Los autores desean agradecer a Kristen Bullard-Feibelman, a Milena Veselinovic ya Claudia Rückert por su ayuda en la caracterización del virus derivado de clones. Este trabajo fue apoyado en parte por subvenciones del Instituto Nacional de Alergias y Enfermedades Infecciosas, NIH bajo las concesiones AI114675 (BJG) y AI067380 (GDE).

1. Transformación y recuperación de plásmidos de clones infecciosos <ol><li> Transformar ambos plásmidos (por separado) utilizando un protocolo de transformación comercial ( por ejemplo , NEB 5 Minute Transformation Protocol) con algunas modificaciones. Ambos plásmidos contienen un gen que codifica la resistencia a ampicilina, por lo tanto, usan ampicilina o carbenicilina para la selección. Se prefiere la carbenicilina, ya que es más estable. <ol><li> Retirar las células (ver tabla de materiales) de -80 ° C congelador y descongelar en hielo durante 5-10 min. Caldo de lysogénesis pre-calcinado (LB) (conteniendo 10 g / L de NaCl y 25 μg / mL de carbenicilina, llamado LB-carb) y el caldo con catabolita (SOC (sin antibióticos) - a 37 ° C. </li><li> Añadir entre 100 pg-10 ng en 1 μl de ADN plasmídico a un tubo que contenga 50 μl de células competentes; Mezcle suavemente haciendo chasquear el tubo. </li><li> Incubar los tubos en hielo durante 5 min. </li><li> Tubos de choque térmico a 42 ° C durante 30 sEn un baño de agua. Regrese al hielo por 2 minutos inmediatamente después del choque térmico. </li><li> Pipetee 950 μL de temperatura ambiente en cada tubo y mezcle por pipeteado. Se disemina 100 μL de la mezcla bacteriana sobre una placa de LB-carb e incuba durante la noche a 37 ° C (aproximadamente 12-14 h). </li></ol></li><li> Quitar las placas de 37 ° C incubadora después de 12-14 h de incubación. Colocar las placas en un cajón oscuro a temperatura ambiente para permitir que las colonias continúen creciendo (aproximadamente 8-9 h). </li><li> Utilizando 5 mL de Caldo Terrific (TB, que contiene 25 μg / mL de carbenicilina, llamado TB-carb), crecen 5-10 pequeñas colonias para cada plásmido durante la noche a 30 ° C en un agitador bacteriano (aproximadamente 14-16 h). NOTA: Las colonias pequeñas son un indicador de que el plásmido está intacto; Las colonias con plásmidos que contienen delecciones, reordenamientos o mutaciones (en lo sucesivo denominados eventos de inestabilidad) crecerán más rápidamente y, por tanto, serán más grandes. Por lo tanto, uno debe tratar de recoger las colonias más pequeñas en la placa, específicamente noT seleccionando las colonias más grandes presentes. También se pueden seleccionar algunas colonias de tamaño medio para que sean completas. La temperatura más baja utilizada reduce la probabilidad de que las células crezcan demasiado (DO 600 de más de 0,6-0,8). Como la mayoría de los investigadores realizan crecimiento durante la noche, permite más control y menor probabilidad de crecimiento excesivo. </li><li> Compruebe si hay turbidez en los cultivos líquidos (aproximadamente DO 600 de 0,6-0,8). Coloque los tubos turbios a 4 ° C y permita que otros tubos se vuelvan turbios creciendo por más tiempo. NOTA: No cultivar bacterias a valores de DO 600 mayores de lo recomendado, ya que pueden ocurrir eventos de inestabilidad plasmídica. </li><li> Extraer el ADN del plásmido de las bacterias con un kit comercial de miniprep de plásmido (Ver Tabla de Materiales). Eluir en 15 μL de tampón de elución precalentado (hasta 70 ° C en un bloque de calentamiento). Dejar que el tampón de elución se incube en la columna durante 5 minutos antes de la centrifugación. NOTA: Preserve al menos 1 mL de este cultivo de arranque a 4 ° C paraUso adicional en la siguiente etapa. </li><li> Digerir 10 μL de los plásmidos recuperados para evaluar si los eventos de inestabilidad del plásmido se produjeron durante el cultivo. NOTA: Digerir p1 con SalI / NheI y p2 con BamHI / HindIII a 37 ° C durante 1 h. Confirme la presencia de las bandas correctas después de la digestión ( Figura 2a ) por electroforesis en gel y continúe con el paso 2. Si se prepara ADN de plásmido mediante amplificación en círculo rodante (RCA), reserve parte del eluido de miniprep para servir como molde. </li></ol> 2. Preparación de ADN plasmídico suficiente para la ligadura NOTA: La ligadura y la electroporación subsecuente requieren una cantidad suficiente de ADN plasmídico que debe