Damos las gracias a Ron Davis, Deutschbauer Adán, y el laboratorio de HIP HOP todo en la Universidad de Toronto para el debate y asesoramiento. CN es apoyado por becas de la National Human Genome Research Institute (número de concesión HG000205), RO1 HG003317, CIHR MOP-84305, y la Sociedad Canadiense del Cáncer (# 020380). JO fue apoyada por el Programa de Entrenamiento de Stanford Genome (número de concesión T32 HG00044 de la National Human Genome Research Institute) y los Institutos Nacionales de Salud (número de concesión P01 GH000205). GG es apoyado por el NHGRI HG003317 SR1 y la Sociedad Canadiense del Cáncer, subvención n º 020380, TD y el Centro de Secuenciación Donnelly es apoyado en parte por subvenciones de la Fundación Canadiense para la Innovación a los Dres. Brenda Andrews y Greenblatt Jack. AMS es apoyado por una beca de la Universidad de Toronto en Abrir.

<ol>
	<li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+profiling+of+the+Saccharomyces+cerevisiae+genome.">Functional profiling of the Saccharomyces cerevisiae genome.</a> Nature. 418, 387-391 (2002).</li><li>Baba, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Molecular systems biology. 2, 2006.0008-2006.0008 (2006).</li><li>Claus, H., Frosch, M., Vogel, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+hotspot+for+transformation+of+Neisseria+meningitidis+by+shuttle+mutagenesis+using+signature-tagged+transposons.">Identification of a hotspot for transformation of Neisseria meningitidis by shuttle mutagenesis using signature-tagged transposons.</a> Mol Gen Genet. 259, 363-371 (1998).</li><li>Hava, D. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+identification+of+serotype+4+Streptococcus+pneumoniae+virulence+factors.">Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors.</a> Molecular microbiology. 45, 1389-1406 (2002).</li><li>Costanzo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genetic+Landscape+of+a+Cell.">The Genetic Landscape of a Cell.</a> Science. 327, 425-431 (2010).</li><li>Tong, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Pan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+toolkit+for+functional+profiling+of+the+yeast+genome.">A robust toolkit for functional profiling of the yeast genome.</a> Molecular cell. 16, 487-496 (2004).</li><li>Schuldiner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+Function+and+Organization+of+the+Yeast+Early+Secretory+Pathway+through+an+Epistatic+Miniarray+Profile.">Exploration of the Function and Organization of the Yeast Early Secretory Pathway through an Epistatic Miniarray Profile.</a> Cell. 123, 507-519 (2005).</li><li>Deutschbauer, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+haploinsufficiency+revealed+by+genome-wide+profiling+in+yeast.">Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast.</a> Genetics. 169, 1915-1925 (2005).</li><li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemogenomic+profiling:+identifying+the+functional+interactions+of+small+molecules+in+yeast.">Chemogenomic profiling: identifying the functional interactions of small molecules in yeast.</a> Proceedings of the National Academy of Sciences of the United States of America. 101, 793-798 (2004).</li><li>Lum, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovering+modes+of+action+for+therapeutic+compounds+using+a+genome-wide+screen+of+yeast+heterozygotes.">Discovering modes of action for therapeutic compounds using a genome-wide screen of yeast heterozygotes.</a> Cell. 116, 121-137 (2004).</li><li>Hillenmeyer, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+universal+TagModule+collection+for+parallel+genetic+analysis+of+microorganisms.">A universal TagModule collection for parallel genetic analysis of microorganisms.</a> Nucleic acids research. 38, e146-e146 (2010).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+annotation+and+drug+target+discovery+in+Candida+albicans+with+a+tagged+transposon+mutant+collection.">Gene annotation and drug target discovery in Candida albicans with a tagged transposon mutant collection.</a> PLoS pathogens. 6, (2010).</li><li>Nislow, C., Giaever, G., Stark, I., Stansfields, M. J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+387.">Chapter 387.</a> Yeast Gene Analysis. , 387-414 (2007).</li><li>Pierce, S. E., Davis, R. W., Nislow, C., Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+barcoded+Saccharomyces+cerevisiae+gene-deletion+mutants+in+pooled+cultures.">Genome-wide analysis of barcoded Saccharomyces cerevisiae gene-deletion mutants in pooled cultures.</a> Nature protocols. 2, 2958-2974 (2007).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2001).</li><li>Smith, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+phenotyping+via+deep+barcode+sequencing.">Quantitative phenotyping via deep barcode sequencing.</a> Genome Res. , (2009).</li><li>Hamady, M., Walker, J. J., Harris, J. K., Gold, N. J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Error-correcting+barcoded+primers+for+pyrosequencing+hundreds+of+samples+in+multiplex.">Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex.</a> Nature. 5, 235-237 (2008).</li><li>Gresham, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=System-Level+Analysis+of+Genes+and+Functions+Affecting+Survival+During+Nutrient+Starvation+in+Saccharomyces+cerevisiae.">System-Level Analysis of Genes and Functions Affecting Survival During Nutrient Starvation in Saccharomyces cerevisiae.</a> Genetics. 187, 299-317 (2011).</li></ol>

No hay conflictos de interés declarado.

