R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.

Note: See Figure 1 for outline of protocol. Several steps and reagents in the protocol require safety measures (indicated with &#34;CAUTION&#34;). Consult material safety data sheets before use. All protocol steps are performed at RT unless other indicated.
1. Prepare Culture Media and Plates
<ol>
	<li>Prepare and sterilize by autoclaving 1 L purified water, 100 ml&#160;Super Optimal Broth (SOB; Table 1), 1 L Luria-Bertani broth (LB; Table 2...

<ol>
	<li>Hutchison, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutagenesis+at+a+specific+position+in+a+DNA+sequence.">Mutagenesis at a specific position in a DNA sequence.</a> J Biol Chem. 253 (18), 6551-6560 (1978).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Papworth, C., Bauer, J. C., Braman, J., Wright, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+mutagenesis+in+one+day+with+&gt;80%+efficiency.">Site-directed mutagenesis in one day with &gt;80% efficiency.</a> Strategies. 9 (3), 3-4 (1996).</li><li>Higuchi, R., Krummel, B., Saiki, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+of+in+vitro+preparation+and+specific+mutagenesis+of+DNA+fragments:+study+of+protein+and+DNA+interactions.">A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions.</a> Nucleic Acids Res. 16 (15), 7351-7367 (1988).</li><li>Rennell, D., Bouvier, S. E., Hardy, L. W., Poteete, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+mutation+of+bacteriophage+T4+lysozyme.">Systematic mutation of bacteriophage T4 lysozyme.</a> J Mol Biol. 222 (1), 67-88 (1991).</li><li>Markiewicz, P., Kleina, L. G., Cruz, C., Ehret, S., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIV.+Analysis+of+4000+altered+Escherichia+coli+lac+repressors+reveals+essential+and+non-essential+residues,+as+well+as+'spacers'+which+do+not+require+a+specific+sequence.">Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and non-essential residues, as well as 'spacers' which do not require a specific sequence.</a> J Mol Biol. 240 (5), 421-433 (1994).</li><li>Kleina, L. G., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIII.+Extensive+amino+acid+replacements+generated+by+the+use+of+natural+and+synthetic+nonsense+suppressors.">Genetic studies of the lac repressor. XIII. Extensive amino acid replacements generated by the use of natural and synthetic nonsense suppressors.</a> J Mol Biol. 212 (2), 295-318 (1990).</li><li>Huang, W., Petrosino, J., Hirsch, M., Shenkin, P. S., Palzkill, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amino+acid+sequence+determinants+of+beta-lactamase+structure+and+activity.">Amino acid sequence determinants of beta-lactamase structure and activity.</a> J Mol Biol. 258 (4), 688-703 (1996).</li><li>Fowler, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+mapping+of+protein+sequence-function+relationships.">High-resolution mapping of protein sequence-function relationships.</a> Nat Methods. 7 (9), 741-746 (2010).</li><li>Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+illumination+of+a+fitness+landscape.">Experimental illumination of a fitness landscape.</a> Proc Natl Acad Sci U S A. 108 (19), 7896-7901 (2011).</li><li>McLaughlin, R. N., Poelwijk, F. J., Raman, A., Gosal, W. S., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+spatial+architecture+of+protein+function+and+adaptation.">The spatial architecture of protein function and adaptation.</a> Nature. 491 (7422), 138-142 (2012).</li><li>Deng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+sequencing+of+systematic+combinatorial+libraries+reveals+beta-lactamase+sequence+constraints+at+high+resolution.">Deep sequencing of systematic combinatorial libraries reveals beta-lactamase sequence constraints at high resolution.