generarse a través de maxiprep o RCA. Mientras que el maxiprep es el enfoque tradicionalmente utilizado, RCA ofrece la ventaja de no requerir bacterias, eliminando así el potencial de toxicidad inducida por plásmidos en bacterias que pueden dar lugar a eventos de inestabilidad. <ol><li><stRong&gt; Realice el siguiente procedimiento maxiprep. <ol><li> Para cada plásmido que demostró el patrón de digestión de la enzima de restricción correcto en la sección anterior, añadir 500 μl de cultivo de arranque a 1 L de caldo de TB-Carb (25 μg / mL de carbenicilina) y agitar durante la noche a 30 ° C (aproximadamente 14-16 h , Aproximadamente OD $ _ $ de 0,6-0,8). NOTA: No permita que el cultivo crezca sobre este valor de OD 600 . Esto resultará potencialmente en eventos de inestabilidad dentro de los plásmidos. </li><li> Coseche las bacterias y realice maxipreps por el protocolo del fabricante (véase la tabla de materiales). </li></ol></li><li> Utilizando el miniprep guardado desde el paso 1.6, realice lo siguiente para el procedimiento RCA. <ol><li> Transferir 1 μl de ADN plasmídico a un tubo que contenga 50 μl de tampón de muestra. </li><li> Desnaturalizar por calor la muestra a 95 ° C durante 3 min, e incubar después a 4 ° C hasta que esté listo para usar. </li><li> Preparar la amplificación comercialPremezcla (ver tabla de materiales ). Se combinan 50 μl de tampón de reacción con 2 μl de mezcla enzimática en un conjunto de tubos sobre hielo. NOTA: La premezcla de amplificación debe mantenerse en hielo hasta que esté lista para su uso. Es conveniente preparar una mezcla maestra combinando reactivos suficientes para el número requerido de reacciones de amplificación. Cualquier premezcla no utilizada debe desecharse. </li><li> Transferir 50 μl de premezcla de amplificación preparada a la muestra desnaturalizada. </li><li> Incubar los tubos de reacción a 30 ° C durante 18 h. </li><li> Incubar los tubos a 65 ° C durante 10 min para inactivar la DNA polimerasa ø29. </li><li> Guarde los tubos de reacción a 4 ° C o -20 ° C hasta que estén listos para su uso. NOTA: En este punto, se debe cuantificar el ADN plasmídico preparado a través de ambos métodos (utilizando absorbancia a 260 nm) y el genoma ZIKV debe ser secuenciado completamente por Sanger para confirmar que no ocurrieron eventos de inestabilidad (deleciones y reordenamientos) durante la preparación. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Primer Nombre </td><td> Secuencia (5 &#39;- 3&#39;) </td></tr><tr><td> ZIKV PRVABC59 1Para. </td><td> AGTTGTTGATCTGTGTGAATCAGAC </td></tr><tr><td> ZIKV Conservado 632Para. </td><td> GCCCTATGCTGGATGAGG </td></tr><tr><td> ZIKV Conserved 692Rev. </td><td> GGTTCCGTACACAACCCAAGTTG </td></tr><tr><td> ZIKV Conservado 1313Rev. </td><td> CTCCCTTTGCCAAAAAGTCCACA </td></tr><tr><td> ZIKV Conservado 1201Para. </td><td> CCAACACAAGGTGAAGCCTAC </td></tr><tr><td> ZIKV conservado 1663For. </td><td> GCAGACACCGGAACTCCACACT </td></tr><tr><td> ZIKV Conservado 2008For. </td><td> CAGATGGCGGTGGACATGC </td></tr><tr><td> ZIKV Conservado 2350Rev. </td><td> GTGAGAACCAGGACATTCCTCC </td></tr><tr><td> ZIKV conservado 2605 para. </td><td> TACAAGTACCATCCTGACTCCC </td></tr><tr><td> ZIKV Conservado 3499Rev. </td><td>GCCTTATCTCCATTCCATACCA </td></tr><tr><td> ZIKV Conservado 3961Rev. </td><td> TTGCCAACCAGGCCAAAG </td></tr><tr><td> ZIKV Conservado 4132Para. </td><td> CATTTGTCATGGCCCTGG </td></tr><tr><td> ZIKV Conservado 4561Rev. </td><td> CTATTGGGTTCATGCCACAGAT </td></tr><tr><td> ZIKV conservado 4665For. </td><td> GACCACAGATGGAGTGTACAGAGT </td></tr><tr><td> ZIKV Conservado 5189Rev. </td><td> AAGACAGTTAGCTGCTTCTTCTTCAG </td></tr><tr><td> ZIKV conservado 5219For. </td><td> GAGAGTTCTTCCTGAAATAGTCCGTGA </td></tr><tr><td> ZIKV Conservado 6086Rev. </td><td> CTTGCTTCAAGCCAGTGTGC </td></tr><tr><td> ZIKV Conservado 6119Para. </td><td> GCCTCATAGCCTCGCTCTATCG </td></tr><tr><td> ZIKV Conservado 6721Rev. </td><td> CCATTCCAAAGCCCATCTTCCC </td></tr><tr><td> ZIKV Conservado 6769Para. </td><td> CCAGCCAGAATTGCATGTGTCC </td></tr><tr><td> ZIKV Conservado 7209Rev. </td><td> ATCATTAGCAGCGGGACTCCAA </td></tr><tr><td> ZIKV Conservado 7343Para. </td><td> GTTGTGGATGGAATAGTGGT </td></tr><tr><td> ZIKV conservado 8243Para. </td><td> TGCCCATACACCAGCACTATGA </td></tr><tr><td> ZIKV PRVABC59 8893Rev. </td><td> TGCATTGCTACGAACCTTGTTG </td></tr><tr><td> ZIKV