The authors wish to acknowledge the students at Longwood University in BIOL 324 (Genetics) and the students in CHEM 403 (Advanced Chemical Laboratory Problem Solving) who were involved in the initial preparation and testing of the antimony and lead biosensors. The idea for MicRoboCop was conceived at the GCAT SynBIO workshop (summer 2014), which is funded by NSF and Howard Hughes Medical Institute and hosted by the University of Maryland Baltimore County. The authors also acknowledge funding received from Longwood University&#8217;s Cook-Cole College of Arts and Sciences and the GCAT SynBio Alumni Grant.

NOTE: Synthesis of E. coli expressing RFP is presented.
1. Preparation of plasmid DNA from E. coli
<ol>
	<li>Thaw E.coli containing a plasmid with an RFP gene and ampicillin resistance gene and grow the E.coli on Luria Broth (LB) agar plates containing 100 &#181;g/mL ampicillin at 37 &#176;C for 24 h. For example, use the J10060 plasmid from the registry of standard biological parts used for synthetic biology (see Table of Materials). The J10060 plasmid includes a gene for RFP (red fluorescent protein) under the control of a pBad promoter region and an ampicillin resistance gene. Alternatively, transform E.coli (refer to step 3.2) with the plasmid prior to growth on the LB agar plates.</li>
	<li>Follow a standard miniprep protocol (see Table of Materials) to isolate DNA from 1 mL of an E. coli culture that contains the J10060 plasmid. The purpose of the following protocol is to remove the pBad promoter and replace it with the desired promoter for the device.</li>
	<li>Following the plasmid miniprep, store DNA in the freezer until ready for digestion.</li>
</ol>
2. Restriction enzyme digestion
<ol>
	<li>Set up the following reaction in a microcentrifuge tube for EcoRI and NheI digestion: 10 &#956;L of J10060 plasmid DNA (isolated in step 1), 8 &#956;L of water, and 1 &#956;L each of EcoRI and NheI enzymes pre-mixed with 1 &#956;L of buffer (see Table of Materials).</li>
	<li>For the promoter DNA, set up the following reaction in a microcentrifuge tube for EcoRI and NheI digestion: 10 &#956;L of annealed promoter DNA sequences (8 &#956;L of water, and 1 &#956;L each of EcoRI and NheI enzymes pre-mixed with 1 &#956;L of buffer.
	<ol>
		<li>For Sb-, Pb-, or TNT-RFP (see Table of Materials), dissolve the oligonucleotides in buffer (30 mM HEPES, pH 7.5; 100 mM potassium acetate), incubate in equal molar concentrations, heat to 94 &#176;C for 2 min, and gradually cool at room temperature).</li>
	</ol>
	</li>
	<li>Mix the samples by pipetting gently up and down with the pipette set to 10 &#956;L.</li>
	<li>Incubate for 30 min at 37 &#176;C.</li>
	<li>Heat inactivate the enzymes at 80 &#176;C for 5 min.</li>
	<li>Store the digested DNA in the freezer until ready for the next step.</li>
</ol>
3. Ligation and transformation
<ol>
	<li>Ligation
	<ol>
		<li>Using the plasmid and promoter DNA that were double digested with EcoRI and NheI in step 2, set up the reaction mixture shown in Table 1 in a microcentrifuge tube on ice; add the T4 DNA Ligase last. 
		NOTE: Table 1 shows a ligation using a molar ratio of 1:3 vector to insert for the indicated DNA sizes.</li>
		<li>Gently mix the reaction by pipetting up and down and microcentrifuge briefly.</li>
		<li>Incubate at room temperature for 10 min.</li>
		<li>Heat inactivate at 65 &#176;C for 10 min.</li>
	</ol>
	</li>
	<li>Transformation
	<ol>
		<li>Thaw a tube with 20 &#181;L of DH5-alpha Competent E. coli cells on ice until the last ice crystals disappear.</li>
		<li>Add 5 &#181;L of plasmid DNA to the cell mixture. Carefully flick the tube 4-5 times to mix the cells and DNA.</li>
		<li>Place the mixture on ice for 2 min.</li>
		<li>Heat shock at exactly 42 &#176;C for exactly 30 s. Do not mix.</li>
		<li>Place on ice for 2 min. Do not mix.</li>
		<li>Pipette 380 &#181;L of room temperature SOC into the mixture. Immediately spread onto an LB agar plate containing ampicillin (100 &#181;g/mL) and incubate overnight at 37 &#176;C.</li>
		<li>Check the plates within 24 h for growth.</li>
		<li>Seal the plates with sealing film and store in the refrigerator until ready for next step.</li>
	</ol>
	</li>
</ol>
4. Colony PCR
<ol>
	<li>Add to a PCR tube (set up 4 reaction tubes) the reaction mixtures shown in Table 2.</li>
	<li>Gently mix the reactions by pipetting up and down.</li>
	<li>Using a yellow pipette tip, scrape a colony (or very small region) of the transformed E. coli. Transfer a swipe of this E. coli onto a new LB/ampicillin/agar plate that has been sectioned off, and then insert the pipette tip into the PCR tube. Shake the pipette tip to mix the E. coli with the PCR mix. Repeat three more times for additional colonies. Transfer the PCR tubes to a PCR machine and begin thermocycling using the program shown in Table 3.</li>
	<li>Run gel electrophoresis using a 2% agarose gel in TAE to determine which colonies have the best ligation into the plasmid and grow those colonies on a new plate.</li>
	<li>Store the plates in the refrigerator until ready for testing. Prepare a liquid culture in Luria broth with 100 &#181;g/mL ampicillin added for chemical testing.</li>
</ol>
5. DNA Sequencing
<ol>
	<li>For each sample, add 5 &#181;L of plasmid, 4 &#181;L of the sequencing primer, and 3 &#181;L of deionized water.</li>
	<li>Place this mixture into a tube and send it for DNA sequencing (see Table of Materials).</li>
	<li>Analyze DNA sequence data to compare the expected and observed DNA sequences using DNA sequence analysis software to ensure that there is no mutation and that the genes were correctly inserted. 