</a> J Mol Biol. 424 (3-4), 150-167 (2012).</li><li>Stiffler, M. A., Hekstra, D. R., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolvability+as+a+Function+of+Purifying+Selection+in+TEM-1+beta-Lactamase.">Evolvability as a Function of Purifying Selection in TEM-1 beta-Lactamase.</a> Cell. 160 (5), 882-892 (2015).</li><li>Matagne, A., Lamotte-Brasseur, J., Frere, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Catalytic+properties+of+class+A+beta-lactamases:+efficiency+and+diversity.">Catalytic properties of class A beta-lactamases: efficiency and diversity.</a> Biochem J. 330 (Pt2), 581-598 (1998).</li><li>Salverda, M. L., De Visser, J. A., Barlow, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+evolution+of+TEM-1+beta-lactamase:+experimental+reconstruction+and+clinical+relevance.">Natural evolution of TEM-1 beta-lactamase: experimental reconstruction and clinical relevance.</a> FEMS Microbiol Rev. 34 (6), 1015-1036 (2010).</li><li>Weinreich, D. M., Delaney, N. F., Depristo, M. A., Hartl, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Darwinian+evolution+can+follow+only+very+few+mutational+paths+to+fitter+proteins.">Darwinian evolution can follow only very few mutational paths to fitter proteins.</a> Science. 312 (5770), 111-114 (2006).</li><li>Stewart, S. M., Fisher, M., Young, J. E., Lutz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+levels+in+sputum,+serum,+and+saliva.">Ampicillin levels in sputum, serum, and saliva.</a> Thorax. 25 (3), 304-311 (1970).</li><li>Giachetto, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+and+penicillin+concentration+in+serum+and+pleural+fluid+of+hospitalized+children+with+community-acquired+pneumonia.">Ampicillin and penicillin concentration in serum and pleural fluid of hospitalized children with community-acquired pneumonia.</a> Pediatr Infect Dis J. 23 (7), 625-629 (2004).</li><li>Ambler, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+numbering+scheme+for+the+class+A+beta-lactamases.">A standard numbering scheme for the class A beta-lactamases.</a> Biochem J. 276 (Pt 1), 269-270 (1991).</li><li>Magoc, T., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH:+fast+length+adjustment+of+short+reads+to+improve+genome+assemblies).">FLASH: fast length adjustment of short reads to improve genome assemblies).</a> Bioinformatics. 27 (21), 2957-2963 (2011).</li><li>Melamed, D., Young, D. L., Gamble, C. E., Miller, C. R., Fields, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+mutational+scanning+of+an+RRM+domain+of+the+Saccharomyces+cerevisiae+poly(A)-binding+protein.">Deep mutational scanning of an RRM domain of the Saccharomyces cerevisiae poly(A)-binding protein.</a> RNA. 19 (11), 1537-1551 (2013).</li><li>Bank, C., Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+survey+of+an+intragenic+epistatic+landscape.">A systematic survey of an intragenic epistatic landscape.</a> Mol Biol Evol. 32 (1), 229-238 (2015).</li><li>Dove, S. L., Joung, J. K., Hochschild, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+prokaryotic+transcription+through+arbitrary+protein-protein+contacts.">Activation of prokaryotic transcription through arbitrary protein-protein contacts.</a> Nature. 386 (6625), 627-630 (1997).</li><li>Romero, P. A., Tran, T. M., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+enzyme+function+with+microfluidic-based+deep+mutational+scanning.">Dissecting enzyme function with microfluidic-based deep mutational scanning.</a> Proc Natl Acad Sci U S A. 112 (23), 7159-7164 (2015).</li></ol>