conservado 9133For. </td><td> AGCCCTTGGATTCTTGAACGAGGA </td></tr><tr><td> ZIKV PRVABC59 9673Rev. </td><td> AACGCAATCATCTCCACTGACT </td></tr><tr><td> ZIKV Conservado 9686Para. </td><td> GATGATAGGTTTGCACATGCC </td></tr><tr><td> ZIKV Conservado 10321Rev. </td><td> GTCCATGTACTTTTCTTCATCACCTAT </td></tr><tr><td> ZIKV Conservado 10455Para. </td><td> CAGGAGAAGCTGGGAAACC </td></tr><tr><td> ZIKV Conservado 10621Rev. </td><td> CAGATTGAAGGGTGGGGAAGGTC </td></tr></tbody></table> TABLA 1: Cebadores para la secuenciación de clones de cDNA. Los plásmidos pueden secuenciarse completamente con los cebadores enumerados. Primers marcados como &quot;conservados&quot; indiQue son capaces de secuenciar / amplificar todos los genotipos de ZIKV. Primers etiquetados como &quot;PRVABC59&quot; son específicos de esta cepa, pero también puede trabajar para otras cepas de genotipo asiático y, posiblemente, otros genotipos. 3. Preparación del ARN transcrito in vitro <ol><li> Establecer la reacción de digestión de maxiprep o RCA preparado ADN. <ol><li> Para la digestión con p1, mezclar 10 μl de tampón de reacción 10x, 3 μl de ApaLI, 3 μl de BamHI-HF, 3 μl de rSAP o CIP y 3,3 μg de ADN p1. Añadir ddH $ ₂ $ O a 100 μl. </li><li> Para la digestión con p2, mezclar 10 μl de tampón de reacción 10x, 3 μl de ApaLI, 3 μl de EcoRI-HF y 13,3 μg de ADN p2. Añadir ddH $ ₂ $ O a 100 μl. </li><li> Incubar a 37 ° C durante 1-2 h. </li><li> Purificar usando un gel comercial y un kit de limpieza de PCR (Ver Tabla de Materiales). Eluir en 30 μl de tampón de elución precalentado a 70 ° C en un bloque de calentamiento (incubar elColumna durante 5 min antes de hilar). NOTA: Mantenga 1 μL para que funcione en un gel más tarde. </li></ol></li><li> Preparar la reacción de ligadura. <ol><li> Se combinan 10 μl de tampón de reacción de ligación de ADN T4 10x, 3 μl de ADN ligasa T4 (400 U / μl), 29 μL de p1 purificado y 29 μL de p2 purificado. Añadir ddH $ ₂ $ O a 100 μl. </li><li> Incubar a temperatura ambiente durante 2 h o 16 ° C durante la noche. </li><li> Purificar usando un gel comercial y un kit de limpieza de PCR (Ver Tabla de Materiales). Eluir en 10 μl de tampón de elución precalentado a 70 ° C en un bloque de calentamiento (incubar la columna durante 5 minutos antes de centrifugar). NOTA: Mantenga 1 μL para que funcione en un gel más tarde. </li></ol></li><li> Ejecutar plásmidos no digeridos, plásmidos digeridos y ligación en un gel de agarosa. El producto de ligación debe tener una banda de mayor peso molecular (alrededor de 11 kb) que cualquiera de los plásmidos digeridos solo, lo que indica que la ligación fue exitosa ( Figura 2b ).</li><li> Establecer T7 reacción de transcripción in vitro . <ol><li> Combinar 10 μL 2x ARCA / NTP Mix, 2 μL de T7 RNA polimerasa y 8 μL de la reacción de ligación purificada para un volumen final de 20 μL. NOTA: El ARCA incluido en la mezcla es un análogo de tapa que se incorpora exclusivamente en la orientación correcta. Los análogos de tapa estándar pueden dar como resultado que sólo ~ 50% de los transcritos tengan una tapa en la orientación correcta. </li><li> Incubar durante 4 h a 37 ° C. </li><li> Medir la concentración de ARN a través de un espectrofotómetro UV. Opcionalmente, ejecute un gel de agarosa desnaturalizante para confirmar la longitud del transcrito de ARN. </li></ol></li></ol> 4. Rescate del Virus Infeccioso por Electroporación <ol><li> Días antes de la electroporación, se prepara un matraz T182 de células Vero (entre T150 y T182 es aceptable, se desarrolla en DMEM + suero bovino fetal al 10% (FBS)) por constructo que se va a recuperar. Incluir 1 T182 como un control de transfección simulada. CeLls debe utilizarse en un 70-80% de confluencia. </li><li> Cuando las células estén listas, coloque 12 ml / reacción de DMEM + 15% de FBS + 10 mM de HEPES en un baño de agua calentado a 37 ° C. </li><li> Se separan las células por tripsinización con un protocolo estándar y se recuperan las células en medio con FBS al 10% para inactivar tripsina; Centrifugar las células a 150 xg durante 5 min a 4 ° C. </li><li> Lavar las células en 1x solución salina tamponada con fosfato (PBS), sedimentar las células a 150 xg durante 5 min a 4 ° C. Repita este paso dos veces para un total de tres lavados. </li><li> Resuspender las células en 200 μ l de RPMI 1640 + 10 mM HEPES (estéril) por # de muestras. Transferir 200 μl de suspensión celular a un tubo estéril. Las células deben ser ~ 0,5 x 10 7 células / mL. </li><li> Añadir 20 μl de agua (control negativo simulador) o 20 μL de ARN (preferiblemente 5-10 μg) producido en la etapa 3.4 a cada conjunto de células. Mezclar suavemente golpeando el tubo y transferir el contenido del tubo a una cubeta de electroporación de espacio de 2 mm. </li><li> Establecer una electrOporator a 170 V LV, omega (resistencia) a 0 y 950 μF (aproximadamente 625 V / cm y 20 ms de constante de tiempo para otras máquinas). Ajuste la resistencia al valor más bajo disponible, ya sea 0 o ∞ si está disponible. </li><li> Pulse una vez e inmediatamente añada 600 μL de DMEM + 15% de FBS + 10 mM de HEPES que se calentó en el paso 4.2. Enjuague el interior de la cubeta a fondo para eliminar todas las células. Se añaden células a un matraz de cultivo de tejido T75 que contiene 10 ml de medio precalentado. Retire los medios adicionales de la cubeta usando el cuentagotas que se incluye con la cubeta. Tenga cuidado de mantener la esterilidad. </li><li> Frasco de remolino para mezclar los medios y las células y colocar en incubadora a 37 ° C. </li><li> Compruebe el día siguiente para la viabilidad celular, y hacerlo todos los días hasta 50-75% de muerte celular se observa. La muerte celular se observa comparando con el control electroporado simulado. NOTA: El efecto citopático ZIKV (CPE) es bastante pronunciado en células Vero, dando lugar a células redondeadas que se separan y flotan en el medio de cultivo. TenemosObservó un rango de 8-10 días como ideal para la cosecha. </li><li> Colocar el sobrenadante en un tubo cónico y centrifugar para eliminar los desechos celulares a&gt; 3.000 xg durante 10 min a 4 ° C. </li><li> Eliminar el sobrenadante clarificado a un nuevo tubo y completar con una concentración final de FBS al 20% (a partir de 100% de stock). Adicionalmente, se añade HEPES estéril a una concentración final de 10 mM como agente tamponador para preservar la infectividad del virus mientras se congela (a partir de un stock estéril 1 M). </li><li> Mezcle el virus agitando vórtice y alícuota en viales de tapa roscada. Almacenar a -80 ° C para uso futuro. </li></ol> 5. Titulación del virus recuperado <ol><li> Sembrar el número apropiado de placas de 6 o 12 pocillos de células Vero el día antes de la titulación. </li><li> Eliminar el virus del congelador y hacer diluciones en serie de 10 veces en DMEM + 2% de FBS en tubos o placas de 96 pocillos. NOTA: El título esperado de clones recuperados está entre 1 x 10 6 y 5 x 10 7 PFU / mL. </li><li> Añadir 200 oR 400 μl de cada dilución en duplicado a un pocillo de una placa de 12 ó 6 pocillos, respectivamente. </li><li> Coloque las placas en una incubadora a 37 ° C y roca cada 15 min, durante un período de adsorción total de ~ 1-1,5 h. </li><li> Elimine el inóculo viral y añada 1 mL de recubrimiento de DMEM-Tragacanto de (12 pocillos) o 2 mL (6 pocillos) a cada pocillo. NOTA: Es posible utilizar agarosa, agar, metilcelulosa u otros medios de recubrimiento aquí. </li><li> Incubar las células en un incubador a 37 ° C durante 5 días. El tiempo para la formación adecuada de placa variará dependiendo de la superposición utilizada. </li><li> Para fijar las células, retire las placas de la incubadora y decántela suavemente en desinfectante. </li><li> Añadir suficiente 20% de etanol / 0,1% de violeta de cristal (CV) a cada pocillo para cubrir y remolinar para mezclar. NOTA: Existen muchos otros fijadores y se pueden utilizar aquí. Además, si se utiliza una capa de agarosa o agar, puede utilizarse una segunda capa de recubrimiento junto con un rojo neutro para visualizar las placas sin fijación. El 20% de etanol ha demostrado serEficaces en la inactivación de virus envueltos en estudios previos; No utilice esta cantidad para los virus no envueltos ya que no serán inactivados 19 . </li><li> Incubar las placas durante 30-60 min a temperatura ambiente (en un gabinete de bioseguridad de clase II); Desechar el CV (según las regulaciones locales) y lavar los platos con agua del grifo. </li><li> Permita que las placas se sequen y cuente manualmente las placas. NOTA: La referencia 20 puede usarse como una referencia adicional para realizar ensayos de placa. </li></ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

