2 mismatches. Additionally, sgRNAs with off-targets in an exon, which have the greatest potential to affect phenotype, should be avoided.
    2. For predicted efficacy, refer to the Doench '16 score. Note that a high Doench '16 score simply indicates that the sgRNA is more likely to be effective. Actual efficacy must be determined experimentally. For this reason, it is always useful to select several sgRNAs, even if they are not intended to be used together.
    3. A GC content that is either too high or too low, as well as certain motifs, can be detrimental to sgRNA efficiency and should be avoided. These parameters are highlighted by CRISPOR.
  10. Repeat step 1.7 to add the sgRNA sequence and the associated PAM sequence to the gene sequence in SnapGene Viewer. At the same time, paste the sgRNA sequence (without the PAM) into a text or Excel file to retain the 5'-3' orientation required when ordering the oligonucleotide.
  11. For PCR-based amplification of the target site, design a couple of primers surrounding it. The amplicon size should be between 800 and 1000 bp. PrimerQuest was used to design the primers for this protocol (https://eu.idtdna.com/pages/tools/primerquest). Alternatively, CRISPOR provides a list of primers to amplify the targeted genomic region as well as the off-target sites. After displaying the full list of potential off-target sites (step 1.9.1), click on Off-target primers at the bottom right corner.

2. Reagent and cell preparation for electroporation (Figure 1.2)

  1. Prepare a 24-well culture plate to recover cells after electroporation by filling the wells with 500 µL of RPMI 1640 medium supplemented with 20% heat-inactivated (56 °C, 30 min), filtered (0.20 µm) fetal bovine serum (FBS). Do not add antibiotics. Keep the plate in a humidified incubator at 37 °C and 5% CO2 for 24 h until electroporation.
  2. If the sgRNAs are shipped dry, rehydrate them with TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) to a final concentration of 100 µM (i.e. 10 µL of TE buffer per 1 nmol of sgRNA). Vortex for 30 s, incubate at 4 °C overnight to allow complete rehydration and, after a brief pipette homogenization, store the sgRNA stock solution at -20 °C. Depending on the final volume, make aliquots to avoid multiple freeze-thaw cycles.
  3. Prepare a working sgRNA solution at a final concentration of 30 µM by diluting the 100 µM stock solution in nuclease-free water. Vortex for 30 s and incubate 5 min at room temperature.
  4. Assemble the Cas9:sgRNA RNPs at a 1:9 molar ratio by simultaneously diluting 1 µL of each of the three 30 µM sgRNAs and 0.5 µL of 20 µM Cas9 solutions in 3.5 µL of resuspension buffer R, included in the electroporation kit (final volume of 7 µL, for one experimental condition; scale accordingly). Vortex briefly and incubate for 5 min at room temperature.
  5. In the meantime, prepare an unedited control by adding 0.5 µL of 20 µM Cas9 to 6.5 µL of resuspension buffer R. Vortex briefly and incubate for 5 min at room temperature.
  6. Add 5 µL of resuspension buffer R to all samples for a final volume of 12 µL per electroporation condition.
  7. Prepare the THP-1 cells for electroporation.
    1. To assess concentration and viability by Trypan blue exclusion test. Dilute the cells 1:2 in a 0.4% trypan blue staining solution. After 30 s incubation, homogenize well and add 10 µL in a wall of a counting chamber with a Neubauer-improved grid style. Count three large squares and divide the count by 100 to obtain the cell concentration (x106 cells/mL).
      NOTE: The health of the cells influences their sensitivity to electroporation. Care should be taken to perform the cell culture in optimal conditions. Time outside the incubator must be limited, and all reagents and solutions should be prepared and warmed up in advance.
    2. For each condition, collect a volume equivalent to 0.2 x 106 cells and centrifuge (336 x g, 5 min, 20 °C).
    3. Aspirate the supernatant using a pipette and resuspend the pellet in 500 µL of PBS. Centrifuge again (336 x g, 5 min, 20 °C).
    4. Aspirate the supernatant carefully using a pipette and resuspend the THP-1 cell pellet with the 12 µL of RNP solution (step 2.6).

