Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

NOTA: Este estudio se realizó de conformidad con la recomendación de la Guía para el Cuidado y Uso de Animales de Laboratorio del Instituto Nacional de Salud. El animal protocolo fue aprobado por la Universidad de Wisconsin-Madison, Institucional Cuidado de Animales y el empleo. Protocolo de cultivo de astrocitos primarios que se presenta aquí se adopta a partir de los protocolos presentados por Zhang Y 19 et al., Y Cengiz P 20 et al., Con algunas modificaciones. 1. La disección y del hipocampo Astrocyte Cultura <ol><li> Preparar todos los reactivos y materiales necesarios, incluyendo tijeras quirúrgicas, pinzas finas lisas, pinzas de punta plana, toallas de papel, bolsas de basura, 70% de etanol y 2 platos de disección (3,5 cm de diámetro) en el hielo llenos de 2 Solución de ml salina equilibrada de Hank (HBSS) cada . Asegúrese de que el equipo quirúrgico son estériles (autoclave) antes del procedimiento y el uso de todos los demás materiales (Astrocyte medio de baño: suero de DMEM + 5% + caballo1% de penicilina-estreptomicina, suero de caballo, HBSS, 0,25% de tripsina, cubreobjetos de vidrio, placas de Petri, 15/50 ml tubos, matraces T25, etc.) como pre-estéril. </li><li> Coloque un lado y rociar la cabeza y el cuello de la cría de ratón con un 70% de etanol y decapitar con unas tijeras estériles afiladas [Figura 1 (1)]. </li><li> Realizar una incisión en la línea media de posterior a anterior cráneo con unas tijeras pequeñas a lo largo del cuero cabelludo para exponer el cerebro [Figura 1 (2-3)]. </li><li> Cortar el cráneo con cuidado desde el cuello hasta la nariz con pequeñas tijeras. A continuación, corte anterior cráneo hasta los bulbos olfativos e inferior al cerebelo para desconectar el cráneo desde la base del cráneo. </li><li> Hacer una pequeña incisión en la base del cráneo y cortar a lo largo de la línea media. El uso de fórceps de punta plana estériles para despegar el cráneo. Quitar el tallo cerebral con la ayuda de unas pinzas curvas. Retire el cerebro del cráneo y el lugar en el primer plato de disección [Figura 1 (4-9)] 21. </li><li> Usando unas pinzas curvas, darle la vuelta al cerebro de manera que la superficie ventral del cerebro esté orientada hacia arriba y luego separar los dos hemisferios con una cuchilla quirúrgica estéril aguda [Figura 1 (10,11)] </li><li> Despegue los hemisferios cerebrales y cuidadosamente retire el tejido del cerebro medio y el tálamo abultada con unas pinzas curvas planas estériles para revelar el hipocampo, una estructura pequeña, con forma de caballito de mar en el lóbulo temporal medial [Figura 1 (12-14)]. </li><li> Eliminar tanto los lóbulos del hipocampo [Figura 1 (15,16)] y diseccionar cuidadosamente las meninges de los lóbulos tirando con las pinzas finas. Este paso evita contaminación del cultivo de astrocitos definitiva por células de las meninges y los fibroblastos. </li><li> La transferencia de los lóbulos del hipocampo preparados en el segundo plato lleno de HBSS y devolverlo en hielo [Figura 1 (17,18)]. Piscina, tanto del hipocampo lóbulos de un solo ratón (P0 - P2) para la preparación de hipopótamocultivos de astrocitos campal. Esto le da a la densidad apropiada de astrocitos. Picar lóbulos del hipocampo utilizando una cuchilla afilada quirúrgico estéril (aproximadamente 4 veces). </li><li> Aspirar HBSS del plato utilizando una punta estéril conectada a una pipeta de 1 ml y añadir 3 ml de tripsina al 0,25%, mezcla, transferir a un tubo cónico estéril de 15 ml e incubar el tejido a 37 ° C durante 20 minutos con agitación suave. </li><li> Tubo de centrífuga a 300 xg durante 5 min. Aspirar el sobrenadante con cuidado usando una pipeta de vidrio estéril conectada a una línea de vacío. Añadir 10 ml de astrocitos medio y se tritura chapado (20 - 30 veces) usando una pipeta de vidrio pulida al fuego hasta que las piezas de tejido homogeneizar. </li><li> Tubo de centrífuga a 300 xg durante 5 min. Aspirar el sobrenadante y añadir 2 ml de medio de astrocitos chapado fresca precalentada. Pase células a través de