Los autores no tienen nada que revelar.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse mode...

El virus Zika (ZIKV, Familia Flaviviridae : Género Flavivirus ) es un flavivirus transmitido por mosquitos que llegó a Brasil en 2013-14 y posteriormente se asoció con un brote masivo de enfermedad febril que se extendió a través de las Américas 1 . Además, ZIKV se ha relacionado con graves resultados de la enfermedad, como el síndrome de Guillain-Barré en adultos y microcefalia en fetos y neonatos [ 2] . Poco se sabía acerca de ZIKV antes de su rápida propagación en el hemisferio occidental. Esto incluyó la falta de herramientas moleculares, dificultando así la investigación mecanicista. Las herramientas moleculares para los virus, como los clones de cDNA infecciosos, facilitan el desarrollo terapéutico de las vacunas y antivirales y permiten la evaluación de factores genéticos virales relacionados con la patogénesis viral diferencial, la respuesta inmune y la evolución viral. Se sabe que los clones infecciosos de flavivirus son altamente inestables en bacterias debido a crY promotores prokaryotic yptic presentes en sus genomas 3 . Se han utilizado varios enfoques para mitigar este problema; Incluyendo la inserción de repeticiones en tándem aguas arriba de las secuencias víricas 4 , mutación de las secuencias putativas del promotor procariótico 5 , división del genoma en múltiples plásmidos 6 , vectores de bajo número de copias (incluidos los cromosomas artificiales bacterianos) 7 , 8 e inserción de intrones en el genoma viral 9 . Se ha descrito un sistema de longitud completa sin modificaciones para ZIKV; Sin embargo, este clon parecía estar atenuado en cultivo celular y en ratones 10 . Otros grupos han introducido intrones en el genoma ZIKV, permitiendo la interrupción de secuencias inestables en bacterias que pueden ser empalmadas en células de mamíferos in vitro para la producción de virus infeccioso 11, 12 . Además, se ha utilizado con éxito un sistema basado en PCR denominado Infectious Subgenomic-Amplicons para rescatar la cepa MR766 de ZIKV 13 . El enfoque aquí descrito no requiere secuencias foráneas, sino que altera el genoma en la región de alta inestabilidad mediante el uso de múltiples plásmidos, que se ha utilizado previamente con éxito con la fiebre amarilla 6 , dengue 14 , 15 y virus del Nilo Occidental 16 . Además, la adición de la secuencia de ribozima de hepatitis D en los extremos genómicos víricos facilita la creación de un extremo 3 &#39;auténtico sin la necesidad de la adición de un sitio de linealización. Además, ambos plásmidos se construyen en un vector de número de copias bajas (pACYC177, ~ 15 copias por célula) para mitigar cualquier toxicidad residual 17 . El virus recuperado muestra un perfil de crecimiento comparable alParental en curvas de crecimiento in vitro en 8 líneas celulares que comprenden una variedad de tipos de células derivadas de mamíferos e insectos, y ha exhibido perfiles patógenos idénticos en ratones y tasas de infección, diseminación y transmisión en mosquitos 18 . En el presente documento, detallamos un protocolo que describe cómo cultivar los plásmidos de clones infecciosos, genera ARN viral de longitud completa (el genoma viral) in vitro y recupera el virus infeccioso en cultivo celular. En primer lugar, se describe la propagación de los plásmidos en bacterias o sin bacterias de amplificación mediante amplificación de círculo de rodadura (RCA). A continuación, se muestra cómo se digieren los dos plásmidos y luego se ligan entre sí para generar el virus de longitud completa. Por último, se describe la producción de ARN transcrito y su posterior electroporación en células Vero, seguido de la valoración del virus recuperado ( Figura 1 ]. El enfoque descrito es rápido,R recuperación de las poblaciones de virus infecciosos en 1-2 semanas.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>NEB Stable CompetentE. coli</td>
			<td>New England BioLabs</td>
			<td>C3040H</td>
			<td></td>
		</tr>
		<tr>
			<td>Carbenicillin, Disodium Salt</td>
			<td>various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zyppy Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4036</td>
			<td></td>
		</tr>
		<tr>
			<td>ZymoPURE Plasmid Maxiprep Kit</td>
			<td>Zymo Research</td>
			<td>D4202</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI-HF</td>
			<td>New England BioLabs</td>
			<td>R3138S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>NheI-HF</td>
			<td>New England BioLabs</td>
			<td>R3131S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>ApaLI</td>
			<td>New England BioLabs</td>
			<td>R0507S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>EcoRI-HF</td>
			<td>New England BioLabs</td>
			<td>R3101S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>BamHI-HF</td>
			<td>New England BioLabs</td>
			<td>R3136S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>HindIII-HF</td>
			<td>New England BioLabs</td>
			<td>R3104S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>illustra TempliPhi 100 Amplification Kit</td>
			<td>GE Healthcare Life Sciences</td>
			<td>25640010</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-up</td>
			<td>Macherey-Nagel</td>
			<td>740609.5</td>
			<td></td>
		</tr>
		<tr>
			<td>Shrimp Alkaline Phosphatase (rSAP)</td>
			<td>New England BioLabs</td>
			<td>M0371S</td>
			<td>1,000 units/ml</td>
		</tr>
		<tr>
			<td>Alkaline Phosphatase, Calf Intestinal (CIP)</td>
			<td>New England BioLabs</td>
			<td>M0290S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>New England BioLabs</td>
			<td>M0202S</td>
			<td>400,000units/mL</td>
		</tr>
		<tr>
			<td>HiScribe T7 ARCA mRNA Kit</td>
			<td>New England BioLabs</td>
			<td>E2065S</td>
			<td></td>
		</tr>
		<tr>
			<td>Vero cells</td>
			<td>ATCC</td>
			<td>CCL-81</td>
			<td></td>
		</tr>
		<tr>
			<td>ECM 630 High Throughput Electroporation System</td>
			<td>BTX</td>
			<td>45-0423</td>
			<td>Other machines are acceptable.</td>
		</tr>
		<tr>
			<td>LB Broth with agar (Miller)</td>
			<td>Sigma</td>
			<td>L3147</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Terrific Broth</td>
			<td>Sigma</td>
			<td>T0918</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Petri Dish</td>
			<td>Celltreat</td>
			<td>229693</td>
			<td></td>
		</tr>
		<tr>
			<td>Culture Tubes</td>
			<td>VWR International</td>
			<td>60818-576</td>
			<td></td>
		</tr>
		<tr>
			<td>T75 flasks</td>
			<td>Celltreat</td>
			<td>229340</td>
			<td></td>
		</tr>
		<tr>
			<td>T182 flasks</td>
			<td>Celltreat</td>
			<td>229350</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS</td>
			<td>Corning</td>
			<td>21-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 with L-glutamine</td>
			<td>Corning</td>
			<td>10-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM with L-glutamine and 4.5 g/L glucose</td>
			<td>Corning</td>
			<td>10-017-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Atlas Biologicals</td>
			<td>FP-0500-A</td>
			<td></td>
		</tr>
		<tr>
			<td>Tragacanth Powder</td>
			<td>MP Bio</td>
			<td>MP 104792</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Violet</td>
			<td>Amresco</td>
			<td>0528-1006</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol Denatured</td>
			<td>VWR International</td>
			<td>BDH1156-1LP</td>
			<td></td>
		</tr>
		<tr>
			<td>6 well plate</td>
			<td>Celltreat</td>
			<td>229106</td>
			<td></td>
		</tr>
		<tr>
			<td>12 well plate</td>
			<td>Celltreat</td>
			<td>229111</td>
			<td></td>
		</tr>
		<tr>
			<td>Sequencing Oligos</td>
			<td>IDT</td>
			<td>see table 1</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 3.0</td>
			<td>ThermoFisher</td>
			<td>Qubit 3.0</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit dsDNA BR Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32850</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit RNA HS Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32852</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Class II Biosafety Cabinet</td>
			<td>Varies</td>
			<td>N/A</td>
			<td>This is necessary for live-virus work.</td>
		</tr>
	</tbody>
</table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

