Name: preparation and application of a new bacterial biosensor for the presumptive detection of gunshot residue
Uploaded: 2019-05-09T14:45:00
Description: Watch this Scientific Journal Video about Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue at JoVE.com

The authors wish to acknowledge the students at Longwood University in BIOL 324 (Genetics) and the students in CHEM 403 (Advanced Chemical Laboratory Problem Solving) who were involved in the initial preparation and testing of the antimony and lead biosensors. The idea for MicRoboCop was conceived at the GCAT SynBIO workshop (summer 2014), which is funded by NSF and Howard Hughes Medical Institute and hosted by the University of Maryland Baltimore County. The authors also acknowledge funding received from Longwood University&#8217;s Cook-Cole College of Arts and Sciences and the GCAT SynBio Alumni Grant.

NOTE: Synthesis of E. coli expressing RFP is presented.
1. Preparation of plasmid DNA from E. coli
<ol>
	<li>Thaw E.coli containing a plasmid with an RFP gene and ampicillin resistance gene and grow the E.coli on Luria Broth (LB) agar plates containing 100 &#181;g/mL ampicillin at 37 &#176;C for 24 h. For example, use the J10060 plasmid from the registry of standard biological parts used for synthetic biology (see Table of Materials). The ...

<ol>
	<li>Eschner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#34;The+Story+of+the+Real+Canary+in+the+Coal+Mine.&#34;.">&#34;The Story of the Real Canary in the Coal Mine.&#34;.</a> The Smithsonian Magazine. , (2016).</li><li>Roda, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+in+chemical+luminescence-based+biosensors:+A+critical+review.">Progress in chemical luminescence-based biosensors: A critical review.</a> Biosensors &#38; Bioelectronics. 76, 164-179 (2016).</li><li>He, W., Yuan, S., Zhong, W. H., Siddikee, M. A., Dai, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+genetically+engineered+microbial+whole-cell+biosensors+for+combined+chemosensing.">Application of genetically engineered microbial whole-cell biosensors for combined chemosensing.</a> Applied Microbiology and Biotechnology. 100 (3), 1109-1119 (2016).</li><li>Dalby, O., Butler, D., Birkett, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Gunshot+Residue+and+Associated+Materials-A+Review.">Analysis of Gunshot Residue and Associated Materials-A Review.</a> Journal of Forensic Sciences. 55 (4), 924-943 (2010).</li><li>Bell, S., Seitzinger, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+binary+presumptive+assays+to+probabilistic+assessments:+Differentiation+of+shooters+from+non-shooters+using+IMS,+OGSR,+neural+networks,+and+likelihood+ratios.">From binary presumptive assays to probabilistic assessments: Differentiation of shooters from non-shooters using IMS, OGSR, neural networks, and likelihood ratios.</a> Forensic Science International. 263, 176-185 (2016).</li><li>O&#39;Mahony, A. M., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+Detection+of+Gunshot+Residue+for+Forensic+Analysis:+A+Review.">Electrochemical Detection of Gunshot Residue for Forensic Analysis: A Review.</a> Electroanalysis. 25 (6), 1341-1358 (2013).</li><li>Vigneshvar, S., Sudhakumari, C. C., Senthilkumaran, B., Prakash, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+Advances+in+Biosensor+Technology+for+Potential+Applications+-+An+Overview.">Recent Advances in Biosensor Technology for Potential Applications - An Overview.</a> Frontiers in Bioengineering and Biotechnology. 4, 9 (2016).