En este sentido, se indica un protocolo que, con la modificación de modesto, se puede adaptar fácilmente a una amplia gama de las colecciones existentes de código de barras colecciones de mutantes de microorganismos diferentes para crear colecciones de mutantes marcados. Hacemos hincapié en que, si bien nos han informado de un protocolo sobre la mutagénesis de transposones etiquetados para el patógenos levadura C. albicans, un protocolo muy similar podría ser adaptado a una amplia variedad de hongos unicelulares. Modificado, este protocolo funciona muy bien en las bacterias 13, y en la actualidad las colecciones de un número adicional de genomas de hongos y bacterias se encuentran en construcción. En la actualidad, este ensayo proporciona la única completa de todo el genoma de pantalla imparcial de las interacciones gen-molécula pequeña. Una característica particularmente atractiva de este ensayo es que ningún conocimiento previo del gen o una molécula pequeña es necesaria. A pesar del alcance y el poder de estos ensayos, que se puedan transferir a otros laboratorios se ha visto obstaculizada tanto por la inversión de capital inicial y las herramientas informáticas para el análisis de los resultados. Con la adopción de una lectura de la generación siguiente secuencia en combinación con potentes herramientas para el análisis, se espera su aprobación para aumentar.

<table border="1"><tbody><tr><td> Antibióticos </td><td> Proveedor y números de catálogo </td></tr><tr><td> Carbenicilina </td><td> Sigma, parte # C1613 </td></tr><tr><td> Kanamicina </td><td> Sigma, parte # K1876 </td></tr><tr><td> espectinomicina </td><td> Sigma, parte # S0692 </td></tr><tr><td> Cloranfenicol </td><td> Sigma, parte # C0378 </td></tr><tr><td> ADN de limpieza y kits de concentración </td><td></td></tr><tr><td> QIAprep Spin Miniprep Kit </td><td> Qiagen, parte # 27106 </td></tr><tr><td> Kit Hi-Speed ​​Maxi plásmido </td><td> Qiagen, parte # 12663 </td></tr><tr><td> QIAquick PCR kit de purificación </td><td> Qiagen, parte # 28106 </td></tr><tr><td> QIAquick Gel Extraction Kit </td><td> Qiagen, parte # 28704 </td></tr><tr><td> PCR y los reactivos de electroforesis </td><td></td></tr><tr><td> Taq ADN polimerasa (Mg libre) Buffer </td><td> New England Biolabs, parte # M0320L </td></tr><tr><td> Mezcle la solución desoxinucleótidos </td><td> New England Biolabs, parte # N0447L </td></tr><tr><td> 25 mM MgCl 2 </td><td> Sigma, parte # 63036 </td></tr><tr><td> Agarosa, colorante de carga, y el ácido nucleico mancha adecuada para electroforesis en gel </td><td> Varios </td></tr><tr><td> 10X tampón TAE </td><td> Sigma, parte # T8280 </td></tr><tr><td> Más de 1 Kb DNA Ladder </td><td> Invitrogen, parte # 10787026 </td></tr><tr><td> YPD caldo </td><td></td></tr><tr><td> 10 g de extracto de levadura </td><td> Sigma, parte # Y1625 </td></tr><tr><td> 20 g de Bacto peptona </td><td> BD Biosciences, parte # 211677 </td></tr><tr><td> 20 g de dextrosa </td><td> Sigma, parte # D9434 </td></tr><tr><td> Material de laboratorio </td><td></td></tr><tr><td> Pipetas multicanal (1000, 200, y el l 20) </td><td> Varios </td></tr><tr><td> Depósitos desechables pipeteo </td><td> Varios </td></tr><tr><td> 15 y 50 tubos de centrifugación ml </td><td> Varios </td></tr><tr><td> 96 - y 384-Pozo Profundo placas </td><td> Axygen Scientific, parte # P-2ML-SQ-CS &amp; P 384240SQCS- </td></tr><tr><td> 96 y 384 así-PCR placas y película de sellado </td><td> Varios </td></tr><tr><td> Compactador para el sellado de varias placas </td><td> Sigma, parte # R1275 </td></tr><tr><td> 30 ° C y 37 ° C agitando incubadoras para el cultivo de bacterias y levaduras en las placas y tubos </td><td> Varios </td></tr><tr><td> Transposón mutagénesis in vitro </td><td></td></tr><tr><td> EZ-Tn5 transposasa </td><td> Epicentro biotecnologías, parte # TNP92110 </td></tr><tr><td> De alto rendimiento de la transformación </td><td></td></tr><tr><td> Seqprep 96 HT Kit de Preparación plásmido </td><td> Borde Biosystems, part # 84359 </td></tr><tr><td> polietilenglicol, peso molecular 3350 </td><td> Varios </td></tr><tr><td> acetato de litio </td><td> Sigma, parte # 517992 </td></tr><tr><td> Placas de 6 pocillos, estériles </td><td> Corning, parte # 3335 </td></tr><tr><td> 50 mg / ml uridina </td><td> Sigma, parte # U3750 </td></tr><tr><td> 100X Tris-EDTA solución </td><td> Sigma, parte # T9285 </td></tr><tr><td> 1X TE/0.1M LiOAc </td><td> Varios </td></tr><tr><td> salmón testículos ADN </td><td> Sigma, parte # 1626 </td></tr><tr><td> El crecimiento de las colecciones de código de barras </td><td></td></tr><tr><td> 48 placas, y si en las placas de crecimiento de cultivos </td><td> Greiner, parte # M9437 </td></tr><tr><td> Sellos adhesivos placa </td><td> ABgene, parte # AB-0580 </td></tr><tr><td> 200 ml frascos de cultivo </td><td> Varios </td></tr><tr><td> Espectrofotómetro capaz de absorbancia </td><td> Varios </td></tr><tr><td> Con control de temperatura agitador de matraces de 250 ml o espectrofotómetro temblor </td><td> Varios </td></tr><tr><td> Safe-Lock Microcentrífuga tubo, 2 mL </td><td> Eppendorf, parte # 0030 120.094 </td></tr><tr><td> Hibridación equipo </td><td></td></tr><tr><td> Horno de hibridación 640 </td><td> Affymetrix, parte # 800138 </td></tr><tr><td> GeneChip neumático Estación 450 </td><td> Affymetrix, pieza # 00-0079 </td></tr><tr><td> GeneArray Scanner 3000 </td><td> Affymetrix, pieza # 00-0212 </td></tr><tr><td> Baño de agua hirviendo con bastidor flotante </td><td> Varios </td></tr><tr><td> Consumibles de hibridación </td><td></td></tr><tr><td> Genflex etiqueta 16K matriz v2 </td><td> Affymetrix, parte # 511331 </td></tr><tr><td> Solución de Denhardt, concentrado 50 veces </td><td> Sigma, parte # D2532 </td></tr><tr><td> Estreptavidina, R-ficoeritrina conjugado (SAPE) </td><td> Invitrogen, parte # S866 </td></tr><tr><td> Safe-Lock Microcentrífuga tubos de 0,5 mL </td><td> Eppendorf, parte # 0030 123.301 </td></tr><tr><td> Teeny Tough-Spots </td><td> Diversificación de la biotecnología, parte # LTTM-1000 </td></tr><tr><td> EDTA 0,5 M </td><td> BioRad, part # 161-0729 </td></tr><tr><td> 10% de Tween </td><td> Sigma, parte # T2700 </td></tr><tr><td> MES monohidrato de ácido libre </td><td> Sigma, parte # M5287 </td></tr><tr><td> MES sal de sodio </td><td> Sigma, parte # M5057 </td></tr><tr><td> 5 M NaCl </td><td> Sigma, parte # 71386 </td></tr><tr><td> 20X PEES </td><td> Sigma, parte # S2015 </td></tr><tr><td> La biología molecular del agua de grado </td><td> Sigma, parte # W4502 </td></tr><tr><td> Primers hibridación </td><td> Varios proveedores (desalación estándar) </td></tr><tr><td> Uptag </td><td> 5 &#39;GATGTCCACGAGGTCTCT 3&#39; </td></tr><tr><td> Buptagkanmx4 </td><td> 5 &#39;con biotina GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntag </td><td> 5 &#39;CGGTGTCGGTCTCGTAG 3&#39; </td></tr><tr><td> Bdntagkanmx4 </td><td> 5 &#39;con biotina GAAAACGAGCTCGAATTCATCG 3&#39; </td></tr><tr><td> B213 </td><td> 5 &#39;con biotina CTGAACGGTAGCATCTTGAC 3&#39; </td></tr><tr><td> Uptagkanmx </td><td> 5 &#39;GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntagkanmx </td><td> 5&#39;GAAAACGAGCTCGAATTCATCG 3 &#39; </td></tr><tr><td> Uptagcomp </td><td> 5&#39;AGAGACCTCGTGGACATC 3 &#39; </td></tr><tr><td> Dntagcomp </td><td> 5&#39;CTACGAGACCGACACCG 3 &#39; </td></tr><tr><td> Upkancomp </td><td> 5&#39;CGTACGCTGCAGGTCGAC 3 &#39; </td></tr><tr><td> Dnkancomp </td><td> 5&#39;CGATGAATTCGAGCTCGTTTTC 3 &#39; </td></tr><tr><td> Secuenciación Primers: Plataforma Illumina </td><td> Varios proveedores </td></tr><tr><td> UpTag Adelante (100um) </td><td> 5 &#39;AAC GCA GAA GAC GGC ATA CGA GCT CTT CCG ATC GAT T GTC CAC GAG GTC TCT 3&#39; </td></tr><tr><td> UpTag inversa (100um) </td><td> 5 &#39;AAT GAT ACG GCG ACC ACC GAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T NNNNN GTC CAG CAG CTG CGT ACG 3&#39; </td></tr><tr><td> DownTag Adelante (100um) </td><td> 5 &#39;AAC GCA GAA GAC GGC ATA CGA GCT CTT CCG ATC T AAC GAA GAG CTC GAA TTC ATC G 3&#39; </td></tr><tr><td> DownTag inversa (100um) </td><td> 5 &#39;AAT GAT ACG GCG ACC ACC GAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T NNNNN CGG TGT TCT CGG CGT AG 3&#39; </td></tr><tr><td> Leer 1 UP-tag siguientes cebadores (100um) </td><td> 5 &#39;GTC CAG CAG CTG CGT ACG 3&#39; </td></tr><tr><td> Leer 1 ABAJO-tag imprimación siguientes (100um) </td><td> 5 &#39;TGT CGG CGG CGT TCT AG 3&#39; </td></tr><tr><td> Lea 2 cebador de secuenciación Índice (de serie Illumina imprimación R1) (100um) </td><td> 5 &#39;AC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T 3&#39; </td></tr><tr><td> Reactivos adicionales Secuenciación / Equipo </td><td></td></tr><tr><td> Qiagen MinElute 96 UF Kit de purificación de PCR </td><td> Qiagen, parte # 29051 </td></tr><tr><td> Bomba de vacío </td><td> Cualquier proveedor </td></tr><tr><td> Macherey-Nagel vacío en el colector </td><td> Macherey-Nagel, parte # 740 681 </td></tr><tr><td> Invitrogen Quant-iT dsDNA BR Kit de ensayo </td><td> Invitrogen, parte # Q32853 </td></tr><tr><td> Invitrogen Qubit tubos de ensayo </td><td> Invitrogen, parte # Q32856 </td></tr><tr><td> 40% de acrilamida y 1% de N, N&#39;-metilen-bis-acrilamida, 37.5:1 </td><td> Bio Rad, part # 161-0148 </td></tr><tr><td> Tris Base </td><td> Sigma, parte # T1503-1kg </td></tr><tr><td> Ácido bórico </td><td> Sigma, parte # B6768-500G </td></tr><tr><td> 0,5 M EDTA, pH 8,0 </td><td> Teknova, parte # E0306 </td></tr><tr><td> Persulfato de amonio </td><td> Sigma, parte # A3678-25G </td></tr><tr><td> TEMED </td><td> Bioshop, parte # TEM001.25 </td></tr><tr><td> Solución de bromuro de etidio </td><td> Bioshop, parte # ETB444.10 </td></tr><tr><td> Acetato de amonio 0,5 M </td><td> Teknova, parte # A2000 </td></tr><tr><td> 10 mM de acetato de magnesio tetrahidratado </td><td> Sigma, parte # M0631-100G </td></tr><tr><td> 1 mM EDTA, pH 8,0 </td><td> Ver 0,5 M EDTA, pH 8,0 </td></tr><tr><td> Etanol </td><td> Varios </td></tr><tr><td> Acetato de sodio, pH 5,2 </td><td> Teknova, parte # S0297 </td></tr><tr><td> Velocidad de vacío </td><td> Varios </td></tr><tr><td> Lea solo racimo kit de generación de </td><td> Illumina, parte # GD-300-1001 </td></tr><tr><td> 36c Secuenciación Kit v4 </td><td>Illumina, parte # FC-104-4002 </td></tr><tr><td></td><td></td></tr></tbody></table> Receta de TBE 10X <table border="1"><tbody><tr><td> Cantidades </td><td> Reactivos </td></tr><tr><td> 108 gramos </td><td> Tris Base </td></tr><tr><td> 55 gramos </td><td> Ácido bórico </td></tr><tr><td> 40 ml </td><td> 0,5 M EDTA (pH 8,0) </td></tr><tr><td colspan="2"> Añadir dH 2 O a 1 litro marca </td></tr></tbody></table> 12% de poliacrilamida gel receta <table border="1"><tbody><tr><td> Volúmenes </td><td> Reactivos </td></tr><tr><td> 5,8 ml </td><td> 40% de acrilamida y 1% de N, N&#39;-metilen-bis-acrilamida, 37.5:1 </td></tr><tr><td> 12 ml </td><td> dH 2 O </td></tr><tr><td> 2 ml </td><td> TBE 10X </td></tr><tr><td> 140 l </td><td> 10% de persulfato de amonio </td></tr><tr><td> El volumen total de: 20 ml </td><td></td></tr></tbody></table> Uptag mezcla de cebadores: Resuspender Uptag y Buptagkanmx4 cada uno en ddH2O a 100 M, a continuación, mezclar en una proporción de 1:1 para una concentración final de 50 M cada uno. Almacenar a -20 ° C. Downtag mezcla de cebadores: Resuspender Dntag y Bdntagkanmx4 cada uno en ddH2O a 100 M, a continuación, mezclar en una proporción de 1:1 para una concentración final de 50 M cada uno. Almacenar a -20 ° C. Oligonucleótidos mixtos: Resuspender cada uno de los siguientes ocho oligos (estándar desalada) en ddH2O a 100 M: Uptag, Dntag, Uptagkanmx, Dntagkanmx, Uptagcomp, Dntagcomp, Upkancomp, Dnkancomp. Mezclar un volumen igual de los ocho oligonucleótidos para una concentración final de 12,5 M cada uno. 12X MES acciones: De 10 ml, disolver 0,7 g de monohidrato de ácido libre MES y 1,93 g de sal de sodio MES en 8 ml de agua de grado molecular biología. Después de mezclar bien, verificar el pH y ajustar si es necesario a un pH 6.5 a 6.7. Añadir agua hasta un volumen total de 10 ml. Filtro de esterilizar y almacenar a 4 ° C protegido de la luz (por ejemplo, envolver el tubo de papel de aluminio). Reemplace si la solución se vuelve visiblemente amarilla o después de 6 meses. Tampón de hibridación 2X: De 50 ml, mezclar 8,3 ml de 12X MES acciones (de 02/09/14), 17,7 ml de 5 M NaCl, 4,0 ml de EDTA 0,5 M, 0,1 ml de 10% de Tween 20 (vol / vol), y 19,9 ml de filtrado ddH 2 O. Filtro de esterilización. Lavar A: Mezclar 300 ml de 20X SSPE, 1 ml de Tween 10% (vol / vol), 699 ml ddH 2 O. Filtro de esterilización. Lave B: Mezcle 150 ml 20X SSPE, 1 ml de Tween 10% (vol / vol), 849 ml ddH 2 O. Filtro de esterilización. Cebadores de secuenciación de códigos de barras En primer secuencias UP-etiqueta de los 5 &#39;de cola (en negrita) son secuencias de Illumina adaptador específico incorporado en el primer F y R. La secuencia variable (cursiva) representa la etiqueta de indexación 5-mer utilizados en la multiplexación / índice de lectura. La cola de la 3 &#39;(subrayado) representa el primer comunes que flanquean el código de barras uptag y es necesario ampliar los códigos de barras de levadura. En ABAJO-tag imprimación secuencias 5 &#39;es idéntica a la cola 5&#39; de la cola de la UP-etiqueta de cebadores (secuencia específica de iluminación), sin embargo, el 3 &#39;de cola (subrayado) se sustituye con los primers comunes que se utilizan para amplificar la baja etiqueta de código de barras.