un filtro de malla 70 micras (filtro de células) en un nuevo tubo cónico de 50 mL. </li><li> toda la placa de suspensión de células en un matraz de cultivo T25 estéril poli-D-lisina / laminina recubierta que contiene 3 ml demedios de astrocitos chapado, a continuación, se incuba el matraz a 37 ° C en una incubadora de CO2 al 5%. </li><li> Toda Aspirar los medios de comunicación en día- i n-vitro (DIV) 1, 3 y DIV DIV 7, y reemplazar con 2 ml de medio fresco de astrocitos en placas. Observar la progresión y la confluencia de los astrocitos bajo microscopio de luz cada vez, mientras que la sustitución de los medios de comunicación astrocito chapado. NOTA: En DIV 1, todos los astrocitos viables están unidas a la superficie del matraz de cultivo y las células muertas o moribundas que incluyen neuronas están flotando en el sobrenadante. En DIV 3, las células unidas comienzan a dividirse para formar la capa de células de los astrocitos. En ausencia de las condiciones de apoyo, la cultura es casi desprovisto de cualquier crecimiento neuronal. En DIV 7, la capa de astrocitos es de aproximadamente 80 - 90% confluentes y unos pocos microglia, así como precursores de oligodendrocitos están presentes en la parte superior de la capa de astrocitos. </li><li> Aspirar el medio en placa del matraz, añadir 2 ml de medio precalentado astrocito chapado fresca, enjuague unand remover de nuevo en DIV 11, cuando los astrocitos son confluentes y listo para sub cultivo. </li><li> Añadir 2 ml de tripsina al 0,25%, gire suavemente el frasco unas cuantas veces y tripsina aspirado utilizando una pipeta de vidrio estéril. </li><li> Añadir 2 ml de tripsina al 0,25% y dejó que el matraz se sienta en la campana de cultivo de tejidos durante 4 - 5 min a temperatura ambiente. </li><li> Retire la tripsina y mantener el matraz a 37 ° C en una incubadora de CO2 al 5% durante 10 min. Añadir 5 ml precalentado astrocito medio en placa y separar la capa de astrocito tocando el frasco contra la palma de la mano (3 - 4 veces) seguido por trituración suave para lograr la separación completa y recoger los astrocitos en un tubo cónico de 15 ml. </li><li> tubo de centrifugación a 300 xg durante 5 minutos, aspirar el sobrenadante, y se añade 1 ml de medio fresco astrocito chapado. </li><li> Añadir 10 l de la suspensión celular a un hemocitómetro y contar las células en la gran zona cuadriculada central (1 mm 2) usando un microscopio de contraste de fases invertido (objetivo 10X). multiply por 10 4 para estimar el número de células por ml. Un matraz T25 rendirá ~ 1 x 10 6 células totales disociado. Seed ~ 1 x 10 5 células en 2 ml de astrocitos medio en placa en un 12 mm de diámetro de poli-D-lisina cubreobjetos de vidrio con capa preliminar en el pocillo de una placa de cultivo de 24 pocillos. </li><li> Se incuba a 37 ° C en una incubadora de CO2 al 5%. Realizar OGD / Reox en DIV 12 - 14 (apartado 2). </li><li> El tratamiento de los cultivos de astrocitos en DIV 3 con clorhidrato de 5 mM de L-leucina metil éster (LME) hasta DIV 11 si se desean cultivos de hipocampo carentes de la microglia. Después de la incubación de la LME, los cultivos sometidos a agitación (300 rpm durante 1 h) para eliminar la contaminación de la microglía. NOTA: LME es un agente citotóxico microglial que se ha utilizado ampliamente como un método para eliminar la proliferación de microglia 22. </li></ol> 2. OGD / Tratamiento Reox <ol><li> Aspirar los medios de cultivo que contienen cubreobjetos astrocito adherente (DIV 12 - 14) y enjuagar 3 veceshaciendo girar suavemente la placa de cultivo de 24 pocillos que sostiene el cubreobjetos un par de veces con 1 ml de solución isotónica de OGD (pH 7,4) que contiene (en mM): 0 glucosa, 21 NaHCO 3, 120 NaCl, 5,36 KCl, 0,33 Na 2 HPO 4, 0,44 KH 2 PO 4, CaCl2 1,27 y 0,81 MgSO4. </li><li> Añadir 0,2 ml de solución OGD para así cubrir el cubreobjetos y se incuba durante 2 h en un incubador hipóxico que contiene 94% N 2, 1% O 2, y 5% de CO 2. Mezclar suavemente con un agitador orbital (50 rpm) para la primera 30 min de hipoxia para facilitar el intercambio