3. Electroporation system set-up and nucleofection (Figure 1.3)

  1. Place the pipette station under a biosafety cabinet, put an electroporation tube in the support, and add 3 mL of buffer E, included in the electroporation kit.
  2. After switching on the electroporation device, use the touch screen to set the following electroporation parameters: Voltage = 1 500 V, Duration = 10 ms, Number = 3.
  3. Equip the electroporation pipette with a tip and aspirate 10 µL of the RNP/THP-1 solution (step 2.7.4). Insert the pipette into the electroporation tube and press Start on the electroporation device screen. Wait for the message Complete to appear and remove the pipette from the tube.
  4. Transfer the cells to a well of the pre-heated 24-well plate and homogenize gently. Put the plate back in the humidified incubator and let them rest undisturbed for 72 h.
    NOTE: Take care not to make any bubbles when pipetting the RNP/THP-1 suspension, as they will interfere with the electroporation procedure. If an error message appears in the absence of a visible electric arc, remove the electroporation pipette from the tube and press Start again. However, if an electric arc in the form of a brief bright spark is observed, it might indicate the presence of bubbles. The electroporation procedure will likely fail, even in the absence of an error message.

4. THP-1 recovery 72 h post-electroporation (Figure 1.4)

  1. Count the cells to assess concentration (step 2.7.1) 72 h after the electroporation.
  2. If there are enough cells (i.e.,≥0.6 x 106 cells/mL), dilute them at least a factor 2 with RPMI supplemented with 20% FBS and 1% Penicillin-Streptomycin and bring the concentration between 0.3-0.5 x 106 cells per mL. Otherwise, allow the cell to recover for another 72 h.
  3. Passage and amplify the cells until there is enough for KO validation. In the meantime, isolation of single-cell clones may be initiated (step 7).

5. Gene editing validation by T7EI mismatch assay (Figure 1.5)

NOTE: The assay might underestimate the editing efficiency given that T7EI recognizes mismatches larger than 1 bp. Thus, the T7EI assay is not useful for screening homozygous cell populations (i.e., single-cell clones) unless appropriately modified (step 5.7).

  1. Assess the cell concentration (step 2.7.1) and withdraw a volume equivalent to 0.1 x 106 cells in a 1.5 mL tube. Centrifuge (336 x g, 5 min, 20 °C), aspirate the supernatant, and resuspend the pellet in 500 µL of PBS. Centrifuge again and, using a pipette, aspirate as much supernatant as possible without disturbing the pellet. Snap-freeze the sample and store at -20 °C.
  2. Extract the genomic DNA to serve as a matrix for PCR amplification.
    1. Resuspend the pellet with 50 µL of DNA extraction solution, homogenize, and transfer the entire volume in a 0.2 mL PCR tube. Vortex and centrifuge briefly (pulse for 3 s).
    2. Place the tube in a thermal cycler and heat it at 65 °C for 15 min, followed by 98 °C for 10 min.
    3. Dilute the extracted DNA with 90 µL of ultrapure water. Vortex and centrifuge briefly (5,000 x g, 3 s).
  3. Dilute the PCR primer (see Table of Materials) in ultrapure water for a final concentration of 10 µM (i.e., 10 pmol/µL).
  4. Prepare the PCR mix (following the NOTE below) in a 0.2 mL PCR tube (final volume = 50 µL, for one condition). Usually, there will be at least two conditions: the KO and the unedited control with Cas9 only.
    NOTE: Purified genomic DNA: 10 µL; Forward and reverse primer (10 µM): 2.5 µL each, the final concentration of 500 nM; Reaction Buffer (5x): 10 µL. Vortex well before adding. Mix dNTP (25 mM of each): 0.6 µL, final concentration of 0.3 mM for each dNTP. DNA polymerase: 0.5 µL; Ultrapure water: 23.9 µL. Vortex and centrifuge briefly (pulse for 3 s).
  5. Place the tubes in the thermal cycler and run the PCR program with the following settings:
    NOTE: One cycle at 95 °C for 5 min, followed by 30 cycles [98 °C for 20 s (denaturation step), X °C for 15 s (annealing step), 72 °C for 45 s (elongation step)], then one final cycle at 72 °C for 2 min. At the end of the amplification, remove the tubes, vortex, and centrifuge briefly (pulse for 3 s). The annealing temperature (X) is the melting temperature (Tm) of the primers minus 5 °C.
  6. For a polyclonal edited population: in a new 0.2 mL tube, add 17.5 µL of the PCR amplicon and 2 µL of NEBuffer 2 (10x) for a final volume of 19.5 µL. Vortex and centrifuge briefly (pulse for 3 s). Alternatively, to screen single-cell clones, mix 1:1 of the PCR products from both the edited and the unedited control cells (step 5.6) (Supplementary Figure 1).
  7. For the heteroduplex formation, place the tubes in the thermal cycler and run the following program: one cycle at 95 °C for 10 min, one with a ramp of -2 °C/s from 95 to 85 °C, one with a ramp of -0.3 °C/s from 85 to 25 °C and one final cooling cycle at 10 °C on HOLD.
  8. After the heteroduplex formation, add 0.5 µL of T7EI solution into the tube. Incubate at 37 °C for 30 min.
  9. Prepare a 1.2% agarose gel:
    1. Weight the agarose in a glass bottle and add the appropriate volume of 1x TAE buffer (40 mM Tris-acetate, 1 mM EDTA, pH 8.3). Place it in a microwave paying attention not to screw the cap firmly. Heat several times until the agarose crystals are completely dissolved.
      NOTE: If required, mix the solution. Do not allow it to boil, or volume will decrease, changing the agarose concentration.
    2. Add the DNA gel stain diluted at 1/20,000 and mix well.
    3. Pour the agarose solution into a mold, add a comb, and let solidify at room temperature.
  10. Prepare samples for gel electrophoresis by mixing 5 µL of the T7EI-digestion products (step 5.9) or the undigested PCR product with 5 µL of water and 2 µL of 6x DNA loading dye. Load the samples and size ladder and migrate at 80 V for 45 min (time can be adapted depending on the expected size of the DNA fragments). Once migration is over, acquire an image of the gel with an appropriate imaging system.