The authors declare they have no competing financial interests

Here a protocol is described for performing the functional assessment of whole-protein saturation mutagenesis libraries, using high-throughput sequencing technology. An important aspect of the method is the use of orthogonal primers during the cloning process. Briefly, each amino acid position is randomized by mutagenic PCR, and mixed together into groups of positions whose combined sequence length is accommodated by high-throughput sequencing. These groups are cloned into plasmid vectors containing pairs of orthogonal p...

Mutagenesis has long been employed in the laboratory to study the properties of biological systems and their evolution, and to produce mutant proteins or organisms with enhanced or novel functions. While early approaches relied on methods which produce random mutations in organisms, the advent of recombinant DNA technology enabled researchers to introduce select changes to DNA in a site-specific manner, i.e., site-directed mutagenesis1,2. With current techniques, typically using mutagenic oligonucleotides in a polymerase chain reaction (PCR), it is relatively facile to create and assess small numbers of mutations (e.g., point mutations) in a given gene3,4. It is far more difficult however when the goal approaches, for example, the creation and assessment of all possible single-site (or higher-order) mutations.
While much has been learned from early studies attempting to assess large numbers of mutations in genes, the techniques used were often laborious, for example requiring the assessment of each mutation independently using nonsense suppressor strains5-7, or were limited in their quantitative ability due to the low sequencing depth of Sanger sequencing8. The techniques used in these studies have largely been supplanted by methods utilizing high-throughput sequencing technology9-12. These conceptually simple approaches entail creating a library comprising a large number of mutations, subjecting the library to a screen or selection for function, and then deep-sequencing (i.e., on the order of &#62;106 sequencing reads) the library obtained before and after selection. In this way, the phenotypic or fitness effects of a large number of mutations, represented as the change in population frequency of each mutant, can be assessed simultaneously and more quantitatively.
We previously introduced a simple approach for assessing libraries of all possible single amino acid mutations in proteins (i.e., whole-protein saturation mutagenesis libraries), applicable to genes with a length longer than the sequencing read length11,13: First, each amino acid position is randomized by site-directed mutagenic PCR. During this process, the gene is split into groups composed of contiguous positions with a total length accommodated by the sequencing platform. The mutagenic PCR products for each group are then combined, and each group independently subjected to selection and high-throughput sequencing. By maintaining a correspondence between the location of mutations in the sequence and the sequencing read length, this approach has the advantage of maximizing sequencing depth: while one could simply sequence such libraries in short windows without splitting into groups (e.g., by a standard shotgun sequencing approach), most reads obtained would be wild-type and thus the majority of sequencing throughput wasted (e.g., for a whole-protein saturation mutagenesis library of a 500 amino acid protein sequenced in 100 amino acid (300 bp) windows, at minimum 80% of reads will be the wild-type sequence).
Here, a protocol is presented which utilizes high-throughput sequencing for the functional assessment of whole-protein saturation mutagenesis libraries, using the above approach (outlined in Figure 1). Importantly, we introduce the usage of orthogonal primers in the library cloning process to barcode each sequence group, which allows them to be multiplexed into one library, subjected simultaneously to screening or selection, and then de-multiplexed for deep sequencing. Since the sequence groups are not subjected to selection independently, this reduces the workload and ensures that each mutation experiences the same level of selection. TEM-1 &#946;-lactamase, an enzyme which confers high-level resistance to &#946;-lactam antibiotics (e.g., ampicillin) in bacteria is used as a model system14-16. A protocol is described for the assessment of a whole-protein saturation mutagenesis library of TEM-1 in E. coli under selection at an approximate serum level for a clinical dose of ampicillin (50 &#181;g/ml)17,18.