de gases. </li><li> Se incuban las células de control de normoxia durante 2 h en 5% de CO2 y aire atmosférico en un tampón idéntico a la solución OGD a excepción de la adición de glucosa 5,5 mM. </li><li> Para Reox, solución OGD aspirado y añadir 2 ml de medio de baño de astrocitos. Incubar en 5% de CO2 y aire atmosférico a 37 ° C durante 5 h. </li></ol> 3. La tinción inmunocitoquímica &lt;/ P&gt; <ol><li> Aspirar los medios de cultivo usando una pipeta de vidrio estéril unida a una línea de vacío y enjuague rápidamente cubreobjetos una vez mediante la adición de 1 ml de 0,1 M Tris Buffered Saline (TBS) (NaCl 154 mM, 16 mM Trizma Base, 84 mM Tris-HCl, pH 7,4) al pozo. Aspirar y añadir 2 ml de paraformaldehído al 4% (PFA) en 1x Tampón fosfato salino (PBS). Incubar durante 15 min a TA. </li><li> Aspirar y agregar 1 ml de TBS 0,1 M, a continuación, colocar en un agitador oscilante durante 2 min. Repetir 3 veces. Añadir 1 ml de solución (10% de suero de cabra, 10 mg / ml de BSA, 0,025% de Triton X-100 en 0,1 M TBS) de bloqueo y se incuba durante 30 min a 37 ° C en un agitador de balanceo. </li><li> Aspirar solución de bloqueo y añadir anticuerpo-GFAP contra monoclonal primario de ratón (0,2 ml de una dilución 1: 500 en solución de bloqueo) y policlonal de conejo anti-S100B (1: 500) o policlonal de conejo anti-HIF1α (1: 200) durante 60 min a 37 ° C en un agitador de balanceo. </li><li> Alternativamente, algunos astrocitos se incubaron con anticuerpo policlonal de conejo anti-Iba1 (1: 200) y ratón lunoclonal anti-MAP2 para acceder a la pureza del cultivo. </li><li> Aspirar anticuerpo primario y enjuague cubreobjetos mediante la adición de 1 ml de 0,1 M TBS y colocar en un agitador de balanceo durante 2 min y luego aspirar. Repetir dos veces. </li><li> Añadir 0,2 ml de una dilución 1: 200 de los anticuerpos anti-conejo conjugados 568 488-conjugados y anti-ratón de cabra secundario en solución de bloqueo durante 60 min a 37 ° C en un agitador de balanceo. </li><li> Aspirar el anticuerpo secundario y enjuague cubreobjetos mediante la adición de 1 ml de 0,1 M TBS y se deposita en un agitador oscilante durante 2 min y luego aspirado. Repetir dos veces. </li><li> Retire el cubreobjetos de bien y seca mediante la colocación en un portaobjetos situado sobre un portaobjetos de pelo. CUBREOBJETOS en una nueva diapositiva mediante la inversión en una sola gota de medio de montaje Vectashield Hardset con DAPI (1,5 ng / l). </li><li> cubreobjetos de imagen en un microscopio confocal utilizando 20X petróleo objetivo seco o 60X. Adquirir imágenes (512 x 512) para DAPI (405 nm ex / em 450 nm) y 488 fluorocromo etiquetados anticuerpo GFAP (488 nm ex / 515 nmem). Mantener constantes los parámetros de adquisición dentro de la 20X y 60X grupos. </li></ol> 4. Determinación del Sexo El uso de PCR <ol><li> dedo del pie perrito calor o recortes de los dedos a 95 ° C durante 45 minutos en NaOH 50 mM y se neutralizan con un volumen igual de Tris 1 M, pH 6,8. </li><li> Añadir 1 l de la solución de ADN se extrajo a 19 l de la siguiente mezcla: 5 pmoles de cebadores para los genes MYOG y SRY, tampón de reacción 1x, 0,2 mM de cada uno de desoxinucleótido y 8 U Taq polimerasa. </li><li> Utilizar secuencias de cebadores; Sry 5&#39;TCATGAGACTGCCAACCACAG3 &#39;, 5&#39;CATGACCACCACCACCACCAA3&#39; y MYOG 5&#39;TTACGTCCATCGTGGACAGC3 &#39;, 5&#39;TGGGCTGGGTGTTAGTCTTA3&#39; 23. </li><li> Realizar el siguiente protocolo de PCR: 95 ° C durante 3 min, a continuación 30 ciclos de desnaturalización a 95 ° C durante 15 s, hibridación a 58 ° C durante 15 s, y elongación a 72 ° C durante 1 min. Después de estos 30 ciclos, la reacción concluye con una final de elongación a 72ºC durante 1 min. </li><li> PC separadaProductos R electroforéticamente en un gel de agarosa con bromuro de etidio que contiene 2% y visualizar bajo iluminación UV. PRECAUCIÓN (Figura 2A.)! El bromuro de etidio es un carcinógeno potencial y debe ser manejado con cuidado y eliminarse adecuadamente según las regulaciones de la institución. </li></ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