6. Gene editing validation by Sanger sequencing analysis (Figure 1.6)

  1. To characterize the genetic modification, purify the PCR products (step 5.4) and, after Sanger sequencing, analyze the results with the ICE tool (https://www.synthego.com/products/bioinformatics/crispr-analysis).
  2. Control whether a protein can be produced despite the modifications.
    1. Download the ICE results and open the contribs.txt file.
    2. Compare the edited sequences with the WT counterpart. Map the indels and verify that they arose at the targeted genomic region. Assess their size. If the indel length is not a multiple of three, a frameshift will occur, and a PTC will possibly be introduced. The mutated mRNA will expectedly undergo NMD-mediated degradation.

7. Single-cell clone isolation by limiting dilution (Figure 1.7)

NOTE: Isolation of single-cell clones is not mandatory. However, if choosing to do so, it is important to characterize multiple clones and compare their phenotype with the original polyclonal population.

  1. Take a sample of cell suspension, dilute it 1/2 with culture medium, and assess the concentration (step 2.7.1). Dilution increases the counting accuracy.
  2. Perform 2 to 3 serial dilution steps to reach a concentration of 7 cells/mL. Dispense 100 µL of the cell suspension per well in a round-bottom 96-well plate (i.e., 0.7 cells per well). Let the cell decant for a few hours before observing the plates at the microscope to identify wells containing one cell.
  3. Monitor regularly colony formation and growth and transfer cells to a larger culture plate or flask when needed.

8. Functional characterization of THP-1 KO SAMHD1 cells by HIV-1 restriction assay

  1. Seed THP-1 in a 24-well culture plate with 0.25 x 106 cells per well in 300 µL of RPMI supplemented with 10% FBS, 1% Penicillin-Streptomycin (complete RPMI) and containing 300 ng/mL PMA for differentiation. Keep the plate in a humidified incubator (37 °C, 5% CO2) for 24 h.
  2. Replace the medium with a PMA-free complete RPMI medium and put the plate back in the incubator for another 24 h.
  3. Using a vacuum pump, aspirate all the culture medium. Add 250 µL of VSVg-pseudotyped HIV-1-GFP viral stock-containing solution (MOI = 0.5 IFU/cell). Include a non-infected control. Place the plate at 4 °C for 2 h to synchronize the infection.
  4. Wash the cells once with RPMI. Add 500 µL of complete RPMI to each well and incubate for 48 h in standard conditions (time can be adjusted).
  5. After removing the culture medium, wash the cells once with cold 1x PBS. Then, add 100 µL of 0.05% Trypsin-EDTA in each well. Place the plate in an incubator at 37 °C until the cells are completely detached (5 min should be enough) before adding 200 µL of complete RPMI to inactivate the enzyme. Transfer 250 µL from each well into a 96-well round-bottom plate (ensure the flow cytometer accepts culture plates).
  6. Centrifuge the plate (757 x g, 3 min, deceleration = 6, 20 °C) and aspirate the supernatant using a multichannel pipette. Resuspend the pellet with 100 µL of 4% PFA and incubate at 4 °C for 10 min. Add 100 µL of cold 1X PBS.
  7. Analyse the infection rate, represented by GFP-positive cells, by flow cytometry (see Supplementary Figure 2 for a suggested gating strategy).