</li><li>Fernandez, M., Morel, B., Ramos, J. L., Krell, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paralogous+Regulators+ArsR1+and+ArsR2+of+Pseudomonas+putida+KT2440+as+a+Basis+for+Arsenic+Biosensor+Development.">Paralogous Regulators ArsR1 and ArsR2 of Pseudomonas putida KT2440 as a Basis for Arsenic Biosensor Development.</a> Applied and Environmental Microbiology. 82 (14), 4133-4144 (2016).</li><li>Porter, S. E. G., Barber, A. E., Colella, O. K., Roach, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+Biological+Organisms+as+Chemical+Sensors:+The+MicRoboCop+Project.">Using Biological Organisms as Chemical Sensors: The MicRoboCop Project.</a> Journal of Chemical Education. 95 (8), 1392-1397 (2018).</li><li>Borremans, B., Hobman, J. L., Provoost, A., Brown, N. L., Van der Lelie, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+functional+analysis+of+the+pbr+lead+resistance+determinant+of+Ralstonia+metallidurans+CH34.">Cloning and functional analysis of the pbr lead resistance determinant of Ralstonia metallidurans CH34.</a> Journal of Bacteriology. 183 (19), 5651-5658 (2001).</li><li>Hobman, J. L., Julian, D. J., Brown, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cysteine+coordination+of+Pb(II)+is+involved+in+the+PbrR-dependent+activation+of+the+lead-resistance+promoter,+PpbrA,+from+Cupriavidus+metallidurans+CH34.">Cysteine coordination of Pb(II) is involved in the PbrR-dependent activation of the lead-resistance promoter, PpbrA, from Cupriavidus metallidurans CH34.</a> Bmc Microbiology. 12, (2012).</li><li>Yagur-Kroll, S., Amiel, E., Rosen, R., Belkin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+2,4-dinitrotoluene+and+2,4,6-trinitrotoluene+by+an+Escherichia+coli+bioreporter:+performance+enhancement+by+directed+evolution.">Detection of 2,4-dinitrotoluene and 2,4,6-trinitrotoluene by an Escherichia coli bioreporter: performance enhancement by directed evolution.</a> Applied Microbiology and Biotechnology. 99 (17), 7177-7188 (2015).</li><li>Gorman, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#34;Guns+in+America:+The+Debate+Over+Lead+Based+Bullets.&#34;.">&#34;Guns in America: The Debate Over Lead Based Bullets.&#34;.</a> Newsweek. , (2017).</li><li>Yuksel, B., Ozler-Yigiter, A., Bora, T., Sen, N., Kayaalti, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFAAS+Determination+of+Antimony,+Barium,+and+Lead+Levels+in+Gunshot+Residue+Swabs:+An+Application+in+Forensic+Chemistry.">GFAAS Determination of Antimony, Barium, and Lead Levels in Gunshot Residue Swabs: An Application in Forensic Chemistry.</a> Atomic Spectroscopy. 37 (4), 164-169 (2016).</li><li>Blakey, L. S., Sharples, G. P., Chana, K., Birkett, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fate+and+Behavior+of+Gunshot+Residue-A+Review.">Fate and Behavior of Gunshot Residue-A Review.</a> Journal of Forensic Sciences. 63 (1), 9-19 (2018).</li><li>Yagur-Kroll, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+bioreporters+for+the+detection+of+2,4-dinitrotoluene+and+2,4,6-trinitrotoluene.">Escherichia coli bioreporters for the detection of 2,4-dinitrotoluene and 2,4,6-trinitrotoluene.</a> Applied Microbiology and Biotechnology. 98 (2), 885-895 (2014).</li></ol>

Modifications and troubleshooting
The experiment described in Table 4 can be modified in any way appropriate to the sensors that have been designed. The most important aspect of a chemical sensor is to evaluate its sensitivity and specificity. It is beneficial to ensure that a wide range of concentrations of the analyte is analyzed to determine the useful analytical range of the sensor. It is also worth determining a maximum level of analyte for the cells. Bec...