Ninguno de los autores han intereses en competencia o en conflicto.

Con el fin de estudiar las diferencias de sexo en las propiedades y funciones de los astrocitos en condiciones fisiológicas y patológicas, la preparación de los astrocitos primarios sexado en cultivo celular es una herramienta importante que se utilice. En el presente estudio se presenta un altamente eficiente y un método reproducible a la cultura de una población homogénea altamente enriquecido de los astrocitos del hipocampo sexado de recién nacido (P0-P2) C57Bl / 6 (de tipo salvaje) o K19F (GFAP nulo) crías d...

Los astrocitos son uno de los jugadores clave más importantes en el sistema nervioso central (SNC). La creciente cuerpo de evidencia indica que las funciones de los astrocitos son más que proporcionar apoyo neuronal. De hecho, las funciones de los astrocitos en condiciones fisiológicas pueden ser muy complejos, como guía la migración de los axones en desarrollo 1, la regulación de CNS flujo de sangre 2, el mantenimiento de la homeostasis del pH del fluido intersticial sináptica 3, y participar en la barrera hematoencefálica 4 y 5 la transmisión sináptica. En condiciones patológicas, los astrocitos responden a la lesión con un proceso llamado astrogliosis reactiva en la que la morfología, el número, la ubicación, la topografía (con respecto a la distancia de insulto) y la función de los astrocitos pueden cambiar de una manera heterogénea 6,7. Astrogliosis visto después de la encefalopatía hipóxico-isquémica neonatal puede que contribuye a la morbilidad y la mortalidad de los recién nacidos <shasta&gt; 8. estudios clínicos y experimentales recientes indican que la gravedad de la lesión cerebral parece ser dependiente del sexo y que los recién nacidos masculinos son más susceptibles a los efectos de la hipoxia / isquemia (HI) lesión cerebral -related, resultando en resultados neurológicos más graves en comparación con las mujeres con lesiones cerebrales comparables 9-11. Aunque la localización de la lesión depende de la edad gestacional y la duración y la gravedad de la lesión, el hipocampo es una de las regiones más comúnmente realizada en el SNC después neonatal HI plazo, y astrogliosis hipocampo ha sido confirmado por la sobre regulación de aumento la proteína glial fibrilar ácida (GFAP) 3 d después de la HI neonatal 7,10,12,13. Las diferencias de sexo en función de los astrocitos se muestran en ambos neonatos y roedores adultos después de la isquemia cerebral 14,15. Además, la susceptibilidad astrocytic macho a la isquemia in vitro se demostró por el aumento de cell muerte en comparación con los astrocitos corticales femeninas en la cultura 16. Las diferencias de sexo comienzan en el útero y continúan hasta la muerte 17. Durante la última década, la importancia de incluir los sexos en condiciones experimentales en cultivo celular y estudios in vivo han sido el énfasis del Instituto de Medicina y los NIH para buscar el conocimiento fundamental de las diferencias sexuales observadas en condiciones fisiológicas y patológicas 17,18 . El desarrollo de métodos fiables para aislar y mantener las poblaciones de astrocitos del hipocampo sexuado es esencial para entender las bases celulares de las diferencias sexuales en las consecuencias patológicas de HI neonatal. El presente estudio fue diseñado para proporcionar las técnicas para preparar cultivos de astrocitos del hipocampo sexo-específicas enriquecidas a partir de ratones recién nacidos con el fin de evaluar el papel de los astrocitos GFAP-inmunorreactivas siguientes oxígeno / glucosa Privación (OGD) y reoxigenación (Reox), induciendoHI en el ambiente de cultivo celular. Esta técnica se puede utilizar para probar cualquier hipótesis relativa a los astrocitos del hipocampo en los machos y hembras neonatales en condiciones de normoxia e isquémicos.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Astrocyte culture media</td>
		</tr>
		<tr>
			<td>DMEM, high glucose</td>
			<td>cellgro</td>
			<td>10-013-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Horse serum</td>
			<td>Gibco</td>
			<td>26050-070</td>
			<td>Final Concentration: 10%</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin</td>
			<td>Cellgro&#160;</td>
			<td>30-002-CI</td>
			<td>Final Concentration: 1%</td>
		</tr>
		<tr>
			<td rowspan="2">L-Leucine methyl ester hydrochloride</td>
			<td rowspan="2">Aldrich</td>
			<td rowspan="2">L1002-25G</td>
			<td rowspan="2">Final Concentration: 5 mM</td>
		</tr>
		<tr>
		</tr>
		<tr>
			<td colspan="4">Solution for brain tissue digestion</td>
		</tr>
		<tr>
			<td>HBSS</td>
			<td>Life Technologies</td>
			<td>14170-088</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin</td>
			<td>cellgro</td>
			<td>25-050-CI</td>
			<td>Final Concentration: 0.25%</td>
		</tr>
		<tr>
			<td colspan="4">Other</td>
		</tr>
		<tr>
			<td>70% (vol/vol) ethanol</td>
			<td>Roth</td>
			<td>9065.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly-D-Lysine 12mm round coverslips&#160;</td>
			<td>Corning</td>
			<td>354087</td>
			<td></td>
		</tr>
		<tr>
			<td>Water</td>
			<td>Sigma</td>
			<td>W3500</td>
			<td>cell culture grade</td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>cellgro</td>
			<td>21-040-CV</td>
			<td>cell culture grade</td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA&#160;</td>
			<td>Life Technologies</td>
			<td>25300-062</td>
			<td></td>
		</tr>
		<tr>
			<td>70 &#956;m Sterile cell strainer&#160;</td>
			<td>Fisher scientific</td>
			<td>22363548</td>
			<td></td>
		</tr>
		<tr>
			<td>3.5 cm petri dish</td>
			<td>BD Falcon</td>
			<td>353001</td>
			<td></td>
		</tr>
		<tr>
			<td>15 ml Falcon tube</td>
			<td>BD Falcon</td>
			<td>352096</td>
			<td></td>
		</tr>
		<tr>
			<td>50 ml Falcon tube</td>
			<td>BD Falcon</td>
			<td>352070</td>
			<td></td>
		</tr>
		<tr>
			<td>Forceps, fine&#160;</td>
			<td>Dumont</td>
			<td>2-1032; 2-1033</td>
			<td># 3c; # 5</td>
		</tr>
		<tr>
			<td>Forceps, flat tip</td>
			<td>KLS Martin</td>
			<td>12-120-11</td>
			<td></td>
		</tr>
		<tr>
			<td>13 cm surgical scissors</td>
			<td>Aesculap</td>
			<td>BC-140-R</td>
			<td></td>
		</tr>
		<tr>
			<td>Confocal Microscope</td>
			<td>Nikon</td>
			<td>A1RSi&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5805000.017</td>
			<td>Centrifuge5804R</td>
		</tr>
		<tr>
			<td>Orbital Shaker</td>
			<td>Thermo Scientific</td>
			<td>SHKE 4450-1CE</td>
			<td>MaxQ 4450&#160;</td>
		</tr>
		<tr>
			<td>Anti-IBA1</td>
			<td>Wako</td>
			<td>019-19741</td>
			<td>Rabbit monoclonal</td>
		</tr>
		<tr>
			<td>Anti-MAP2</td>
			<td>Sigma</td>
			<td>M2320</td>
			<td>Mouse monoclonal</td>
		</tr>
		<tr>
			<td>Anti-HIF1alpha</td>
			<td>abcam</td>
			<td>ab179483</td>
			<td>rabbit monoclonal</td>
		</tr>
		<tr>
			<td>Anti-S100B</td>
			<td>Sigma</td>
			<td>HPA015768</td>
			<td>Rabbit polyclonal</td>
		</tr>
		<tr>
			<td>Anti-GFAP (cocktail)</td>
			<td>Biolegend</td>
			<td>837602</td>
			<td></td>
		</tr>
		<tr>
			<td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td>
			<td>Vector Labs</td>
			<td>PK-6101</td>
			<td>Contains 4 Reagents&#160;</td>
		</tr>
		<tr>
			<td>Goat Anti Rabbit Alexa-Fluor 488</td>
			<td>Invitrogen</td>
			<td>A11070</td>
			<td></td>
		</tr>
		<tr>
			<td>Goat Anti Mouse Alexa-Fluor 568</td>
			<td>Invitrogen</td>
			<td>A11004</td>
			<td></td>
		</tr>
	</tbody>
</table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