Access restricted. Please log in or start a trial to view this content.

Results

A THP-1 cell line was generated stably expressing the GFP reporter protein (THP-1_GFP) (Figure 2A) and used as a tool to establish a protocol for an efficient CRISPR-Cas9-mediated gene edition. To this aim, 3 sgRNA targeting the EGFP gene was designed with the CRISPOR web tool29 (Figure 2B), which were simultaneously complexed with Cas9 at a molar ratio of 9:1 to form RNPs before delivery into the cells by electroporation us...

Access restricted. Please log in or start a trial to view this content.

Discussion

Here, a protocol is described to obtain a successful CRISPR-mediated editing of the THP-1 cell line. The approach relies on the transfer of pre-assembled sgRNA/Cas9 RNPs by electroporation/nucleofection. This strategy was chosen to limit the off-target effects that potentially arise upon lentiviral-mediated integration of the sgRNA/Cas9 cassette, yielding persistent expression of the nuclease. Multiple sgRNAs targeting the gene of interest were selected to achieve reliable and efficient editing, which increases the likel...

Access restricted. Please log in or start a trial to view this content.

Disclosures

All authors have no conflicts of interest.

Acknowledgements

We are grateful to JP Concordet (MNHN, U1154/UMR7196, Paris), G. Bossis (IGMM, Montpellier), and D. Schlüter (Hannover Medical School, Germany) for sharing protocols and for discussion. This project has received funding from the European Union's Horizon 2020 research and innovation program (grant agreement No 101017572 to AZ) and ANRS (grant ECTZ162721 to AZ). The Infectious Disease Model and Innovative Therapies (IDMIT) research infrastructure is supported by the "programme investissement d'avenir (PIA)" under reference ANR_11_INSB_0008.

Access restricted. Please log in or start a trial to view this content.

Materials

NameCompanyCatalog NumberComments
0.2 µm syringe filterClearLine146560_
0.4 % trypan blueBeckman Coulter383200_
1.5 mL tubeEppendorf3810X_
24-well plateCorning353047_
6x TriTrack DNA Loading DyeThermo scientificR1161_
75 cm² Culture Flask Vented CapCorning353136_
8-Strip PCR Tubes with CapsLife technologiesAM12230_
96-well plates Flat bottomCorning353072_
96-well plates Round bottomCorning353077_
AgaroseEuromedexD5_
ATGpr__https://atgpr.dbcls.jp/
ChemiDoc Imaging SystemBIO-RAD12003153_
Counting slideNanoEntekDHC-N04_
CRISPOR__http://crispor.gi.ucsc.edu/
DPBSGibco14190094_
EnsemblEMBL-EBI_https://www.ensembl.org/index.html
Fetal Bovine SerumSigma-AldrichF7524_
FlowJoBD Life Sciencesv10.10_
GeneRuler 100 bp Plus DNA LadderThermo scientificSM0323_
Genome Data ViewerNCBI_https://www.ncbi.nlm.nih.gov/gdv/
GraphPad PrismDotmatics_Version 9.3.1
Herculase II Fusion DNA PolymerasesAgilent600679_
ICE CRISPR Analysis ToolSynthego_https://www.synthego.com/products/bioinformatics/crispr-analysis
Image Lab TouchBIO-RAD_Version 2.4.0.03
NEBuffer 2New England BiolabsB7002SIncluded with T7EI M0302S
Neon Kit, 10 µLInvitrogenMPK1025KElectroporation kit containing tips, tubes, buffer R and E
Neon Transfection SystemInvitrogenMPK5000_
NetStart 1.0__https://services.healthtech.dtu.dk/services/NetStart-1.0/
Nuclease-free WaterSynthego__
PCR primer (EGFP)Eurofins_Fw : GGAATGCAAGGTCTGTTGAATG ; Rev : CACCTTGATGCCGTTCTTCT
PCR primer (SAMHD1)Eurofins_Fw : CGGGATTGATTTGAGGACGA ; Rev : GGGTGGCAAGTTAGTGAAGA
Penicillin-streptomycin (10,000 U/mL)Gibco15140122_
PFAElectron Microscopy Sciences15714_
PMASigma-AldrichP8139_
PrimerQuestIDT_https://eu.idtdna.com/pages/tools/primerquest
QIAquick PCR Purification KitQiagen28104_
QuickExtract DNA Extraction SolutionBiosearch TechnologiesQE09050_
RPMI 1640, GlutaMAXGibco61870010_
SnapGene ViewerDotmatics_Version 7
SpCas9 2NLS NucleaseSynthego__
SYBR Safe DNA Gel StainInvitrogenS33102_
Synthetic sgRNA (EGFP)Synthego_#1 : CGCGCCGAGGUGAAGUUCGA ; #2 : UUCAAGUCCGCCAUGCCCGA ; #3 : CAACUACAAGACCCGCGCCG
Synthetic sgRNA (SAMHD1)Synthego_#1 : AUCGCAACGGGGACGCUUGG ; #2 : GCAGUCAAGAACCUCGGCGC ; #3 : CCAUCCCGACUACAAGACAU
Syringe Plastipak Luer LockBD301229_
T100 Thermal CyclerBIO-RAD1861096_
T7 endonuclease INew England BiolabsM0302S_
TAE buffer UltraPure, 10xInvitrogen15558026400 mM Tris-Acetate, 10 mM EDTA
THP-1 cellsATCCTIB-202_
Trypsin-EDTA (0,05 %)Gibco25300054_
ZE5 Cell AnalyzerBIO-RAD12014135_