<table border="0" cellpadding="0" cellspacing="0" width="1073">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Typtone</td>
			<td style="width:259px;">Research Products Intl. Corp.</td>
			<td style="width:271px;">T60060-1000.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Yeast extract</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">Y20020-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Sodium chloride</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP358-212</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Potassium chloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">P9333-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Magnesium sulfate</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">M7506-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agar</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP1423-500</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Tetracycline hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">T7660-5G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">petri plates</td>
			<td>Corning</td>
			<td style="width:271px;">351029</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MATLAB&#160;</td>
			<td>Mathworks</td>
			<td style="width:271px;">http://www.mathworks.com/products/matlab/</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Oligonucleotide primers</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:271px;">https://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos</td>
			<td style="width:271px;">25 nmol scale, standard desalting</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_AvrII</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">pBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_OP1 &#8211; pBR322_OP5</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">five modified pBR322 plasmids each containing a pair of orthogonal priming sites</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Q5 high-fidelity DNA polymerase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0491L</td>
			<td style="width:271px;">includes 5X PCR buffer and PCR additive (GC enhancer)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">15 mL conical tube</td>
			<td>Corning</td>
			<td style="width:271px;">430025</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Multichannel pipettes (Eppendorf ResearchPlus)</td>
			<td>Eppendorf</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">PCR plate, 96 well</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">14230232</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">96 well plate seal</td>
			<td>Excel Scientific</td>
			<td style="width:271px;">F-96-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Veriti 96-well thermal cycler</td>
			<td>Applied Biosystems</td>
			<td style="width:271px;">4375786</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">6X gel loading dye</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">B7024S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">20090-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ethidium bromide</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">161-0433</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">UV transilluminator (FOTO/Analyst ImageTech)</td>
			<td>Fotodyne Inc.</td>
			<td style="width:271px;">http://www.fotodyne.com/content/ImageTech_gel_documentation</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EB buffer</td>
			<td>Qiagen</td>
			<td style="width:271px;">19086</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">96-well black-walled, clear bottom assay plates</td>
			<td>Corning</td>
			<td style="width:271px;">3651</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Lambda phage DNA</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">N3011S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">PicoGreen dsDNA reagent</td>
			<td>Invitrogen</td>
			<td style="width:271px;">P7581</td>
			<td style="width:271px;">dsDNA quantitation reagent, used in protocol step 2.2.4</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Victor 3V microplate reader</td>
			<td>PerkinElmer</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">DNA purification kit</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Microcentrifuge tubes</td>
			<td>Corning</td>
			<td style="width:271px;">3621</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Long-wavelength UV illuminator</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">FBUVLS-80</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose gel DNA extraction buffer</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4001-1-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AatII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0117S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AvrII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0174L</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0202S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EVB100 electrocompetent E. coli</td>
			<td>Avidity</td>
			<td style="width:271px;">EVB100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporator (E. coli Pulser)</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">1652102</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporation cuvettes</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">165-2089</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Spectrophotometer (Ultrospec 3100 pro)</td>
			<td>Amersham Biosciences</td>
			<td style="width:271px;">80211237</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">50 mL conical tubes</td>
			<td>Corning</td>
			<td style="width:271px;">430828</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plasmid purification kit</td>
			<td>Macherey-Nagel</td>
			<td style="width:271px;">740588.25</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">8 well PCR strip tubes</td>
			<td>Axygen</td>
			<td style="width:271px;">321-10-551</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit dsDNA HS assay kit</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32854</td>
			<td style="width:271px;">dsDNA quantitation reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit assay tubes</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32856</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit fluorometer</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32866</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ampicillin sodium salt</td>
			<td>Akron Biotechnology</td>
			<td style="width:271px;">50824296</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">MiSeq reagent kit v2 (500 cycles)</td>
			<td>Illumina</td>
			<td style="width:271px;">MS-102-2003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MiSeq desktop sequencer</td>
			<td>Illumina</td>
			<td style="width:271px;">http://www.illumina.com/systems/miseq.html</td>
			<td style="width:271px;">alternatively, one could sequence on Illumina HiSeq platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">FLASh software</td>
			<td>John Hopkins University - open source</td>
			<td style="width:271px;">http://ccb.jhu.edu/software/FLASH/</td>
			<td style="width:271px;">software to merge paired-end reads from next-generation sequencing data</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GATAATAATGGTTTCTTAGACGTCAGGTGGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCACCTAGGTCCTTTTAAATTAAAAATGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCATTTTTAATTTAAAAGGACCTAGGTGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGTATTTCAACTGTCCGGTCTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGCTCACGGAGTGTACTAATTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTACGTCTGAACTTGGGACTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCCGTTCTCGATACCAAGTGATAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTCCGTCGGAGTAACAATCTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GACCGGACAGTTGAAATACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CGACGTACAGGACAATTTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ATTAGTACACTCCGTGAGCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTATTAGGCGTCAAGGTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTCCCAAGTTCAGACGTAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GAAAAGTCCCAATGAGTGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TCACTTGGTATCGAGAACGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATCACGGAAGGACTCAACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGATTGTTACTCCGACGGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATAACAGGCTGCTGAGACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCATTTTGCCTACCGGTTTTTGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCTTGCCCGGCGTCAAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGAACGTTTTCCAATGATGAGCAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGTCCTCCGATCGTTGTCAGAAG</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGTAAGAGAATTATGCAGTGCTGCC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCGCCAGTTAATAGTTTGCGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCCAAACGACGAGCGTGACAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGCAATGATACCGCGAGACCC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCGGCTGGCTGGTTTATTGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTATATGAGTAAACTTGGTCTGACAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">501_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">502_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">503_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">504_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">505_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">701_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">702_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTG</td>
		</tr>
	</tbody>
</table>

a protocol for functional assessment of whole-protein saturation mutagenesis libraries utilizing high-throughput sequencing

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 &#946;-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to &#946;-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

The plasmid map for the five modified pBR322 plasmids containing orthogonal priming sites (pBR322_OP1 - pBR322_OP5) is shown in Figure 2A. To test whether the orthogonal primers are specific, PCRs were performed using each pair of orthogonal primers individually, along with all five pBR322_OP1-5 plasmids, or with all plasmids minus the plasmid matching the orthogonal primer pair. The correct product was only obtained when the matching plasmid was included, and no product ...