Astrogliosis siguiente / isquemia (HI) -relacionado lesión cerebral por hipoxia juega un papel en el aumento de la morbilidad y la mortalidad en los recién nacidos. Los estudios clínicos recientes indican que la gravedad de la lesión cerebral parece ser dependiente del sexo, y que los recién nacidos varones son más susceptibles a los efectos de la lesión cerebral relacionada con HI, dando lugar a resultados neurológicos más graves en comparación con las mujeres con lesiones cerebrales comparables. El desarrollo de métodos fiables para aislar y mantener las poblaciones altamente enriquecidas de los astrocitos del hipocampo sexuado es esencial para entender las bases celulares de las diferencias sexuales en las consecuencias patológicas de HI neonatal. En este estudio, se describe un método para crear cultivos de astrocitos de hipocampo específicos del sexo que están sometidos a un modelo de isquemia in vitro, la privación de glucosa en oxígeno, seguido por la reoxigenación. astrogliosis reactiva subsiguiente fue examinado por immunostaiNing para la proteína glial fibrilar ácida (GFAP) y S100B. Este método proporciona una herramienta útil para estudiar el papel de los astrocitos del hipocampo masculinos y femeninos siguiente neonatal HI, por separado.

La comprensión de las funciones de las funciones de astrocitos sexado bajo condiciones fisiológicas o fisiopatológicas se han dilucidado inmensamente mediante el cultivo de estas células en condiciones in vitro. El aspecto importante de la realización de cultivo sexuado es determinar el sexo de la cría de ratón antes de su uso. Se determinó el sexo del ratón genéticamente por PCR y por la evaluación visual (Figura 2) 16. La metodología de ...

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Los astrocitos son uno de los jugadores clave más importantes en el sistema nervioso central (SNC). Aquí, estamos reportando un método práctico de protocolo de cultivo de astrocitos del hipocampo sexado con el fin de estudiar los mecanismos que subyacen a la función de los astrocitos en cachorros recién nacidos masculinos y femeninos después de la isquemia in vitro.

Diferencias de sexo en el ratón del hipocampo después de astrocitos<em&gt; In-Vitro</em&gt; isquemia

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Research

JoVE Journal

Neuroscience

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

13.3K vistas.  University of Wisconsin.  Los astrocitos son uno de los jugadores clave más importantes en el sistema nervioso central (SNC). Aquí, estamos reportando un método práctico de protocolo de cultivo de astrocitos del hipocampo sexado con el fin de estudiar los mecanismos que subyacen a la función de los astrocitos en cachorros recién nacidos masculinos y femeninos después de la isquemia in vitro. 