competitive genomic screens of barcoded yeast libraries

En virtud de los avances en las tecnologías de secuenciación de próxima generación, tenemos acceso a nuevas secuencias del genoma casi a diario. El ritmo de estos avances se está acelerando, prometiendo una mayor profundidad y amplitud. A la luz de estos avances extraordinarios, la necesidad de métodos rápidos, en paralelo a definir la función del gen se vuelve cada vez más importante. Las colecciones de mutantes de deleción en todo el genoma de las levaduras y E. coli han servido como bestias de carga para la caracterización funcional de la función del gen, pero este método no es escalable, actual deleción del gen enfoques requieren cada uno de los miles de genes que componen un genoma que se eliminan y verifican. Sólo después de este trabajo está completo podemos seguir de alto rendimiento fenotipificación. Durante la última década, nuestro laboratorio ha refinado con una cartera de la competencia, en miniatura, de alto rendimiento de todo el genoma ensayos que se pueden realizar en paralelo. Este paralelismo es posible gracias a la inclusión de &quot;etiquetas&quot; de ADN, o &quot;códigos de barras,&quot; en cada mutante, con el código de barras que sirve como indicador de la mutación y se puede medir la abundancia de código de barras que evaluará su aptitud mutante. En este estudio, se busca llenar el vacío entre la secuencia de ADN y con código de barras colecciones de mutantes. Para lograr esto, se introduce una interrupción transposón combinado-código de barras del enfoque que abre los ensayos paralelos de código de barras que recientemente secuenciado, pero mal caracterizado microbios. Para ilustrar este enfoque se presenta una nueva colección de Candida albicans interrupción de código de barras y describir cómo los microarrays basado en la próxima generación basada en la secuencia de plataformas se pueden utilizar para recoger 10.000 - 1.000.000 gen-gen y las drogas las interacciones entre genes en un solo experimento.