Watch this Scientific Journal Video about A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing at JoVE.com

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

We present a protocol for the functional assessment of comprehensive single-site saturation mutagenesis libraries of proteins utilizing high-throughput sequencing. Importantly, this approach uses orthogonal primer pairs to multiplex library construction and sequencing. Representative results using TEM-1 &#946;-lactamase selected at a clinically relevant dosage of ampicillin are provided.

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel ...

The overall goal of this protocol is to describe the functional assessment of comprehensive, single-site saturation mutagenesis libraries of proteins, utilizing high-throughput sequencing. This method can help answer key questions in the fields of biochemistry and molecular evolution. Such as, what are the biochemical structural and evolutionary constraints on proteins?And how can we engineer proteins with novel functions? The main advantage of this technique is that it maximizes a number of useful sequencing reads in a whole-protein saturation mutagenesis study, by mulitplexing library construction and sequencing. After preparing a plate of PCR Master Mix according to the text's protocol, use a multi-channel pipette to transfer 10 microliters from the 96-well plates containing the previously diluted sense mutagenesis primers to the cognate wells in the PCR plates.Use a plate seal to cover each PCR plate, and centrifuge at 200 Gs for two minutes. Then, transfer the PCR plates to a thermocycler, and run the following program. After carrying out additional PCR and diluting the reactions, one to 100, transfer one microliter from the mixed and diluted first-round mutagenic PCR products, to the cognate wells of new PCR plates containing Master Mix.Use a plate seal to cover each PCR plate. Centrifuge the plates at approximately 200 Gs for two minutes. Then transfer the plates to the thermocycler, and run the same program listed earlier in the video.After verifying the PCR product sizes, and measuring the concentrations according to the text protocol, mix 100 nanograms of each NNS sublibrary PCR product into five NNS sublibrary groups. After running sublibrary PCR reactions and digesting cloning vectors in the PCR reactions, according to the text protocol, set up ligation reactions following these guidelines for each digested NNS sublibrary group, with its cognate restriction digested cloning vector. Then, incubate at room temperature for one hour.Once electrocompetent E.coli cells have been thawed, add ten microliters of cells to each purified ligation reaction, and transfer to an electroproration cuvette. Electroprorate the cells at 1.8 kilovolts, then add one milliliter of SOB medium and incubate at 37 degrees celsius for one hour. Then, re-suspend 10 microliters of each recovery culture in 990 microliters of LB.And spread 100 microliters on LB auger plates containing 12 micrograms per milliliter of tetracycline.Per each recovery culture, prepare a 250-milliliter culture flask with 50 milliliters of LB and 50 microliters of tet-stock. Transfer the remaining approximately one milliliter of recovery culture to a flask. Incubate at 37 degrees celsius and 200 rpm overnight.After counting the number of successful transformants on the plates, and isolating the plasma DNA from the overnight cultures, mix together 100 nanograms of each plasmid. After transforming the DNA library according to the text protocol, dilute the library overnight culture to an OD-600 equal to 0.1. And add one milliliter to one flask.Incubate the pre-selection culture at 37 degrees celsius and 200 RPM. Periodically monitor the growth by measuring the OD-600, until it equals 0.1. Transfer 100 milliliters of the pre-selection culture to two 50-milliliter conical tubes, and centrifuge at 4, 000 Gs for six minutes, at four degrees celsius.Remove most of the supernatant and combine the pellets into a single, 15-milliliter conical tube. Then, after repeating the centrifugation, remove all the supernatant. To the other two flasks, add tetracycline to a final concentration of 12 micrograms per milliliter.And a volume of the pre-selection culture, such that the final OD-600 equals 0.001. To one flask, add one milliliter of 50 milligrams per milliliter Ampicillin at a final concentration of 50 micrograms per milliliter. This is the selection culture.While incubating the cultures at 37 degrees celsius in 200 RPM, monitor the growth of the culture containing no Ampicillin until it reaches an OD-600 equal to 0.1. Also measure the OD-600 of the selection culture. After dividing the OD-600 of the selection culture into 0.1, and multiplying by 100, transfer this volume to 50-milliliter conical tubes, and centrifuge at 4, 000 Gs and four degrees celsius for six minutes.After removing most of the supernatant, combine the pellets into a single tube before spinning again and removing all the supernatant. To carry