Video: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Fluorescence Recovery After Photobleaching (FRAP) of Fluorescence Tagged Proteins in Dendritic Spines of Cultured Hippocampal Neurons

FRAP has been used to quantify the mobility of GFP-tagged proteins. Using a strong excitation laser, the fluorescence of a GFP-tagged protein is bleached in the region of interest. The fluorescence of the region recovers when the unbleached GFP-tagged protein from outside of the region diffuses into the region of interest. The mobility of the protein is then analyzed by measuring the fluorescence recovery rate. This technique could be used to characterize protein mobility and turnover rate.
In this study, we express the (enhanced green fluorescent protein) EGFP vector in cultured hippocampal neurons. Using the Zeiss 710 confocal microscope, we photobleach the fluorescence signal of the GFP protein in a single spine, and then take time lapse images to record the fluorescence recovery after photobleaching. Finally, we estimate the percentage of mobile and immobile fractions of the GFP in spines, by analyzing the imaging data using ImageJ and Graphpad softwares.
This FRAP protocol shows how to perform a basic FRAP experiment as well as how to analyze the data.

Fluorescence Recovery After Photobleaching FRAP of Fluorescence Tagged Proteins in Dendritic Spines of Cultured Hippocampal Neurons

FRAP has been used to quantify the mobility of Green Fluorescence Protein (GFP)-tagged proteins in cultured cells. We examined the mobile/immobile fractions of the GFP by analyzing the fluorescence recovery percentage after photobleaching. In this study, FRAP was performed at spines of hippocampal neurons.

La recuperación de fluorescencia después de photobleaching (FRAP) de fluorescencia de proteínas marcadas en las espinas dendríticas de las neuronas del hipocampo cultivadas

FRAP has been used to quantify the mobility of GFP-tagged proteins. Using a strong excitation laser, the fluorescence of a GFP-tagged protein is bleached ...

Investigación

Neurociencias

Dual Electrophysiological Recordings of Synaptically-evoked Astroglial and Neuronal Responses in Acute Hippocampal Slices

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs through activation of their ion channels and neurotransmitter receptors, and process information in part through activity-dependent release of gliotransmitters. Furthermore, astrocytes constitute the main uptake system for glutamate, contribute to potassium spatial buffering, as well as to GABA clearance. These cells therefore constantly monitor synaptic activity, and are thereby sensitive indicators for alterations in synaptically-released glutamate, GABA and extracellular potassium levels. Additionally, alterations in astroglial uptake activity or buffering capacity can have severe effects on neuronal functions, and might be overlooked when characterizing physiopathological situations or knockout mice. Dual recording of neuronal and astroglial activities is therefore an important method to study alterations in synaptic strength associated to concomitant changes in astroglial uptake and buffering capacities. Here we describe how to prepare hippocampal slices, how to identify stratum radiatum astrocytes, and how to record simultaneously neuronal and astroglial electrophysiological responses. Furthermore, we describe how to isolate pharmacologically the synaptically-evoked astroglial currents.

The preparation of acute brain slices from isolated hippocampi, as well as the simultaneous electrophysiological recordings of astrocytes and neurons in stratum radiatum during stimulation of schaffer collaterals is described. The pharmacological isolation of astroglial potassium and glutamate transporter currents is demonstrated.

Dos registros electrofisiológicos de sinápticamente respuestas evocadas neuronal y astroglial en agudas rodajas de hipocampo

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Aislamiento y cultivo de astrocitos corticales de ratones

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Modeling Astrocytoma Pathogenesis In Vitro and In Vivo Using Cortical Astrocytes or Neural Stem Cells from Conditional, Genetically Engineered Mice

Current astrocytoma models are limited in their ability to define the roles of oncogenic mutations in specific brain cell types during disease pathogenesis and their utility for preclinical drug development. In order to design a better model system for these applications, phenotypically wild-type cortical astrocytes and neural stem cells (NSC) from conditional, genetically engineered mice (GEM) that harbor various combinations of floxed oncogenic alleles were harvested and grown in culture. Genetic recombination was induced in vitro using adenoviral Cre-mediated recombination, resulting in expression of mutated oncogenes and deletion of tumor suppressor genes. The phenotypic consequences of these mutations were defined by measuring proliferation, transformation, and drug response in vitro. Orthotopic allograft models, whereby transformed cells are stereotactically injected into the brains of immune-competent, syngeneic littermates, were developed to define the role of oncogenic mutations and cell type on tumorigenesis in vivo. Unlike most established human glioblastoma cell line xenografts, injection of transformed GEM-derived cortical astrocytes into the brains of immune-competent littermates produced astrocytomas, including the most aggressive subtype, glioblastoma, that recapitulated the histopathological hallmarks of human astrocytomas, including diffuse invasion of normal brain parenchyma. Bioluminescence imaging of orthotopic allografts from transformed astrocytes engineered to express luciferase was utilized to monitor in vivo tumor growth over time. Thus, astrocytoma models using astrocytes and NSC harvested from GEM with conditional oncogenic alleles provide an integrated system to study the genetics and cell biology of astrocytoma pathogenesis in vitro and in vivo and may be useful in preclinical drug development for these devastating diseases.