A biosensor is any analytical device that uses biological components (such as proteins, nucleic acids, or whole organisms) that produce a response that can be used for the detection of a chemical substance or analyte. As an example, the coal mining industry used a biosensor for much of the 20th century to detect the presence of toxic mine gases: the canary in the coal mine1. The biological organism&#39;s (canary&#39;s) response (death or distress) to a chemical analyte (carbon monoxide) was observed by the miners in order to protect the workers. In a more modern and sophisticated example, bacteria can be altered using synthetic biology techniques to respond to the presence of a certain chemical analyte by exhibiting a specific response, such as the expression of a fluorescent protein.
Synthetic biology is a broad term that refers to the construction of biological devices and systems that do not exist naturally, or the re-design of existing biological systems for a specific purpose2. Synthetic biology is distinguished from genetic engineering by a standard methodology and the existence of standardized parts (standard synthetic biology genetic elements) that can be used to synthesize devices and systems. A part is introduced into the genome of a device, an organism such as a bacterium, to express a certain trait that will serve as an indication of function. For example, in many synthetic devices, the expression of a fluorescent protein is introduced into a single celled organism as a reporter protein. Multiple devices can be combined into a system. The genomes of microorganisms such as bacteria are easy to manipulate in this manner. Numerous examples of biosensors specific to a wide range of chemical analytes have been reported in the literature over the last decade3,4.
In this work, the MicRoboCop system is presented as an example of a biosensor designed using synthetic biology techniques with novel applications in forensic and environmental chemistry. MicRoboCop is a system of three separate devices that, when combined, will allow Escherichia coli to express red fluorescent protein (RFP) in the presence of gunshot residue (GSR) that has been collected from a person&#8217;s hands or a surface. Each of the three devices responds to a specific chemical analyte that is known to be a component of GSR5. The three analytes to which the system responds are I. 2,4,6-trinitrotoluene (TNT) and related compounds, II. lead (in the form of lead ions), and III. antimony (also in the form of ions).
GSR consists of many different chemical substances, but the three usually used to identify a residue as GSR are barium, lead, and antimony5. The standard evidentiary test for the identification of GSR is to use scanning electron microscopy (SEM) with energy dispersive X-ray fluorescence (EDX)5. SEM-EDX allows analysts to identify the unique morphology and the elemental components of GSR. Presently, there are few widely used binary presumptive tests available. One recently published presumptive test uses ion-mobility spectroscopy (IMS), which is specialized equipment that might not be available in many labs6. There are also a few color &#8220;spot&#8221; tests that can be used, though they are typically used for distance determination or for GSR identification on bullet holes and wounds5. Additionally, there has been some limited attention in the literature to electrochemical tests for GSR that employ voltammetric analysis, which has the advantage of potentially being field portable, or anodic stripping voltammetry, which is an extremely sensitive method for metallic elements7. There is very little mention in the literature of biosensors designed specifically for the purpose of detecting GSR, though some biosensors for other forensic applications have been published8.
The biological elements for each device in the MicRoboCop system, and the plasmid construction, are illustrated in Figure 1. The curved arrow in Figure 1b represents the promoter region that is activated in the presence of the analyte, the oval is the ribosomal binding site that allows translation of the reporter protein, the gray box labeled RFP is the gene that expresses red fluorescent protein, and the red octagon is the transcription termination site. All three devices will be used together as a system to detect GSR. Each device with a specific promoter (SbRFP, PbRFP, and TNT-RFP) will be incubated with the sample that is being tested and fluorescence of RFP will be measured. RFP will only be expressed if the appropriate chemical analyte is present and activates the promoter region. Three devices that respond to some of the chemical substances present in GSR have been designed and are presented in this work.
The promoters used in the three MicRoboCop devices are an arsenic and antimony sensitive promoter, SbRFP9,10, a lead sensitive promoter, PbRFP11,12 and a TNT sensitive promoter, TNT-RFP13. Because a search in the literature revealed no promoter designed to respond to barium, the TNT promoter was selected instead since this promoter is sensitive to a number of structurally related compounds (in particular, 2,4-dinitrotoluene and dinitrobenzene) that are known to be a part of the organic compounds left behind in GSR. This promoter has successfully been used to specifically detect minute quantities of TNT and 2,4-dinitrotoluene (2,4-DNT) in buried land mines13. Using the three devices together as a system, a positive test for GSR will produce fluorescence in all three devices. A fluorescence signal in only one or two devices will indicate another environmental source of the analyte(s) or in the case of the TNT promoter, activation by a compound that is not an organic compound left behind in GSR. By using all three devices together, the possibility of a false positive results due to environmental sources is minimized. Lead-free ammunition, which is gaining in popularity, still represents only about 5% of ammunition sales in the United States; hence, false negative results due to the absence of lead may be a possibility but there is still utility in a sensor that uses lead as a marker for GSR14. In addition to this specific forensic application, each device can be used separately for purposes of detecting environmental contaminants.
The protocols presented include the synthetic biology techniques used to create the devices (sensor bacteria) and the analytical techniques to check the function of the devices and analyze the fluorescence signals obtained. The protocol also includes collection of forensic evidence in the form of hand wiping to collect GSR from the hands of a suspect or swabbing to collect GSR from a surface. Results from the lead sensor device are presented as example results, along with a demonstration of a positive test for GSR using a spent cartridge casing.