Watch this Scientific Journal Video about Competitive Genomic Screens of Barcoded Yeast Libraries at JoVE.com

Competitive Genomic Screens of Barcoded Yeast Libraries

Hemos desarrollado completa e imparcial en todo el genoma para comprender las pantallas de genes de drogas y las interacciones genético-ambientales. Métodos para la detección de estas colecciones mutantes se presentan.

Pantallas competitiva Genómica de Bibliotecas de levadura con código de barras

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

competitive-genomic-screens-of-barcoded-yeast-libraries

Research

JoVE Journal

Biology

18.1K vistas.  University of Toronto. Hemos desarrollado completa e imparcial en todo el genoma para comprender las pantallas de genes de drogas y las interacciones genético-ambientales. Métodos para la detección de estas colecciones mutantes se presentan.

Video: Competitive Genomic Screens of Barcoded Yeast Libraries

Large-Scale Screens of Metagenomic Libraries

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation. Generating a streamlined procedure for creating and screening metagenomic libraries is therefore useful for efficient high-throughput investigations into the genetic and metabolic properties of uncultured microbial assemblages. Here, key protocols are presented on video, which we propose is the most useful format for accurately describing a long process that alternately depends on robotic instrumentation and (human) manual interventions. First, we employed robotics to spot library clones onto high-density macroarray membranes, each of which can contain duplicate colonies from twenty-four 384-well library plates. Automation is essential for this procedure not only for accuracy and speed, but also due to the miniaturization of scale required to fit the large number of library clones into highly dense spatial arrangements. Once generated, we next demonstrated how the macroarray membranes can be screened for genes of interest using modified versions of standard protocols for probe labeling, membrane hybridization, and signal detection. We complemented the visual demonstration of these procedures with detailed written descriptions of the steps involved and the materials required, all of which are available online alongside the video.

A gran escala de pantallas de bibliotecas metagenómicas

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation.  Generating a ...

Investigación

Biología

Isolation of Genomic DNA from Mouse Tails

El aislamiento de ADN genómico de colas de ratón

Large Insert Environmental Genomic Library Production

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent environmental genomic (i.e. metagenomic) approaches have emerged, enabling researchers to bridge this cultivation gap by capturing the genetic content of indigenous microbial communities directly from the environment. To this end, genomic DNA libraries are constructed using standard albeit artful laboratory cloning techniques. Here we describe the construction of a large insert environmental genomic fosmid library with DNA derived from the vertical depth continuum of a seasonally hypoxic fjord. This protocol is directly linked to a series of connected protocols including coastal marine water sampling [1], large volume filtration of microbial biomass [2] and a DNA extraction and purification protocol [3]. At the outset, high quality genomic DNA is end-repaired with the creation of 5 -phosphorylated blunt ends. End-repaired DNA is subjected to pulsed-field gel electrophoresis (PFGE) for size selection and gel extraction is performed to recover DNA fragments between 30 and 60 thousand base pairs (Kb) in length. Size selected DNA is purified away from the PFGE gel matrix and ligated to the phosphatase-treated blunt-end fosmid CopyControl vector pCC1 (EPICENTRE <a href="http://www.epibio.com/item.asp?ID=385">http://www.epibio.com/item.asp?ID=385</a>). Linear concatemers of pCC1 and insert DNA are subsequently headfull packaged into phage particles by lambda terminase, with subsequent infection of phage-resistant E. coli cells. Successfully transduced clones are recovered on LB agar plates under antibiotic selection and archived in 384-well plate format using an automated colony picking robot (Qpix2, GENETIX). The current protocol draws from various sources including the CopyControl Fosmid Library Production Kit from EPICENTRE and the published works of multiple research groups [4-7]. Each step is presented with best practice in mind. Whenever possible we highlight subtleties in execution to improve overall quality and efficiency of library production. The whole process of fosmid library production and automated colony picking takes at least 7-10 days as there are many incubation steps included. However, there are several stopping points possible which are mentioned within the protocol.

Construction of a fosmid library with environmental genomic DNA isolated from the vertical depth continuum of a seasonally hypoxic fjord is described. The resulting clone library is picked into 384-well plates and archived for downstream sequencing and functional screening by the application of an automated colony picking system.

Inserte grandes Ambiental Genómica Producción Biblioteca

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent ...