out high-throughput sequencing, prepare a PCR Master Mix and transfer 23 microliters to 10 PCR tubes. Add one microliter of 0.5 nanograms per microliter of purified plasmid DNA from the pre-selection culture to tubes one through five.And from the selection culture to tubes six through 10. Mix together 50 microliters of 50 micromolar forward-orthogonal primers, OP1F to OP5F, with the respective reverse-orthogonal primers, OP1R to OP5R. In the same order, transfer one microliter to PCR tubes one through five, and six through 10.Transfer the PCR tubes to the thermocycler, and run the following program. Then, dilute the PCR reactions 100-fold, by transferring one microliter from each tube to 99 microliters of water. Mix well, then pipette 99 microliters from the tubes, and discard.Mix together 50 microliters of the forward, and respective reverse, primers. Then, transfer one microliter to the PCR tubes one through five, and six through 10. Then, after preparing a PCR Master Mix, add 23 microliters to each PCR tube, and run the following program.To carry out the final PCRs to add indexing sequences, after diluting the PCR reactions 100-fold, as before, and keeping one microliter, add 23 microliters of the PCR Master Mix. For tubes with template originating from NNS sublibrary groups one through five, add 0.5 microliters of forward primers 501F to 505F, respectively. For tubes with template resulting from the pre-selection and selection cultures, add 0.5 microliters of reverse primers 701R and 702R.Run the same PCR program as just indicated. Then, after measuring the concentrations of each reaction according to the text protocol, mix 100 nanograms of each PCR product into a single micro-centrifuge tube. After adding 6X gel loading dye, load the entire, combined PCR sample onto a two percent agarose gel.And run the gel at 100 volts, for 50 minutes. Using a long-wavelength UV illuminator, visualize, then excise the slice containing the PCR product of approximately 360 base pairs. Purify, sequence, and analyze the sample according to the text protocol.The plasmid map for the five modified pBR322 plasmids containing orthogonal priming sites is shown here. Testing for the specificity of the orthogonal primers using PCR, showed that the correct PCR product was only obtained when the matching plasmid was included in the reaction. And no product of any size was obtained in its absence.Following the processing of an experiment, 6.2 times 10 to the sixth reads from the pre-selection condition, and 6.3 times 10 to the sixth reads from the ampicillin condition were obtained. The counts for each amino acid mutation from the pre-selection condition display a log-normal distribution. This figure depicts the relative fitness effect, FIA, for each mutation at each position of TEM-one.And its distribution is shown here. Under selection at 50 micrograms per milliliter ampicillin, most mutations have a neutral, or nearly neutral, fitness effect. Corresponding to the white pixels here, and the large peak here.A small fraction of mutations at this antibiotic concentration have substantial effects on fitness. As expected, these include mutations within the highly-conserved active site residues. In contrast, few pixels appear as significantly red.Once mastered, this technique can be done in approximately a week. If it is performed properly, and all reagents are available. While attempting this procedure, it's important to remember to stay organized during cloning to combine the mutagenic PCR products into the correct groups, and to clone into correct vectors.And during sequencing preparation, to use the correct primers. Extending from this procedure, the main steps of the protocol could be modified to examine mutation combinations, different selection environments, and other protein systems, in order to answer additional questions concerning the genetic and environmental context-dependence of mutations. After watching this video, you should have a good understanding of the work required to construct a whole-protein saturation mutagenesis library, and to assess the functional effects of each mutation simultaneously, using high-throughput sequencing.Don't forget that working with ethidium bromide and ultraviolet light can be hazardous and precautions such as gloves, lab coat, and UV shield should always be taken while performing parts of this protocol.

a-protocol-for-functional-assessment-whole-protein-saturation

Research

JoVE Journal

Biology

10.7K vistas.  University of Texas Southwestern Medical Center. The overall goal of this protocol is to describe the functional assessment of comprehensive, single-site saturation mutagenesis libraries of proteins, utilizing high-throughput sequencing. This method can help answer key questions in the fields of biochemistry and molecular evolution. Such as, what are the biochemical structural and evolutionary constraints on proteins?And how can we engineer proteins with novel functions? The main advantage of this technique is that it maximizes a num...