Modeling Astrocytoma Pathogenesis In Vitro and In Vivo Using Cortical Astrocytes or Neural Stem Cells from Conditional, Genetically Engineered Mice

Phenotypically wild-type astrocytes and neural stem cells harvested from mice engineered with floxed, conditional oncogenic alleles and transformed via viral Cre-mediated recombination can be used to model astrocytoma pathogenesis in vitro and in vivo by orthotopic injection of transformed cells into brains of syngeneic, immune-competent littermates.

Modelado astrocitoma Patogénesis<em&gt; In Vitro</em&gt; Y<em&gt; En Vivo</em&gt; Uso cortical astrocitos o células troncales nerviosas de ratones condicionales, Genéticamente Manipulados

Current astrocytoma models are limited in their ability to define the roles of oncogenic mutations in specific brain cell types during disease ...

Immunohistochemical Visualization of Hippocampal Neuron Activity After Spatial Learning in a Mouse Model of Neurodevelopmental Disorders

Induction of phosphorylated extracellular-regulated kinase (pERK) is a reliable molecular readout of learning-dependent neuronal activation. Here, we describe a pERK immunohistochemistry protocol to study the profile of hippocampal neuron activation following exposure to a spatial learning task in a mouse model characterized by cognitive deficits of neurodevelopmental origin. Specifically, we used pERK immunostaining to study neuronal activation following Morris water maze (MWM, a classical hippocampal-dependent learning task) in Engrailed-2 knockout (En2-/-) mice, a model of autism spectrum disorders (ASD). As compared to wild-type (WT) controls, En2-/- mice showed significant spatial learning deficits in the MWM. After MWM, significant differences in the number of pERK-positive neurons were detected in specific hippocampal subfields of En2-/- mice, as compared to WT animals. Thus, our protocol can robustly detect differences in pERK-positive neurons associated to hippocampal-dependent learning impairment in a mouse model of ASD. More generally, our protocol can be applied to investigate the profile of hippocampal neuron activation in both genetic or pharmacological mouse models characterized by cognitive deficits.

We describe an immunohistochemistry protocol to study the profile of hippocampal neuron activation following exposure to a spatial learning task in a mouse model characterized by cognitive deficits of neurodevelopmental origin. This protocol can be applied to both genetic or pharmacological mouse models characterized by cognitive deficits.

Visualización inmunohistoquímico de hipocampo Neurona Actividad Después espacial aprendizaje en un modelo de ratón de los trastornos del desarrollo neurológico

Induction of phosphorylated extracellular-regulated kinase (pERK) is a reliable molecular readout of learning-dependent neuronal activation. Here, we ...

Protocol for Three-dimensional Confocal Morphometric Analysis of Astrocytes

As glial cells in the brain, astrocytes have diverse functional roles in the central nervous system. In the presence of harmful stimuli, astrocytes modify their functional and structural properties, a condition called reactive astrogliosis. Here, a protocol for assessment of the morphological properties of astrocytes is presented. This protocol includes quantification of 12 different parameters i.e. the surface area and volume of the tissue covered by an astrocyte (astrocyte territory), the entire astrocyte including branches, cell body, and nucleus, as well as total length and number of branches, the intensity of fluorescence immunoreactivity of antibodies used for astrocyte detection, and astrocyte density (number/1,000 &#181;m2). For this purpose three-dimensional (3D) confocal microscopic images were created, and 3D image analysis software such as Volocity 6.3 was used for measurements. Rat brain tissue exposed to amyloid beta1-40 (A&#946;1-40) with or without a therapeutic&#160;intervention was used to present the method. This protocol can also be used for 3D morphometric analysis of other cells from either in vivo or in vitro conditions.

Astrocytes in the CNS change their functional and structural properties in response to harmful stimuli. This report presents a protocol for assessment of three-dimensional astrocyte morphology in diseased conditions or after therapeutic interventions.

Protocolo para tridimensional confocal morfométrico Análisis de astrocitos

As glial cells in the brain, astrocytes have diverse functional roles in the central nervous system. In the presence of harmful stimuli, astrocytes modify ...

Tuning in the Hippocampal Theta Band In Vitro: Methodologies for Recording from the Isolated Rodent Septohippocampal Circuit

This protocol outlines the procedures for preparing and recording from the isolated whole hippocampus, of WT and transgenic mice, along with recent improvements in methodologies and applications for the study of theta oscillations. A simple characterization of the isolated hippocampal preparation is presented whereby the relationship between internal hippocampal theta oscillators is examined together with the activity of pyramidal cells, and GABAergic interneurons, of the cornu ammonis-1 (CA1) and subiculum (SUB) areas. Overall, we show that the isolated hippocampus is capable of generating intrinsic theta oscillations in vitro and that rhythmicity generated within the hippocampus can be precisely manipulated by optogenetic stimulation of parvalbumin-positive (PV) interneurons. The in vitro isolated hippocampal preparation offers a unique opportunity to use simultaneous field and intracellular patch-clamp recordings from visually-identified neurons to better understand the mechanisms underlying theta rhythm generation.