Los clones de cDNA infecciosos permiten la manipulación genética de un virus, facilitando así el trabajo sobre vacunas, patogénesis, replicación, transmisión y evolución viral. Aquí se describe la construcción de un clon infeccioso para el virus Zika (ZIKV), que actualmente está causando un brote explosivo en las Américas. Para evitar la toxicidad a las bacterias que se observa comúnmente con los plásmidos derivados de flavivirus, se generó un sistema de dos plásmidos que separa el genoma en el gen NS1 y es más estable que las construcciones de longitud completa que no pudo ser recuperado con éxito sin mutaciones. Después de la digestión y la ligación para unir los dos fragmentos, ARN viral de longitud completa puede ser generado por transcripción in vitro con ARN polimerasa T7. Tras la electroporación del ARN transcrito en las células, se recuperó el virus que exhibía cinética de crecimiento in vitro similar y fenotipos de virulencia e infección in vivo en ratones y mosquitos, respectivamente.

El protocolo descrito aquí permite la recuperación de virus Zika derivados de clones infecciosos. Manipular el sistema de clones infecciosos de dos plásmidos es sencillo cuando se realiza con cuidado, en comparación con las versiones de longitud completa que son altamente inestables (datos no mostrados). Después de la digestión y la ligación de las dos piezas distintas, ARN tapado se produce utilizando la transcripción in vitro con T7 polimerasa que luego se ele...