References

  1. Tsuchiya, S., et al. Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int J Cancer. 26 (2), 171-176 (1980).
  2. Danis, V. A., Millington, M., Hyland, V. J., Grennan, D. Cytokine production by normal human monocytes: inter-subject variation and relationship to an IL-1 receptor antagonist (IL-lRa) gene polymorphism. Clin Exp Immunol. 99, https://academic.oup.com/cei/article/99/2/303/6484286 (1995).
  3. Bol, S. M., et al. Donor variation in in vitro HIV-1 susceptibility of monocyte-derived macrophages. Virology. 390 (2), 205-211 (2009).
  4. Appleby, L. J., et al. Sources of heterogeneity in human monocyte subsets. Immunol Lett. 152 (1), 32-41 (2013).
  5. O'Neill, M. B., et al. Single-cell and bulk RNA-sequencing reveal differences in monocyte susceptibility to Influenza A virus infection between Africans and Europeans. Front Immunol. 12, 768189(2021).
  6. Wen, Y., et al. Comparability study of monocyte-derived dendritic cells, primary monocytes, and THP1 cells for innate immune responses. J Immunol Methods. 498, 113147(2021).
  7. Inagaki, Y., et al. Interferon-g-induced apoptosis and activation of THP-1 macrophages. Life Sci. 71 (21), 2499-2508 (2002).
  8. Boonkaewwan, C., Toskulkao, C., Vongsakul, M. Anti-inflammatory and immunomodulatory activities of stevioside and its metabolite steviol on THP-1 cells. J Agric Food Chem. 54 (3), 785-789 (2006).
  9. Chanput, W., et al. β-Glucans are involved in immune-modulation of THP-1 macrophages. Mol Nutr Food Res. 56 (5), 822-833 (2012).
  10. Cui, J., et al. USP3 inhibits type I interferon signaling by deubiquitinating RIG-I-like receptors. Cell Res. 24 (4), 400-416 (2014).
  11. Chen, S., et al. SAMHD1 suppresses innate immune responses to viral infections and inflammatory stimuli by inhibiting the NF-κB and interferon pathways. Proc Natl Acad Sci USA. 115 (16), E3798-E3807 (2018).
  12. Pradhananga, S., Spalinskas, R., Poujade, F. A., Eriksson, P., Sahlén, P. Promoter anchored interaction landscape of THP-1 macrophages captures early immune response processes. Cell Immunol. 355, 104148(2020).
  13. Mezzasoma, L., Talesa, V. N., Romani, R., Bellezza, I. Anp and BNP exert anti-inflammatory action via npr-1/cgmp axis by interfering with canonical, non-canonical, and alternative routes of inflammasome activation in human THP1 cells. Int J Mol Sci. 22 (1), 1-17 (2021).
  14. Martinat, C., et al. SUMOylation of SAMHD1 at Lysine 595 is required for HIV-1 restriction in non-cycling cells. Nat Commun. 12 (1), 4582(2021).
  15. Rensen, E., et al. Clustering and reverse transcription of HIV-1 genomes in nuclear niches of macrophages. EMBO J. 40 (1), e105247(2021).
  16. Ikeda, T., et al. APOBEC3 degradation is the primary function of HIV-1 Vif determining virion infectivity in the myeloid cell line THP-1. mBio. 14 (4), e0078223(2023).
  17. Jinek, M., et al. A programmable dual RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  18. Kurosaki, T., Maquat, L. E. Nonsense-mediated mRNA decay in humans at a glance. J Cell Sci. 129 (3), 461-467 (2016).
  19. Tuladhar, R., et al. CRISPR-Cas9-based mutagenesis frequently provokes on-target mRNA misregulation. Nat Commun. 10 (1), 4056(2019).
  20. Embree, C. M., Abu-Alhasan, R., Singh, G. Features and factors that dictate if terminating ribosomes cause or counteract nonsense-mediated mRNA decay. J Biol Chem. 298 (11), 102592(2022).