<table>
	<tbody>
		<tr>
			<td>1,3-dinitrobenzene, 97%</td>
			<td>Aldrich</td>
			<td>D194255-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>2,4-dinitrotoluene, 97%</td>
			<td>Aldrich</td>
			<td>101397-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>Fisher Scientific</td>
			<td>BP1423-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Fisher Scientific</td>
			<td>BP1760-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Antimony, Reference Standard Solution (1000ppm &#177;1%/Certified)</td>
			<td>Fisher Scientific</td>
			<td>SA450-100</td>
			<td>Standard in dilute HNO3</td>
		</tr>
		<tr>
			<td>Cut Smart Buffer</td>
			<td>New England BioLabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr>
			<td>Duplex Buffer</td>
			<td>Integrated DNA Technologies</td>
			<td>11-01-03-00</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRI-HF Restriction Enzyme</td>
			<td>New England BioLabs</td>
			<td>R3101S</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol, HPLC grade, denatured</td>
			<td>Acros Organics</td>
			<td>AC611050040</td>
			<td>Solvents do not need to be HPLC grade, ACS or reagent grade will work.</td>
		</tr>
		<tr>
			<td>Eurofins Genomics SimpleSeq DNA Sequencing Kits</td>
			<td>Eurofins Genomics</td>
			<td>SimpleSeq Kit Standard</td>
			<td></td>
		</tr>
		<tr>
			<td>Forward primer for colony PCR</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GCCGCTTGAATTCGTCATATAT-3&#8217;</td>
		</tr>
		<tr>
			<td>Forward primer for DNA sequencing</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GTAAAACGACGGCCAGTG-3&#8217;</td>
		</tr>
		<tr>
			<td>IBI Science High Speed Plasmid Mini-kit</td>
			<td>IBI Scientific</td>
			<td>IB47101</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Broth, Miller</td>
			<td>Fisher Scientific</td>
			<td>BP1426-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Lead, Reference Standard Solution (1000ppm &#177;1%/Certified)</td>
			<td>Fisher Scientific</td>
			<td>SL21-100</td>
			<td>Standard in dilute HNO3</td>
		</tr>
		<tr>
			<td>LeadOff Disposable Cleaning and Decon Wipes</td>
			<td>Hygenall</td>
			<td>45NRCN</td>
			<td>Sold in canisters or individually wrapped, any alcohol based wipe will work.</td>
		</tr>
		<tr>
			<td>Methanol, HPLC grade</td>
			<td>Fisher Scientific</td>
			<td>A452-4</td>
			<td>Solvents do not need to be HPLC grade, ACS or reagent grade will work.</td>
		</tr>
		<tr>
			<td>NEB 5-alpha Competent E. coli cells</td>
			<td>New England BioLabs</td>
			<td>C2987I</td>
			<td></td>
		</tr>
		<tr>
			<td>NheI-HF Restriction Enzyme</td>
			<td>New England BioLabs</td>
			<td>R3131S</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease free water</td>
			<td>New England BioLabs</td>
			<td>B1500S</td>
			<td></td>
		</tr>
		<tr>
			<td>OneTaq 2X Master Mix with Standard Buffer</td>
			<td>New England BioLabs</td>
			<td>M0482S</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmids from the registry of standard biological parts used for synthetic biology</td>
			<td>Registry of Standard Biological Parts</td>
			<td></td>
			<td>http://parts.igem.org/Main_Page</td>
		</tr>
		<tr>
			<td>Promoter Sequences</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>Sb promoter: 5&#8217;-GCATGAATTCAGTCAT 
			ATATGTTTTTGACTTATCCGCTTCGAAGAGAG 
			AGACACTACCTGCAACAATCGCTAGCGCAT-3&#8217; 3&#8217;-CGTACTTAAGCTCACTATATACAAAAACT 
			GAATAGGCGAAGCTTCTCTCTCTGTGATGGAC 
			GTTGTTAGCGATCGCGTA-5&#8217; 
			Pb promoter: 5&#8217;-GCATGAATTCGTCTTG 
			ACTCTATAGTAACTAAGGGTGTATAATCGGCA 
			ACGCGAGCTAGCGCAT-3&#8217; 3&#8217;-CGTACTTAAGCAGAACTGAGATATCATTG 
			ATCTCCCACATCTTAGCCGTTGCGCTGCGATCGCGTA-5&#8217; 
			TNT promoter: 5&#8217;GCATTCTAGATCAATT 
			TATTTGAACAAGGCGGTCAATTCTCTTCGATT 
			TTATCTCTCGTAAAAAAACGTGATACTCATCA 
			CATCGACGAAACAACGTCACTTATACAAAAAT 
			CACCTGCGAGAGATTAATTGAATTCGCAT3&#8217; 3&#8217;CGTAAGATCTAGTTAAATAAACTTGTTCCG 
			CCAGTTAAGAGAAGCTAAAATAGAGAGCATTT 
			TTTTGCACTATGAGTAGTGTAGCTGCTTTGTT 
			GCAGTGAATATGTTTTTAGTGGACGCTCTCTA 
			ATTAACTTAAGCGTA5&#8217;</td>
		</tr>
		<tr>
			<td>Reverse primer for colony PCR</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GCCGCTTGAATTCGTCTAGACT- 3&#8217;</td>
		</tr>
		<tr>
			<td>Reverse primer for DNA sequencing</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GGAAACAGCTATGACCATG-3&#8217;</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>New England BioLabs</td>
			<td>M0202S</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and application of a new bacterial biosensor for the presumptive detection of gunshot residue