Purification of Mitochondria from Yeast Cells

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play essential roles in apoptotic cell death2, cell survival3, mammalian development4, neuronal development and function4, intracellular signalling5, and longevity regulation6. Our understanding of these complex biological processes controlled by mitochondria relies on robust methods for assessing their morphology, their protein and lipid composition, the integrity of their DNA, and their numerous vital functions. The budding yeast Saccharomyces cerevisiae, a genetically and biochemically manipulable unicellular eukaryote with annotated genome and well-defined proteome, is a valuable model for studying the molecular and cellular mechanisms underlying essential biological functions of mitochondria. For these types of studies, it is crucial to have highly pure mitochondria. Here we present a detailed description of a rapid and effective method for purification of yeast mitochondria. This method enables the isolation of highly pure mitochondria that are essentially free of contamination by other organelles and retain their structural and functional integrity after their purification. Mitochondria purified by this method are suitable for cell-free reconstitution of essential mitochondrial processes and can be used for the analysis of mitochondrial structure and functions, mitochondrial proteome and lipidome, and mitochondrial DNA.

We describe a rapid and effective method for purification of mitochondria from the yeast Saccharomyces cerevisiae. This method enables the high-yield isolation of pure mitochondria that are essentially free of contamination by other organelles and retain their structural and functional integrity after their purification.

Purificación de las mitocondrias de las células de levadura

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play ...

Development of automated imaging and analysis for zebrafish chemical screens.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK pathway in zebrafish embryos. The zebrafish embryo is an ideal system for in vivo high-content chemical screens. The 1-day old embryo is approximately 1mm in diameter and can be easily arrayed into 96-well plates, a standard format for high throughput screening. During the first day of development, embryos are transparent with most of the major organs present, thus enabling visualization of tissue formation during embryogenesis. The complete automation of zebrafish chemical screens is still a challenge, however, particularly in the development of automated image acquisition and analysis. We previously generated a transgenic reporter line that expresses green fluorescent protein (GFP) under the control of FGF activity and demonstrated their utility in chemical screens 1. To establish methodology for high throughput whole organism screens, we developed a system for automated imaging and analysis of zebrafish embryos at 24-48 hours post fertilization (hpf) in 96-well plates 2. In this video we highlight the procedures for arraying transgenic embryos into multiwell plates at 24hpf and the addition of a small molecule (BCI) that hyperactivates FGF signaling 3. The plates are incubated for 6 hours followed by the addition of tricaine to anesthetize larvae prior to automated imaging on a Molecular Devices ImageXpress Ultra laser scanning confocal HCS reader. Images are processed by Definiens Developer software using a Cognition Network Technology algorithm that we developed to detect and quantify expression of GFP in the heads of transgenic embryos. In this example we highlight the ability of the algorithm to measure dose-dependent effects of BCI on GFP reporter gene expression in treated embryos.

We report the development of a system for automated imaging and analysis of zebrafish transgenic embryos in multiwell plates. This demonstrates the ability to measure dose dependent effects of a small molecule, BCI, on Fibroblast Growth Factor reporter gene expression and provide technology for establishing high-throughput zebrafish chemical screens.

Desarrollo de la imagen y el análisis automatizado de pantallas de química de pez cebra.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK ...

Yeast Colony Embedding Method

Patterning of different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms also display patterns of cell types. For example, in the yeast S. cerevisiae, sporulated cells and pseudohyphal cells are not uniformly distributed in colonies. The functional importance of patterning and the molecular mechanisms that underlie these patterns are still poorly understood.
One challenge with respect to investigating patterns of cell types in fungal colonies is that unlike metazoan tissue, cells in colonies are relatively weakly attached to one another. In particular, fungal colonies do not contain the same extensive level of extracellular matrix found in most tissues . Here we report on a method for embedding and sectioning yeast colonies that reveals the interior patterns of cell types in these colonies. The method can be used to prepare thick sections (0.5 &mu;) useful for light microscopy and thin sections (0.1 &mu;) suitable for transmission electron microscopy. Asci and pseudohyphal cells can easily be distinguished from ovoid yeast cells by light microscopy , while the interior structure of these cells can be visualized by EM.
The method is based on surrounding colonies with agar, infiltrating them with Spurr's medium, and then sectioning. Colonies with a diameter in the range of 1-2 mm are suitable for this protocol. In addition to visualizing the interior of colonies, the method allows visualization of the region of the colony that invades the underlying agar.

A method for embedding yeast colonies allowing sectioning for light and electron microscopy. This protocol allows determination of the distribution of sporulated cells and pseudohyphal cells within colonies providing a new tool toward understanding the organization of cell types within a fungal community.

Colonia de levaduras Método de anidamiento

Patterning of  different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms ...