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Este protocolo describe la recuperación del virus Zika infeccioso a partir de un clon de ADNc infeccioso de dos plásmidos.

Rescate y Caracterización del Virus Recombinante de un Nuevo Mundo Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Research

JoVE Journal

Immunology and Infection

9.6K vistas.  Colorado State University.  Este protocolo describe la recuperación del virus Zika infeccioso a partir de un clon de ADNc infeccioso de dos plásmidos. 

Video: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Generación de recombinantes del virus de influenza a partir del ADN plásmido

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Investigación

Inmunología e Infección

Detection of Infectious Virus from Field-collected Mosquitoes by Vero Cell Culture Assay

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many of these viruses have intensified in their endemic ranges and expanded to new territories, necessitating effective surveillance and control programs to respond to these threats. One strategy to monitor virus activity involves collecting large numbers of mosquitoes from endemic sites and testing them for viral infection. In this article, we describe how to handle, process, and screen field-collected mosquitoes for infectious virus by Vero cell culture assay. Mosquitoes are sorted by trap location and species, and grouped into pools containing &le;50 individuals. Pooled specimens are homogenized in buffered saline using a mixer-mill and the aqueous phase is inoculated onto confluent Vero cell cultures (Clone E6). Cell cultures are monitored for cytopathic effect from days 3-7 post-inoculation and any viruses grown in cell culture are identified by the appropriate diagnostic assays. By utilizing this approach, we have isolated 9 different viruses from mosquitoes collected in Connecticut, USA, and among these, 5 are known to cause human disease. Three of these viruses (West Nile virus, Potosi virus, and La Crosse virus) represent new records for North America or the New England region since 1999. The ability to detect a wide diversity of viruses is critical to monitoring both established and newly emerging viruses in the mosquito population.