MicRoboCop is a biosensor that has been designed for a unique application in forensic chemistry. MicRoboCop is a system made up of three devices that, when used together, can indicate the presence of gunshot residue (GSR) by producing a fluorescence signal in the presence of three key analytes (antimony, lead, and organic components of GSR). The protocol describes the synthesis of the biosensors using Escherichia coli (E. coli), and the analytical chemistry methods used to evaluate the selectivity and sensitivity of the sensors. The functioning of the system is demonstrated by using GSR collected from the inside of a spent cartridge casing. Once prepared, the biosensors can be stored until needed and can be used as a test for these key analytes. A positive response from all three analytes provides a presumptive positive test for GSR, while each individual device has applications for detecting the analytes in other samples (e.g., a detector for lead contamination in drinking water). The main limitation of the system is the time required for a positive signal; future work may involve studying different organisms to optimize the response time.

Fluorescence spectra for the RFP variant used in this work are shown in Figure 2. These data are from the PbRFP device as it responds to lead and the TNT-RFP device as it responds to two analytes, 2,4-DNT and 1,3-DNB. This figure shows the spectrum of a negative control (no analyte added), and the spectra at two different levels of analyte added. The maximum fluorescence signal for the RFP variant used was observed at 575 nm (excitation wavelength 500 nm). The data in <st...

Watch this Scientific Journal Video about Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue at JoVE.com

Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue

A protocol is presented using synthetic biology techniques to synthesize a set of bacterial biosensors for the analysis of gunshot residue, and to test the functioning of the devices for their intended use using fluorescence spectroscopy.

MicRoboCop is a biosensor that has been designed for a unique application in forensic chemistry. MicRoboCop is a system made up of three devices that, ...

This protocol describes the preparation and analysis of a unique biosensor that has been designed to detect the chemical components of gunshot residue. The use of biosensors for forensic applications is unique. It represents a low-cost, simple to use alternative to the highly specialized instrumentation typically used in forensic laboratories.The synthetic biology methods described can be used for any system that uses standard synthetic biology parts. The chemical analysis described is applicable to any biosensor that expresses red fluorescent protein. Demonstrating the procedure will be Andrea Soles and Elle Richardson, undergraduate students at Longwood University.To begin this procedure, add ten microliters of the previously isolated J10060 plasmid DNA to a microcentrifuge tube. Add eight microliters of water, and one microliter of each of the EcoRI and NHEL enzymes pre-mixed with one microliter of buffer. For the promoter DNA, add ten microliters of annealed promoter DNA sequences to a fresh microcentrifuge tube.Add eight microliters of water, and one microliter of each of the EcoRI and NHEL enzymes pre-mixed with one microliter of buffer. Using a pipette set to ten microliters, gently pipette the samples up and down to mix. Incubate the samples at 37 degrees Celsius for 30 minutes.Then, heat and active the enzymes at 80 degrees Celsius for five minutes. Store the digested DNA in a freezer until ready to proceed. First, use the plasmid and promoter DNA that were previously digested to set up the reaction in a microcetrifuge tube on ice, as outlined in table one of the text protocol.Making sure to add the T4 DNA Ligase last. Pipette up and down gently to mix the reaction, and centrifuge briefly. Incubate at room temperature for ten minutes.Then, heat and activate at 65 degrees Celsius for ten minutes. Perform the transformation as outlined in the text protocol. First, set up the reaction mixtures for PCR as outlined in table two of the text protocol.Gently pipette up and down to mix the reactions. Using a yellow pipette tip, scrape a colony of the transformed E.coli. Transfer a swipe of this E.coli onto a new LB-ampicillin agar plate that has been sectioned off, and then insert the pipette tip into the PCR tube.Shake the pipette tip to mix the E.Coli with the PCR mix. Repeat this process three more times for additional colonies. Then, load the PCR tubes into a PCR machine, and begin thermocycling as outlined in table three of the text protocol.To begin label the appropriate number of sterile culture tubes as outlined in table four of the text protocol. Add two milliliters of the prepared culture broth to each tube. Add the anilite stock solution to the tubes as outlined in table four.Then, place the snap caps on the culture tubes so that they are loose to allow air flow into the tube. Vortex each culture tube. After this, place the tubes into a shaking incubator at 37 degrees Celsius and at 220 RPM for at least 24 hours.First, use an ethanol based wipe designed for removing lead to wipe all surfaces of the hands, including between the fingers. Store the wipes in an appropriately labeled sealable baggie until analysis. Use an alcohol based wipe to wipe down any large surfaces to be tested.Use a cotton swap moistened with ethanol to wipe down any small surfaces to be tested. Wearing clean gloves and using scissors that have been cleaned with alcohol, cut a section that is approximately one square centimeter out of the center of the wipe. Then, place the cut piece of wipe, or cotton swab, directly into a culture tube containing two milliliters of the sensor bacteria, and ensure that it is completely submerged in the broth.Prepare the spectrometer to collect fluorescent submission at the appropriate wavelength for the RFP variant, with an excitation wavelength of 500 nanometers. Then, use a vortex mixer to shake the tubes. Carefully transfer each supernatant to a low volume cuvette, and collect the emission intensity.Using a vortex mixer, shake the tubes. Transfer 200 microliters of the broth to a well in the well plate. Record which samples went into each well of this plate.Set up the flourometer to collect the emission intensity at the appropriate wavelength for the RFP variant. The fluorescence spectra for a representative RFP variant shows both the negative control and the spectra at two different levels of anilite added. The maximum fluorescent signal for the RFP variant used in this work is observed at 575 nanometers.Representative data is collected for the same set of solutions, from both the portable spectrometer and the fluorometer. There is a general trend of the fluorescence increasing as the concentration of anilite increases. It is worth noting that at high concentrations, greater than about 800 parts per billion for the lead sensor, the response drops off due to the toxicity of lead at such a high concentration.Analysis of ethanol swab samples from the inside of a spent 40 caliber cartridge casing provides proof of principle results. The positive results from each of the three sensor bacteria, indicates a positive test for gunshot residue. The biosensors prepared in this protocol can also be used individually to detect contamination in food, water, or environmental samples.This technique paves the way for researchers to develop biosensors using standard synthetic biology techniques for a variety of different chemical anilites. Personal protective equipment should be worn, and analysts should wash hands and disinfect surfaces after handling E.coli. Wastes should be autoclaved, and any wastes containing heavy metal should be treated accordingly.

Research

JoVE Journal

Chemistry

Preparation and Use of Samarium Diiodide (SmI2) in Organic Synthesis: The Mechanistic Role of HMPA and Ni(II) Salts in the Samarium Barbier Reaction

Preparation and Use of Samarium Diiodide SmI2 in Organic Synthesis: The Mechanistic Role of HMPA and NiII Salts in the Samarium Barbier Reaction

Although initially considered an esoteric reagent, SmI2 has become a common tool for synthetic organic chemists. SmI2 is generated through the addition of ...

Synthesis of Hypervalent Iodonium Alkynyl Triflates for the Application of Generating Cyanocarbenes

The procedures described in this article involve the synthesis and isolation of hypervalent iodonium alkynyl triflates (HIATs) and their subsequent ...

Isolation and Preparation of Bacterial Cell Walls for Compositional Analysis by Ultra Performance Liquid Chromatography

The bacterial cell wall is critical for the determination of cell shape during growth and division, and maintains the mechanical integrity of cells in the ...

Preparation of Mica and Silicon Substrates for DNA Origami Analysis and Experimentation

The designed nature and controlled, one-pot synthesis of DNA origami provides exciting opportunities in many fields, particularly nanoelectronics. Many of ...

Protocol for the Synthesis of Ortho-trifluoromethoxylated Aniline Derivatives

Protocol for the Synthesis of Ortho-trifluoromethoxylated Aniline Derivatives

Molecules bearing trifluoromethoxy (OCF3) group often show desired pharmacological and biological properties. However, facile synthesis of ...

Synthesis of Protein Bioconjugates via Cysteine-maleimide Chemistry

Synthesis of Protein Bioconjugates via Cysteine-maleimide Chemistry

The chemical linking or bioconjugation of proteins to fluorescent dyes, drugs, polymers and other proteins has a broad range of applications, such as the ...

Facile Synthesis of Worm-like Micelles by Visible Light Mediated Dispersion Polymerization Using Photoredox Catalyst

Presented herein is a protocol for the facile synthesis of worm-like micelles by visible light mediated dispersion polymerization. This approach begins ...

Preparation of Chitosan-based Injectable Hydrogels and Its Application in 3D Cell Culture

The protocol presents a facile, efficient, and versatile method to prepare chitosan-based hydrogels using dynamic imine chemistry. The hydrogel is ...

Total Internal Reflection Absorption Spectroscopy (TIRAS) for the Detection of Solvated Electrons at a Plasma-liquid Interface

Total Internal Reflection Absorption Spectroscopy TIRAS for the Detection of Solvated Electrons at a Plasma-liquid Interface

The total internal reflection absorption spectroscopy (TIRAS) method presented in this article uses an inexpensive diode laser to detect solvated ...

Color Spot Test As a Presumptive Tool for the Rapid Detection of Synthetic Cathinones

Synthetic cathinones are a large class of new psychoactive substances (NPS) that are increasingly prevalent in drug seizures made by law enforcement and ...