Genomic MRI - a Public Resource for Studying Sequence Patterns within Genomic DNA

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in their nucleotide composition and consist of a complex mosaic of sequence patterns. These patterns include so-called Mid-Range Inhomogeneity (MRI) regions -- sequences 30-10000 nucleotides in length that are enriched by a particular base or combination of bases (e.g. (G+T)-rich, purine-rich, etc.). MRI regions are associated with unusual (non-B-form) DNA structures that are often involved in regulation of gene expression, recombination, and other genetic processes (Fedorova &amp; Fedorov 2010). The existence of a strong fixation bias within MRI regions against mutations that tend to reduce their sequence inhomogeneity additionally supports the functionality and importance of these genomic sequences (Prakash et al. 2009).
Here we demonstrate a freely available Internet resource -- the Genomic MRI program package -- designed for computational analysis of genomic sequences in order to find and characterize various MRI patterns within them (Bechtel et al. 2008). This package also allows generation of randomized sequences with various properties and level of correspondence to the natural input DNA sequences. The main goal of this resource is to facilitate examination of vast regions of non-coding DNA that are still scarcely investigated and await thorough exploration and recognition.

We present a public computational web site for the analysis of genomic sequences. It detects DNA sequence patterns with various non-random nucleotide compositions. This resource also generates randomized sequences with diverse levels of complexity.

Genómica resonancia magnética - un recurso público para el estudio de patrones de secuencia en el ADN genómico

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in ...

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic redundancy affecting simple genetics in higher plants. The novel model organism Ostreococcus tauri is the smallest free-living eukaryote known to date, and possesses a greatly reduced genome size and cellular complexity1,2, manifested by the presence of just one of most organelles (mitochondrion, chloroplast, golgi stack) per cell, and a genome containing only ~8000 genes. Furthermore, the combination of unicellularity and easy culture provides a platform amenable to chemical biology approaches. Recently, Ostreococcus has been successfully employed to study basic mechanisms underlying circadian timekeeping3-6. Results from this model organism have impacted not only plant science, but also mammalian biology7. This example highlights how rapid experimentation in a simple eukaryote from the green lineage can accelerate research in more complex organisms by generating testable hypotheses using methods technically feasible only in this background of reduced complexity. Knowledge of a genome and the possibility to modify genes are essential tools in any model species. Genomic1, Transcriptomic8, and Proteomic9 information for this species is freely available, whereas the previously reported methods6,10 to genetically transform Ostreococcus are known to few laboratories worldwide.
In this article, the experimental methods to genetically transform this novel model organism with an overexpression construct by means of electroporation are outlined in detail, as well as the method of inclusion of transformed cells in low percentage agarose to allow selection of transformed lines originating from a single transformed cell. Following the successful application of Ostreococcus to circadian research, growing interest in Ostreococcus can be expected from diverse research areas within and outside plant sciences, including biotechnological areas. Researchers from a broad range of biological and medical sciences that work on conserved biochemical pathways may consider pursuing research in Ostreococcus, free from the genomic and organismal complexity of larger model species.

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

This article describes genetic transformation of the unicellular marine alga Ostreococcus tauri by electroporation. This eukaryotic organism is an effective model platform for higher plants, possesing greatly reduced genomic and cellular complexity and being readily amenable to both cell culture and chemical biology.

Transformación de Genómica de la Picoeukaryote<em&gt; Ostreococcus tauri</em

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

Captura selectiva de 5-hidroximetilcitosina a partir de ADN genómico

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Assessing Differences in Sperm Competitive Ability in Drosophila

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the number of successful mating events rather than on maximizing survival and viability 1. Sperm competition represents the competition between males after copulating with the same female 2, in which their sperm are coincidental in time and space. This phenomenon has been reported in multiple species of plants and animals 3. For example, wild-caught D. melanogaster females usually contain sperm from 2-3 males 4. The sperm are stored in specialized organs with limited storage capacity, which might lead to the direct competition of the sperm from different males 2,5.
Comparing sperm competitive ability of different males of interest (experimental male types) has been performed through controlled double-mating experiments in the laboratory 6,7. Briefly, a single female is exposed to two different males consecutively, one experimental male and one cross-mating reference male. The same mating scheme is then followed using other experimental male types thus facilitating the indirect comparison of the competitive ability of their sperm through a common reference. The fraction of individuals fathered by the experimental and reference males is identified using markers, which allows one to estimate sperm competitive ability using simple mathematical expressions 7,8. In addition, sperm competitive ability can be estimated in two different scenarios depending on whether the experimental male is second or first to mate (offense and defense assay, respectively) 9, which is assumed to be reflective of different competence attributes.
Here, we describe an approach that helps to interrogate the role of different genetic factors that putatively underlie the phenomenon of sperm competitive ability in D. melanogaster.

Assessing Differences in Sperm Competitive Ability in Drosophila

Differential sperm competitive ability among Drosophila males with distinct genotypes can be ascertained through double-mating experiments. Each of these experiments involves one of the males of interest and a reference male. Readily identifiable markers in the progeny allow inference of the fraction of individuals fathered by each male.

Diferencias Evaluación de Capacidad Competitiva de espermatozoides en<em&gt; Drosophila</em

Competition among conspecific males for fertilizing the ova is one of the mechanisms of sexual selection, i.e. selection that operates on maximizing the ...