  21. Xue, C., Greene, E. C. DNA repair pathway choices in CRISPR-Cas9-mediated genome editing. Trends Genet. 37 (7), 639-656 (2021).
  22. Schnoor, M., et al. Efficient non-viral transfection of THP-1 cells. J Immunol Methods. 344 (2), 109-115 (2009).
  23. Tang, X., et al. A method for high transfection efficiency in THP-1 suspension cells without PMA treatment. Anal Biochem. 544, 93-97 (2018).
  24. Ji, W., Zhang, L., Liu, X. Protocol using lentivirus to establish THP-1 suspension cell lines for immunostaining and confocal microscopy. STAR Protoc. 4 (1), 102032(2023).
  25. Guo, C., Ma, X., Gao, F., Guo, Y. Off-target effects in CRISPR/Cas9 gene editing. Front Bioeng Biotechnol. 11, (2023).
  26. Synthego Performance Analysis, ICE Analysis. 3.0, Synthego. https://www.synthego.com/help/citing-ice (2019).
  27. Salamov, A. A., Nishikawa, T., Swindells, M. B. Assessing protein coding region integrity in cDNA sequencing projects. Bioinformatics. 14, 384-390 (1998).
  28. Pedersen, A. G., Nielsen, H. Neural network prediction of translation initiation sites in eukaryotes: Perspectives for EST and genome analysis. Proc Int Conf Intell Syst Mol Biol. 5, 226-233 (1997).
  29. Concordet, J. P., Haeussler, M. CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res. 46 (W1), W242-W245 (2018).
  30. Laguette, N., et al. SAMHD1 is the dendritic- and myeloid-cell-specific HIV-1 restriction factor counteracted by Vpx. Nature. 474 (7353), 654-657 (2011).
  31. Hrecka, K., et al. Vpx relieves inhibition of HIV-1 infection of macrophages mediated by the SAMHD1 protein. Nature. 474 (7353), 658-661 (2011).
  32. Seki, A., Rutz, S. Optimized RNP transfection for highly efficient CRI SPR/Cas9-mediated gene knockout in primary T cells. J Exp Med. 215 (3), 985-997 (2018).
  33. Batista Napotnik, T., Polajžer, T., Miklavčič, D. Cell death due to electroporation - A review. Bioelectrochemistry. 141, 107871(2021).
  34. Perretta-Tejedor, N., Freke, G., Seda, M., Long, D. A., Jenkins, D. Generating mutant renal cell lines using CRISPR technologies. Methods Mol Biol. 2067, 323-340 (2020).
  35. Sentmanat, M. F., Peters, S. T., Florian, C. P., Connelly, J. P., Pruett-Miller, S. M. A survey of validation strategies for CRISPR-Cas9 editing. Sci Rep. 8 (1), 888(2018).
  36. Makino, S., Fukumura, R., Gondo, Y. Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9. Sci Rep. 6, 39608(2016).
  37. Bowling, A., et al. Downstream alternate start site allows N-terminal nonsense variants to escape NMD and results in functional recovery by readthrough and modulator combination. J Pers Med. 12 (9), 1448(2022).
  38. Inácios, Â, et al. Nonsense mutations in close proximity to the initiation codon fail to trigger full nonsense-mediated mRNA decay. J Biol Chem. 279 (31), 32170-32180 (2004).
  39. Li, J., et al. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9. J Mol Cell Biol. 7 (4), 284-298 (2015).
  40. Guo, Y., et al. CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function. Cell. 162 (4), 900-910 (2015).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

ElectroporationCRISPR Cas9Gene KnockoutTHP 1 CellsHuman Monocyte derived MacrophagesInflammatory Signaling PathwaysPhorbol 12 myristate 13 acetateViral InteractionsSgRNADNA Editing EfficiencySanger SequencingInference Of CRISPR EditsProtein DepletionImmunoblottingSingle cell Clone Isolation

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved