Reconocemos el apoyo de los NIH Premio Innovador Nueva DP2 116520 y ORAU Ralph Powe Premio Junior Faculty mejora.

1. Mantenimiento de la célula <ol><li> HESC H1 (WiCell) se mantuvieron en hESC calificados matrigel pozos revestidos con mTeSR1 los medios de comunicación, con los medios de comunicación cambian todos los días. Los pocillos se recubre por una solución diluida de Matrigel, preparado mediante la adición de 300 l de Matrigel hCME en 25 ml de DMEM: F12. 1 ml de esta solución Matrigel se añadió a cada pocillo de una placa bien seis, o 400 l añadió a cada pocillo de una placa de 12 pocillos y se dejó capa durante 1 hora a temperatura ambiente. Las células se pasaron mecánicamente en una relación de separación de 1:4 por raspado colonias una vez que se alcanzó entre 1 y 1,5 mm de diámetro. </li><li> RHMVEC (tecnologías de la VEC) se mantuvo en MCDB-131 medios de comunicación con los medios de comunicación cambian cada dos días. Las células se dividieron por tripsinización una vez 80% de confluencia se alcanzó en una relación de separación de 1:3. Las células endoteliales entre pasajes 3 y 7 se utilizaron para este estudio. </li></ol> 2. Preparación de las soluciones de archivo <ol><li> Activina A se reconstituyó a 50 mg / ml de P estérilesBS que contenía 0,1% de suero de albúmina bovina. La solución se dividió en alícuotas y se almacenó a -20 ° C. </li><li> EGF se reconstituyó a 500 mg / ml en el estéril de 10 mM de ácido acético. La solución se dividió en alícuotas y se almacenó a -20 ° C. </li><li> La insulina se reconstituyó en 10 mg / ml mediante la adición de H 2 O acidificada (pH ≤ 2), preparado por adición de 0,1 ml de ácido acético glacial a 10 ml de agua. </li><li> DAPT se reconstituyó en DMSO a 18 mg / ml. Se diluyó adicionalmente a la concentración mM 300 en DMEM: F12, alícuotas y se almacenó a -20 ° C. </li><li> KAAD-ciclopamina se reconstituyó en DMSO a 5mg/ml. Se diluyó adicionalmente a la concentración mM 2 en DMEM: F12, alícuotas y se almacenó a -20 ° C. </li><li> Ácido trans-retinoico se reconstituyó en 2,7 mg / ml en 95% de etanol. Se diluyó adicionalmente a la concentración de 2 mM en DMEM: F12, alícuotas y se almacenó a -80 ° C. </li></ol> 3. Endodermo definitivo (DE) y la inducción pancreáticas progenitoras (PP) <ol><li> Una vez que hColonias CES alcanzado entre 1 y 1,5 mm de diámetro, la inducción DE se realizó mediante la adición de DMEM: F12 suplementado con B27, 0,2% de BSA, 100 ng / ml de activina A y 1 Wortmannin mM durante 4 días (día 0-día 4) con los medios cambian todos los días. </li><li> Después de la inducción DE fue completa, la inducción de páncreas progenitora fue inducida por el cambio de soporte a DMEM: F12 suplementado con B27, 0,2% de BSA y KAAD ciclopamina-a una concentración de 0,2 mM durante 24 horas (Día 4-Día 5). </li><li> Después de 24 horas medio se cambió a DMEM: F12 suplementado con B27, 0,2% de BSA, KAAD-ciclopamina a una concentración de 0,2 mM y ácido trans-retinoico en una concentración mM 2 durante 3 días con los medios de cambiar cada día (Día 5-Día 8) . </li></ol> 4. La maduración de páncreas <ol><li> Después de la inducción del PP, todos los grupos se cambió a los medios de maduración compuestas de DMEM: F12 suplementado con B27, 0,2% de BSA, 10 mM de nicotinamida, 25 mg / ml de insulina, 30 nM de Na 2 g Seo 3 y 50 / ml para la transferrina 2 days con los medios de comunicación cambian todos los días (día 8-Día 10). </li><li> Después de 2 días en los medios de maduración, la etapa de maduración final se lleva a cabo en paralelo usando diversas condiciones para la comparación. La diferenciación fue inducida en las siguientes condiciones: i) con la muesca inhibidor DAPT (ii) el uso de co-cultivo único medio de comunicación, sin que las células endoteliales como el control y (iii) mediante el contacto co-cultivo con células RHMVEC. Las células se mantuvieron en los medios de dApt o compañero de la cultura durante una semana (Día 10 Día 17) con los medios de comunicación cambian todos los días. <ol><li> Los medios de comunicación dApt fue preparado por complementar los medios de maduración con 30 mM DAPT. Las células de estos grupos fueron expuestos primero en completar MCDB131 durante 24 horas y luego se expusieron a los medios de comunicación dApt durante 6 días (Día 11 Día 17). </li><li> Medios de co-cultivo se preparó completándolo MCDB-131 con medios B27, 0,2% de BSA, 10 mM de nicotinamida, 10 ng / ml de EGF, 1 mg / ml de hidrocortisona, 10 mg EndoGro, 90 ug / ml de heparina. Para la condición de control de los medios de comunicación células diferenciadas fueron expuestosa MCDB-131 medio completo durante 24 horas (día 10-Día 11) después de lo cual se cambió el medio a los medios de co-cultivo durante 6 días (día 11-Día 17) (sin células endoteliales). </li><li> En caso de contacto condición de co-cultivo, un millón RHMVEC se añadió a las células que se diferencian en completos MCDB-131 medios (tecnologías de la VEC) para 24 horas (día 10-Día 11) para permitir la conexión. Después de los medios de comunicación las 24 horas fue cambiado a los medios de co-cultivo durante 6 días (Día 11 Día 17) con los medios de comunicación cambian todos los días. </li></ol></li></ol> 5. QRT-PCR Análisis <ol><li> Al final de cada etapa de la diferenciación (endodermo; progenitora pancreático; islote madura) se lisaron y el ARN se extrajo utilizando NucleoSpin kit de extracción de ARN II de acuerdo con las instrucciones del fabricante. </li><li> ARN de calidad se analizó mediante la comprobación absorbancia ARN a 260 nm y 280 nm, seguido por la cuantificación de ARN utilizando un espectrofotómetro SmartSpec Plus. </li><li> La transcripción inversa se realizó a través ImProm k II transcripción inversade acuerdo con las instrucciones del fabricante. Todas las reacciones se llevaron a cabo con 100 ng de RNA. </li><li> QRT-PCR se realizó utilizando el sistema de Mx3005P QPCR (Agilent) y Brilliant II SYBR Green mezcla maestra QPCR de acuerdo a las instrucciones del fabricante. Los cebadores utilizados se muestran en la tabla 1. El paso de inicialización se realizó a 50 ° C durante 2 minutos, seguido por 95 ° C durante 10 minutos. 50 ciclos de amplificación se realizaron como sigue: 95 ° C durante 30 segundos, 54 ° C durante 30 segundos y 72 ° C durante 1 minuto. </li><li> Veces el cambio de expresión mRNA blanco sobre las células indiferenciadas se calcula a partir de valores de CT con las siguientes fórmulas: Ct (marcador i) = CT (marcador i) - CT (GAPDH) Δ Ct (marcador i) = Ct (marcador i) (Muestra) - Ct (marcador i) (células indiferenciadas) La expresión relativa (marcador i) = 2-ΔΔCT(Marcador i) </li></ol> 6. La inmunocitoquímica <ol><li> Al final de cada etapa de la diferenciación (endodermo; progenitora pancreático; islote madura) las células fueron fijadas en formaldehído al 4% durante 15 minutos a temperatura ambiente. </li><li> Las células fijadas se permeabilizaron con 0,25% de Triton X-100 (TX) durante 15 minutos. </li><li> Tinción no específica se bloquearon por incubación en suero burro 10% en 0,05% TX durante 30 minutos. </li><li> Incubación del anticuerpo primario se realizó la noche a 4 ° C en tampón de bloqueo a la dilución de anticuerpos recomendado (ver tabla 1). </li><li> Las células fueron lavadas con TX 0,05% tres veces durante 5 minutos. </li><li> Incubación del anticuerpo secundario se realizó durante una hora a temperatura ambiente en la oscuridad con anticuerpos apropiados diluidos en tampón de bloqueo. </li><li> Las células fueron lavadas con TX 0,05% tres veces durante 5 minutos. </li><li> La tinción nuclear se realizó por incubación con Hoescht mancha en la dilución 1:1000 en PBSdurante 5 minutos, seguido de 3 lavados con PBS. </li><li> Las células fijadas y teñidas fueron imágenes utilizando Olympus IX81 microscopio invertido y el software Metamorph imágenes. </li></ol> 7. Los resultados representativos La adición de activina A y Wortmannin de hESC indiferenciada durante 4 días induce endodermo definitivo según lo confirmado por QRT-PCR en el análisis de marcadores DE Sox17, CXCR4, y FOXA2 y la inmunotinción para Sox17 como se ilustra en la Figura 2. La diferenciación de células progenitoras pancreáticas después de la adición de ácido retinoico y ciclopamina fue confirmada por QRT-PCR de marcadores progenitoras pancreáticas y inmunotinción para Pdx1 como se ilustra en la Figura 3. En la etapa final de la diferenciación, póngase en contacto con el co-cultivo con células RHMVEC fuertemente inducida por la regulación positiva de la expresión de insulina en las células pancreáticas hESC derivados progenitoras. La eficiencia de la diferenciación mediada por co-cultivo se analizó por comparing con la condición de control utilizando DAPT. DAPT se utilizó como control positivo, ya que es actualmente uno de los métodos más comúnmente utilizados para lograr la maduración de páncreas. Dado que el co-cultivo se realizó en un medio suplementado modificados por factores de apoyo de las células endoteliales, el control adicional se realizó con los medios de comunicación en ausencia de células endoteliales para verificar el efecto de los medios en la diferenciación. Los detalles de este análisis se presentan en la Figura 4. <img alt="Figura 1." src="/files/ftp_upload/3759/3759fig1.jpg" /> Figura 1. Multi-etapa de protocolo para la diferenciación de hESC en células productoras de insulina que expresan. <img alt="Figura 2." src="/files/ftp_upload/3759/3759fig2.jpg" /> Figura 2. Inducción de endodermo definitivo de células madre embrionarias humanas. A) QRT-PCR análisis de marcadores DE representativas en las células expuestas a hESC activina A y Wortmannin durante 4 días. Resultados ar<html> e normalizada con respecto a hESC indiferenciado. B) Sox17 coloración (verde) y DAPI (azul) muestran la expresión nuclear de Sox17. Barra de escala: 50 m. <img alt="Figura 3." src="/files/ftp_upload/3759/3759fig3.jpg" /> Figura 3. Páncreas inducción de células progenitoras de las células madre embrionarias derivan las células del endodermo. A) QRT-PCR análisis de los marcadores en las células pancreáticas primeros hESC endodermo derivados expuestos al ácido retinoico ciclopamina y durante 4 días después de la inducción DE. Los resultados normalizados con respecto a hESC indiferenciado. B) Pdx1 tinción (violeta) y DAPI (azul) muestran la expresión nuclear de Pdx1. Barra de escala: 50 m. &quot;&gt; <img alt="Figura 4." src="/files/ftp_upload/3759/3759fig4.jpg" /> Figura 4. De páncreas en estadio de maduración A) QRT-PCR análisis de las hormonas pancreáticas en hESC después de la maduración de páncreas con DAPT, póngase en contacto con los medios de co-cultivo o co-la cultura (de control). Los resultados normalizados con respecto a hESC indiferenciado. valores de p obtenido por t de Student. B) Co-cultivo con Dil-Ac-LDL marcados RHMVEC (rojo) muestran las regiones donde EC se adhieren a la placa si hay espacios vacíos (arriba), RHMVEC otros se encuentran en contacto directo con la diferenciación de ESC (abajo). C) del péptido C (verde) para la tinción de las células diferenciadas con el co-cultivo método. Barra de escala: 12,5 m (Arriba) y 50 micras (abajo) D) La inmunotinción de RHMVEC no demuestra la expresión de insulina en el RHMVEC. <table border="1"><tbody><tr><td> Marcador </td><td> Primer1 (5 &#39;a 3&#39;) &lt;/ Td&gt; <td> Primer2 (5 &#39;a 3&#39;) </td><td> Árbitro </td></tr><tr><td> SOX17 </td><td> CTCTGCCTCCTCCACGAA </td><td> CAGAATCCAGACCTGCACAA </td><td> 12 </td></tr><tr><td> CXCR4 </td><td> CACCGCATCTGGAGAACCA </td><td> GCCCATTTCCTCGGTGTAGTT </td><td> 4 </td></tr><tr><td> FOXA2 </td><td> GGAGCGGTGAAGATGGAA </td><td> TACGTGTTCATGCCGTTCAT </td><td> 12 </td></tr><tr><td> PDX1 </td><td> AAGTCTACCAAAGCTCACGCG </td><td> GTAGGCGCCGCCTGC </td><td> 4 </td></tr><tr><td> PTF1 </td><td> CATAGAGAACGAAACCACCCTTTGAG </td><td> GCACGGAGTTTCCTGGACAGAGTTC </td><td> 12 </td></tr><tr><td> HLXB9 </td><td> CACCGCGGGCATGATC </td><td> ACTTCCCCAGGAGGTTCGA </td><td> 4 </td></tr><tr><td> HNF6 </td><td> TGTGGAAGTGGCTGCAGGA </td><td> TGTGAAGACCAACCTGGGCT </td><td> 5 </td></tr><tr><td> PAX6 </td><td> CGAATTCTGCAGGTGTCCAA </td><td> ACAGACCCCCTCGGACAGTAAT </td><td> 5 </td></tr><tr><td> NKX6.1 </td><td> AGACCCACTTTTTCCGGACA </td><td> CCAACGAATAGGCCAAACGA </td><td> 5 </td></tr><tr><td> ISL1 </td><td> GATCTATGTCACCTCGCAAGG </td><td> TACAACCACCATTTCACTG </td><td> 12 </td></tr><tr><td> GLUCAGÓN </td><td> AGGCAGACCCACTCAGTGA </td><td> AACAATGGCGACCTCTTCTG </td><td> 4 </td></tr><tr><td> INSULINA </td><td> AAGAGGCCATCAAGCAGATCA </td><td> CAGGAGGCGCATCCACA </td><td> 12 </td></tr></tbody></table> Primers Tabla 1. Usado para reacciones de qPCR.

<ol>
	<li>De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Les+cellules+souches+embryonnaires+humaines+:+de+la+transgression+de+l'embryon+humain+&#225;+la+m&#233;decine+r&#233;g&#233;n&#233;ratrice+de+demain.">Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain &#225; la m&#233;decine r&#233;g&#233;n&#233;ratrice de demain.</a> Gyn&#233;cologie Obst&#233;trique &#38; Fertilit&#233;. 37, 620-626 (2009).</li><li>Murtaugh, L. C., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes,+Signals,+and+Lineages+in+Pancreas+Development.">Genes, Signals, and Lineages in Pancreas Development.</a> Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).</li><li>Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+definitive+endoderm+from+embryonic+stem+cells+in+culture.">Development of definitive endoderm from embryonic stem cells in culture.</a> Development. 131, 1651-1662 (2004).</li><li>D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat. Biotech. 24, 1392-1401 (2006).</li><li>Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+differentiation+of+human+ES+cells+and+iPS+cells+into+mature+pancreatic+insulin-producing+cells.">Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells.</a> Cell Res. 19, 429-438 (2009).</li><li>Basma, H., Soto-Guti&#233;rrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+and+Transplantation+of+Human+Embryonic+Stem+Cell-Derived+Hepatocytes.">Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes.</a> Gastroenterology. 136, 990-999 (2009).</li><li>Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -. P., Chipperfield, H., Tan, E. -. K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+Differentiation+of+Human+Embryonic+Stem+Cells+into+the+Pancreatic+Endocrine+Lineage.">Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage.</a> Stem Cells and Development. 16, 561-578 (2007).</li><li>Kim, S. K., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreas+development+is+promoted+by+cyclopamine,+a+Hedgehog+signaling+inhibitor.">Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor.</a> Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).</li><li>Docherty, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+development+of+the+islets+of+Langerhans:+implications+for+the+treatment+of+diabetes+mellitus.">Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus.</a> Current Opinion in Pharmacology. 1, 641-649 (2001).</li><li>Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., F&#228;ssler, R., Gu, G., Gerber, H. -. P., Ferrara, N., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Vascular+Basement+Membrane:+A+Niche+for+Insulin+Gene+Expression+and+[beta]&gt;+Cell+Proliferation.">The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]&gt; Cell Proliferation.</a> Developmental Cell. 10, 397-405 (2006).</li><li>Yoshitomi, H., Zaret, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cell+interactions+initiate+dorsal+pancreas+development+by+selectively+inducing+the+transcription+factor+Ptf1a.">Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a.</a> Development. 131, 807-817 (2004).</li><li>Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marked+differences+in+differentiation+propensity+among+human+embryonic+stem+cell+lines.">Marked differences in differentiation propensity among human embryonic stem cell lines.</a> Nat. Biotech. 26, 313-315 (2008).</li><li>Banerjee, I., Sharma, N., Yarmush, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+co-culture+on+pancreatic+differentiation+of+embryonic+stem+cells.">Impact of co-culture on pancreatic differentiation of embryonic stem cells.</a> J. Tissue Eng. Regen. Med. 5, 313-323 (2010).</li></ol>

No tenemos nada que revelar.

Durante el desarrollo del páncreas, que diferencian las células pancreáticas están en estrecha proximidad con las células endoteliales de la aorta y, además, los islotes pancreáticos son densamente vascularizado para promover el intercambio rápido de glucosa en la sangre y las hormonas de los islotes. Teniendo en cuenta estos hechos, no es sorprendente que las células endoteliales juegan un papel importante en el proceso de organogénesis pancreática. Si bien la importancia de las células endoteliales durante...

<table border="1"><tbody><tr><td> Nombre del reactivo </td><td> Empresa </td><td> Número de catálogo </td><td> Las concentraciones </td></tr><tr><td> mTeSR1 (con suplemento) </td><td> Stem Cell Technologies </td><td> 5850 </td><td></td></tr><tr><td> hESC cualificado matrigel </td><td> BD Biosciences </td><td> 354277 </td><td></td></tr><tr><td> DMEM: F12 </td><td> Invitrogen </td><td> 11330-032 </td><td></td></tr><tr><td> MCDB-131 </td><td> Invitrogen </td><td> 10372019 </td><td></td></tr><tr><td> MCDB-131 (Completo) </td><td> VEC Tecnologías </td><td> MCDB-131 </td><td></td></tr><tr><td> B27 Suplemento </td><td> Invitrogen </td><td> 17504044 </td><td></td></tr><tr><td> Activina A </td><td> I + D </td><td> <a href="http://www.rndsystems.com/pdf/338-ac.pdf">338-CA</a> </td><td> 100ng/ml </td></tr><tr><td> Wortmannin </td><td> Invitrogen </td><td> W3144 </td><td> 1um </td></tr><tr><td> KAAD-Cyclopamie </td><td> Sigma-Aldrich </td><td> C4116 </td><td> 0.2μM </td></tr><tr><td> El ácido trans-retinoico </td><td> Sigma-Aldrich </td><td> R2625 </td><td> 2μM </td></tr><tr><td> DAPT </td><td> Sigma-Aldrich </td><td> D5942 </td><td> 30μM </td></tr><tr><td> La nicotinamida </td><td> Sigma-Aldrich </td><td> N0636 </td><td> 10 mM </td></tr><tr><td> Selenita de sodio </td><td> Sigma-Aldrich </td><td> S5261 </td><td> 30 nM </td></tr><tr><td> Insulina </td><td> Sigma-Aldrich </td><td> I1882 </td><td> 25 g / ml </td></tr><tr><td> La transferrina </td><td> Sigma-Aldrich </td><td> T8158 </td><td> 50 g / ml </td></tr><tr><td> EGF </td><td> I + D </td><td> <a href="http://www.rndsystems.com/pdf/236-eg.pdf">236-EG</a> </td><td> 10ng/ml </td></tr><tr><td> EndoGro </td><td> VEC Tecnologías </td><td> ENDOGRO </td><td> 10mg </td></tr><tr><td> La heparina </td><td> Sigma-Aldrich </td><td> H3149 </td><td> 90μg/ml </td></tr><tr><td> La hidrocortisona </td><td> Sigma-Aldrich </td><td> H0888 </td><td> 1μg/ml </td></tr><tr><td> NucleoSpin RNA II </td><td> Macherey Nagel </td><td> 740955 </td><td></td></tr><tr><td> ImProm inversa II de la transcripción del sistema </td><td> Promega </td><td> A3800 </td><td></td></tr><tr><td> Brilliant II SYBR Green QPCR maestro de la mezcla </td><td> Straragene </td><td> 600548 </td><td></td></tr><tr><td> Sox17 policlonal de cabra IgG </td><td> Santa Cruz </td><td> sc-17355 </td><td> 1/500 </td></tr><tr><td> PDX1 policlonal de cabra IgG </td><td> Santa Cruz </td><td> sc-14662 </td><td> 1/500 </td></tr><tr><td> C-péptido de conejo policlonal </td><td> Señalización Celular </td><td> 4593 </td><td> 1/500 </td></tr><tr><td> Alexa Fluor 488 burro anti-IgG de conejo </td><td> Invitrogen </td><td> A-21206 </td><td> 1/1000 </td></tr><tr><td> Alexa Fluor 647 burro anti-IgG de cabra </td><td> Invitrogen </td><td> A-21447 </td><td> 1/1000 </td></tr></tbody></table> Tabla 2. Los reactivos y kits.

endothelial cell co-culture mediates maturation of human embryonic stem cell to pancreatic insulin producing cells in a directed differentiation approach

Las células madre embrionarias (ESC) tienen dos características principales: pueden ser propagadas in vitro indefinidamente en un estado indiferenciado y que son pluripotentes, lo que tiene el potencial de diferenciarse en múltiples linajes. Estas propiedades hacen que CES sumamente atractiva para la terapia celular regenerativa y aplicaciones basadas en el tratamiento 1. Sin embargo, para todo su potencial para llevarse a cabo las células que se diferencian en fenotipos maduros y funcionales, que es una tarea de enormes proporciones. Un enfoque prometedor en la inducción de diferenciación celular es para imitar el camino de la organogénesis en el en el establecimiento in vitro. El desarrollo del páncreas se sabe que se producen en etapas específicas 2, a partir del endodermo, que pueden desarrollarse en varios órganos, incluyendo el hígado y el páncreas. Endodermo inducción se puede lograr por la modulación de la vía nodal mediante la adición de activina A 3 en combinación con varios factores de crecimiento 4-7 </sup&gt;. Células definitivas endodermo luego someterse compromiso pancreático por inhibición de la inhibición sónica erizo, lo cual puede lograrse in vitro mediante la adición de ciclopamina 8. Maduración de páncreas está mediada por varios eventos paralelos, que incluyen la inhibición de la muesca de señalización; agregación de células progenitoras pancreáticas en 3-dimensionales racimos; inducción de la vascularización; para nombrar unos pocos. Con mucho, el más exitoso en la maduración in vitro de células derivadas de CES pancreáticas progenitoras se han logrado a través de la inhibición de la señalización Notch por la suplementación DAPT 9. Aunque tuvo éxito, esto da como resultado un bajo rendimiento del fenotipo maduro con funcionalidad reducida. Un área menos estudiada es el efecto de la señalización de las células endoteliales en la maduración de páncreas, que es cada vez más apreciado como un factor importante que contribuye a la maduración in vivo los islotes pancreáticos 10,11. El presente estudio explora estos efectos de endotelioial de señalización celular en la maduración de los humanos derivados de la CES, las células pancreáticas productoras de insulina en progenitoras de los islotes, como las células. Se presenta un protocolo de múltiples etapas de diferenciación dirigida, donde los humanos CES primero se induce hacia endodermo por activin A junto con la inhibición de la vía PI3K. Especificación de las células de páncreas endodermo se logra mediante la inhibición de la señalización erizo sónico por ciclopamina junto con la inducción de retinoide por adición de ácido retinoico. La etapa final de la maduración es inducida por la señalización de las células endoteliales consigue una configuración de co-cultivo. Mientras que varias células endoteliales han sido probados en el co-cultivo, en este documento se presentan los datos con las células de rata microvasculares endoteliales del corazón (RHMVEC), principalmente por la facilidad de análisis.

Watch this Scientific Journal Video about Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach at J

Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

El estudio actual describe un enfoque de diferenciación dirigida en la inducción de diferenciación pancreática de células madre embrionarias humanas. De gran importancia es la constatación de que las células endoteliales de co-cultivo de maduración media de las células madre embrionarias derivan en células progenitoras pancreáticas de insulina que expresan.

Células endoteliales Co-cultura media la maduración de embriones humanos de células madre a las células productoras de insulina del páncreas en un enfoque de diferenciación dirigida

Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are ...

endothelial-cell-co-culture-mediates-maturation-human-embryonic-stem

Research

JoVE Journal

Biology

16.2K vistas.  University of Pittsburgh. El estudio actual describe un enfoque de diferenciación dirigida en la inducción de diferenciación pancreática de células madre embrionarias humanas. De gran importancia es la constatación de que las células endoteliales de co-cultivo de maduración media de las células madre embrionarias derivan en células progenitoras pancreáticas de insulina que expresan.

Video: Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Derivation of Hematopoietic Stem Cells from Murine Embryonic Stem Cells

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are derived from the blastocyst of the early embryo and are pluripotent in differentiative ability.  Their vast differentiative potential has made them the focus of much research centered on deducing how to coax them to generate clinically useful cell types.  The successful derivation of hematopoietic stem cells (HSC) from mouse ESC has recently been accomplished and can be visualized in this video protocol.  HSC, arguably the most clinically exploited cell population, are used to treat a myriad of hematopoietic malignancies and disorders.  However, many patients that might benefit from HSC therapy lack access to suitable donors.  ESC could provide an alternative source of HSC for these patients.  The following protocol establishes a baseline from which ESC-HSC can be studied and inform efforts to isolate HSC from human ESC.  In this protocol, ESC are differentiated as embryoid bodies (EBs) for 6 days in commercially available serum pre-screened for optimal hematopoietic differentiation.  EBs are then dissociated and infected with retroviral HoxB4.  Infected EB-derived cells are plated on OP9 stroma, a bone marrow stromal cell line derived from the calvaria of  M-CSF-/- mice, and co-cultured in the presence of hematopoiesis promoting cytokines for ten days.  During this co-culture, the infected cells expand greatly, resulting in the generation a heterogeneous pool of 100s of millions of cells.  These cells can then be used to rescue and reconstitute lethally irradiated mice.

This protocol details the derivation of transplantable hematopoietic stem cells from mouse embryonic stem cells (ESC) and their subsequent injection into lethally irradiated recipient mice. Briefly, ESC are differentiated as embryoid bodies, which are then infected with retroviral HoxB4 and co-cultured with OP9 stromal cells and hematopoietic cytokines.

Derivación de células madre hematopoyéticas de células madre embrionarias murinas

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are ...

Investigación

Biología

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Derivación de células estaminales embrionarias humanas por Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Embryonic Stem Cell-Derived Endothelial Cells for Treatment of Hindlimb Ischemia

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This pathology causes symptoms such as intermittent claudication (pain with walking), painful ischemic ulcerations, or even limb-threatening gangrene. It is generally believed that the vascular endothelium, a monolayer of endothelial cells that invests the luminal surface of all blood and lymphatic vessels, plays a dominant role in vascular homeostasis and vascular regeneration. As a result, stem cell-based regeneration of the endothelium may be a promising approach for treating PAD.In this video, we demonstrate the transplantation of embryonic stem cell (ESC)-derived endothelial cells for treatment of unilateral hindimb ischemia as a model of PAD, followed by non-invasive tracking of cell homing and survival by bioluminescence imaging. The specific materials and procedures for cell delivery and imaging will be described. This protocol follows another publication in describing the induction of hindlimb ischemia by Niiyama et al.1

The surgical procedure for delivery of embryonic stem cell-derived endothelial cells to the ischemic hindlimb is demonstrated, with non-invasive tracking by bioluminescence imaging.

Células madre embrionarias-las células endoteliales derivadas de tratamiento de la isquemia Miembro Posterior

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This ...

Isolation and Large Scale Expansion of Adult Human Endothelial Colony Forming Progenitor Cells

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult human peripheral blood within a mean of 12 days. After large scale expansion &gt;1x108 ECFCs can be obtained for further tests. Advantageously by using pHPL the contact of human cells with bovine serum antigens can be excluded. By flow cytometry and immunohistochemistry the isolated cells can be characterized as ECFC and their in vitro functionality to form vascular like structures can be tested in a matrigel assay. Further these cells can be subcutaneously injected in a mouse model to form functional, perfused vessels in vivo. After long term expansion and cryopreservation proliferation, function and genomic stability appear to be preserved. 3,4
This animal-protein free isolation and expansion method is easily applicable to generate a large quantity of ECFCs.

Endothelial colony forming progenitor cells (ECFCs) are a promising tool to study vascular homeostasis and repair.1,2 This paper introduces a novel animal-serum free method for isolation and expansion of ECFC from heparinised adult human peripheral blood with pooled human platelet lysate (pHPL) diminishing the risk of anti-bovine immunisation.

El aislamiento y la expansión a gran escala de células humanas adultas Colonia progenitoras endoteliales formación

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal stem cells, MSCs) and endothelial colony forming progenitor cells (ECFCs). Both cell types are key players in maintaining the integrity of tissue and are probably also involved in regenerative processes and tumor formation.
To study their biology and function in a comparative manner it is important to have both cells types available from the same donor. It may also be beneficial for regenerative purposes to derive MSCs and ECFCs from the same tissue.
Because cellular therapeutics should eventually find their way from bench to bedside we established a new method to isolate and further expand progenitor cells without the use of animal protein. Pooled human platelet lysate (pHPL) replaced fetal bovine serum in all steps of our protocol to completely avoid contact of the cells to xenogeneic proteins.
This video demonstrates a methodology for the isolation and expansion of progenitor cells from one umbilical cord.
All materials and procedures will be described.

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

This protocol describes the isolation and subsequent expansion of mesenchymal stromal cells and endothelial colony forming cells without the use of animal serum to generate autologous pairs for experimental transplantation purposes.

Aislamiento y suero animal expansión libre de cordón umbilical humano derivado de células mesenquimales del estroma (MSC) y endoteliales formadoras de colonias Células Progenitoras (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software.  Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT.  To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images.  To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time.  The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion.  

Video bioinformatics is the automated processing, analysis, understanding, and data mining of biological spatio-temporal data extracted from microscopic videos. The purpose of this article is to demonstrate a method for measuring human embryonic stem cell colony growth using a video bioinformatics method.

Vídeo Bioinformática Análisis de Crecimiento Humano Colonia células madre embrionarias

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

La diferenciación de células madre embrionarias en los precursores de oligodendrocitos

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

El destino de la asignación de células estaminales embrionarias humanas mediante la formación de teratoma

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

Derivación eficiente de los Derechos Humanos precursores cardiacos y cardiomiocitos de pluripotentes células madre embrionarias humanas mediante la inducción de moléculas pequeñas

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

La reprogramación de células somáticas humanas en células madre pluripotentes inducidas (iPSCs) utilizando el vector retroviral con las buenas prácticas agrarias

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...