We describe a method to process and screen field-collected mosquitoes for a diversity of viruses by Vero cell culture assay. By employing this technique, we have detected 9 different viruses from 4 taxonomic families in mosquitoes collected in Connecticut.

Detección del virus infeccioso de campo recogidos por los mosquitos del ensayo cultivo celular Vero

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many ...

Visualizing Dengue Virus through Alexa Fluor Labeling

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that influence this interaction could lead to improved understanding of disease pathogenesis and thus influence vaccine or therapeutic design. Hence, the development 
of methods to probe this interaction would be useful. Recent advancements in fluorophores development1-3 and imaging technology4 can be exploited to 
improve our current knowledge on dengue pathogenesis and thus pave the way to reduce the millions of dengue infections occurring annually.

The enveloped dengue virus has an external scaffold consisting of 90 envelope glycoprotein (E) dimers protecting the nucleocapsid shell, 
which contains a single positive strand RNA genome5. The identical protein subunits on the virus surface can thus be labeled with an amine reactive dye and visualized 
through immunofluorescent microscopy. Here, we present a simple method of labeling of dengue virus with Alexa Fluor succinimidyl ester dye dissolved directly in a sodium 
bicarbonate buffer that yielded highly viable virus after labeling. There is no standardized procedure for the labeling of live virus and existing manufacturer&#x2019;s protocol 
for protein labeling usually requires the reconstitution of dye in dimethyl sulfoxide. The presence of dimethyl sulfoxide, even in minute quantities, can block 
productive infection of virus and also induce cell cytotoxicity6. The exclusion of the use of dimethyl sulfoxide in this protocol thus reduced this possibility. 
Alexa Fluor dyes have superior photostability and are less pH-sensitive than the common dyes, such as fluorescein and rhodamine2, making them ideal for 
studies on cellular uptake and endosomal transport of the virus. The conjugation of Alexa Fluor dye did not affect the recognition of labeled dengue 
virus by virus-specific antibody and its putative receptors in host cells7. This method could have useful applications in virological studies.

Taking advantage of the advancements in fluorophore development and imaging technology, a simple method of Alexa Fluor labeling of dengue virus was devised to visualize the early interactions between virus and cell.

Visualización de virus del dengue a través de Alexa Fluor etiquetado

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that ...

Propagating and Detecting an Infectious Molecular Clone of Maedi-visna Virus that Expresses Green Fluorescent Protein

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in vivo are considered to be of the monocyte lineage2. Certain strains of MVV can replicate in other cell types, however3,4. The green fluorescent protein is a commonly used marker for studying lentiviruses in living cells. We have inserted the egfp gene into the gene for dUTPase of MVV. The dUTPase gene is well conserved in most lentivirus strains of sheep and goats and has been shown to be important in replication of CAEV5. However, dUTPase has been shown to be dispensable for replication of the molecular clone of MVV used in this study both in vitro and in vivo6. MVV replication is strictly confined to cells of sheep or goat origin. We use a primary cell line from the choroid plexus of sheep (SCP cells) for transfection and propagation of the virus7. The fluorescent MVV is fully infectious and EGFP expression is stable over at least 6 passages8. There is good correlation between measurements of TCID50 and EGFP. This virus should therefore be useful for rapid detection of infected cells in studies of cell tropism and pathogenicity in vitro and in vivo8.

We describe a molecular clone of maedi-visna virus that expresses GFP and is fully infectious. Replication of this virus can be detected by using fluorescence microscopy and flow cytometry.

Propagación y detección de un clon infeccioso molecular de Maedi-Visna virus que expresa la proteína fluorescente verde

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

Rescate del virus de la enfermedad de Newcastle recombinante a partir de cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Aislamiento de neutrófilos y análisis para determinar su papel en el linfoma de células sensibles a los agentes terapéuticos

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Virus Zika Sistema infecciosa cultivo celular y la<em&gt; In Vitro</em&gt; Profiláctica Efecto de los interferones

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

Zika Virus específico diagnóstico del epítopo descubrimiento

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

Extracción rápido, seguro y sencillo Manual cabecera de ácido nucleico para la detección del Virus en muestras de sangre entera

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

Cuantificación de estimulación dependiente de los anticuerpos del Virus Zika en células humanas primarias

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...