Tuning in the Hippocampal Theta Band In Vitro: Methodologies for Recording from the Isolated Rodent Septohippocampal Circuit

Here, we present a protocol for recording rhythmic neuronal network theta and gamma oscillations from an isolated whole hippocampal preparation. We describe the experimental steps from extraction of the hippocampus to details of field, unitary and whole-cell patch clamp recordings as well as optogenetic pacing of the theta rhythm.

Tuning en la banda Theta Hippocampal<em&gt; In Vitro</em&gt;: Metodologías para la grabación del circuito septohippocampal de roedores aislados

This protocol outlines the procedures for preparing and recording from the isolated whole hippocampus, of WT and transgenic mice, along with recent ...

In Utero Electroporation of Multiaddressable Genome-Integrating Color (MAGIC) Markers to Individualize Cortical Mouse Astrocytes

Protoplasmic astrocytes (PrA) located in the mouse cerebral cortex are tightly juxtaposed, forming an apparently continuous three-dimensional matrix at adult stages. Thus far, no immunostaining strategy can single them out and segment their morphology in mature animals and over the course of corticogenesis. Cortical PrA originate from progenitors located in the dorsal pallium and can easily be targeted using in utero electroporation of integrative vectors. A protocol is presented here to label these cells with the multiaddressable genome-integrating color (MAGIC) Markers strategy, which relies on piggyBac/Tol2 transposition and Cre/lox recombination to stochastically express distinct fluorescent proteins (blue, cyan, yellow, and red) addressed to specific subcellular compartments. This multicolor fate mapping strategy enables to mark in situ nearby cortical progenitors with combinations of color markers prior to the start of gliogenesis and to track their descendants, including astrocytes, from embryonic to adult stages at the individual cell level. Semi-sparse labeling achieved by adjusting the concentration of electroporated vectors and color contrasts provided by the Multiaddressable Genome-Integrating Color Markers (MAGIC Markers or MM) enable to individualize astrocytes and single out their territory and complex morphology despite their dense anatomical arrangement. Presented here is a comprehensive experimental workflow including the details of the electroporation procedure, multichannel image stacks acquisition by confocal microscopy, and computer-assisted three-dimensional segmentation that will enable the experimenter to assess individual PrA volume and morphology. In summary, electroporation of MAGIC Markers provides a convenient method to individually label numerous astrocytes and gain access to their anatomical features at different developmental stages. This technique will be useful to analyze cortical astrocyte morphological properties in various mouse models without resorting to complex crosses with transgenic reporter lines.

In Utero Electroporation of Multiaddressable Genome-Integrating Color MAGIC Markers to Individualize Cortical Mouse Astrocytes

Astrocytes tile the cerebral cortex uniformly, making the analysis of their complex morphology challenging at the cellular level. The protocol provided here uses multicolor labeling based on in utero electroporation to single out cortical astrocytes and analyze their volume and morphology with a user-friendly image analysis pipeline.

En Utero Electroporación de marcadores de color multiaconsejables integradores del genoma (MAGIC) para individualizar los astrocitos corticales del ratón

Protoplasmic astrocytes (PrA) located in the mouse cerebral cortex are tightly juxtaposed, forming an apparently continuous three-dimensional matrix at ...

Neuronal Differentiation from Mouse Embryonic Stem Cells In vitro

The neural differentiation of mouse embryonic stem cells (mESCs) is a potential tool for elucidating the key mechanisms involved in neurogenesis and potentially aid in regenerative medicine. Here, we established an efficient and low cost method for neuronal differentiation from mESCs in vitro, using the strategy of combinatorial screening. Under the conditions defined here, the 2-day embryoid body formation + 6-day retinoic acid induction protocol permits fast and efficient differentiation from mESCs into neural precursor cells (NPCs), as seen by the formation of well-stacked and neurite-like A2lox and 129 derivatives that are Nestin positive. The healthy state of embryoid bodies and the timepoint at which retinoic acid (RA) is applied, as well as the RA concentrations, are critical in the process. In the subsequent differentiation from NPCs into neurons, N2B27 medium II (supplemented by Neurobasal medium) could better support the long term maintenance and maturation of neuronal cells. The presented method is highly efficiency, low cost and easy to operate, and can be a powerful tool for neurobiology and developmental biology research.

Here, we established a low cost and easy to operate method that directs fast and efficient differentiation from embryonic stem cells into neurons. This method is suitable for popularization among laboratories and can be a useful tool for neurological research.

Diferenciación neuronal de las células madre embrionarias del ratón in vitro

The neural differentiation of mouse embryonic stem cells (mESCs) is a potential tool for elucidating the key mechanisms involved in neurogenesis and ...