	NOTE: Using E. coli as a chemical sensor is presented below.</li>
</ol>
6. Preparation of E. coli cultures
<ol>
	<li>Prepare LB with 100 &#181;g/mL ampicillin for liquid cultures.</li>
	<li>Prepare liquid cultures of the sensor bacteria, the positive control* bacteria and the negative control** bacteria. 
	NOTE: *Positive control bacteria: E. coli containing a plasmid with the RFP gene under control of a constitutive promoter; plasmid E1010 from the registry of standard biological parts used for synthetic biology (see Table of Materials) was used in this work. 
	**Negative control bacteria: E. coli containing a plasmid with the RFP gene under control of a different promoter, such as the pBad promoter (plasmid J10060 from the registry of standard biological parts used for synthetic biology (see Table of Materials)) or a plasmid that does not have the RFP gene.</li>
	<li>Place the cultures into a shaking incubator at 37 &#176;C and 220 rpm for a minimum of 8 h, maximum of 18 h. Cloudy broth indicates bacterial growth.</li>
</ol>
7. Titrating E. coli to check function of device
NOTE: Once the sensors have been titrated to check function, this step does not need to be repeated. A positive control in the form of addition of lead, antimony, and 2,4-DNT or 1,3-dinitrobenzene (1,3-DNB) can check the function of the devices for each use without the need for the full titration.
<ol>
	<li>Prepare a stock solution of the analyte(s) of interest at a concentration of 10 ppm in water. If solubility is an issue, use a 50/50 water/methanol mixture.</li>
	<li>Using Table 4 as a guide, label the appropriate number of sterile culture tubes and place 2 mL of the cultured broth (from protocol step 6) into each tube. 
	NOTE: In order to determine a general analytical range, do at least three different levels of an analyte with the sensor bacteria, one level with the negative control, and one level with the positive control. There should also be one tube of each of the bacteria that has no added metal (another type of negative control). To more accurately determine analytical range and limits of detection, use a larger range of analyte concentrations.</li>
	<li>Add analyte stock solution to the tubes containing 2 mL of broth as noted in Table 4, place the snap caps on the culture tube so that they are loose (to allow air flow into the tube), and vortex the culture tube.</li>
	<li>Leaving the snap caps loosely on the culture tubes, place into a shaking incubator at 220 rpm and 37 &#176;C for at least 24 h.</li>
	<li>Remove the tubes from the incubator, snap the caps onto the tubes tightly, and store the tubes in the refrigerator until ready for fluorescence analysis.</li>
</ol>
8. Using E. coli as chemical sensor for GSR
<ol>
	<li>Using an ethanol-based wipe designed for removing lead (see Table of Materials), wipe all surfaces of the hands, including between the fingers. Use a separate wipe for each hand. Store the wipes in an appropriately labelled sealable baggie until analysis.</li>
	<li>For surfaces to be tested: use an alcohol-based wipe for large surfaces or a cotton swab moistened with ethanol for small surfaces. 
	NOTE: To demonstrate the sensors&#8217; response to GSR, the inside of a spent .40 caliber cartridge casing was swabbed with an ethanol moistened cotton swab.</li>
	<li>Wearing clean gloves and using scissors that have been cleaned with alcohol, cut an approximately 1 cm2 section out of the center of the wipe.</li>
	<li>Place the cut piece of the hand wipe or the cotton swab directly into a culture tube that contains 2 mL of the sensor bacteria, ensuring that it is submerged in the broth.</li>
	<li>Proceed as described above in steps 7.4 &#8211; 7.5.</li>
</ol>
9. Fluorescence analysis using portable spectrometer (see Table of Materials)
<ol>
	<li>Use a vortex mixer to shake the tubes.</li>
	<li>Prepare the spectrometer to collect fluorescence emission at the appropriate wavelength for your RFP variant with an excitation wavelength of 500 nm.</li>
	<li>Use the Luria broth to record a blank spectrum.</li>
	<li>Carefully transfer each supernatant to a low volume cuvette and collect the emission intensity.</li>
</ol>
10. Fluorescence analysis using 96-well plate reader (see Table of Materials)
<ol>
	<li>Use a vortex mixer to shake the tubes.</li>
	<li>Transfer 200 mL of the broth to a well in the well plate. Record which samples went into each well of the plate.</li>
	<li>Set up the fluorimeter to collect the emission intensity at the appropriate wavelength for the RFP variant.</li>
</ol>
11. Data analysis
<ol>
	<li>Using the signal obtained from all negative controls (RFP negative bacteria or sensor bacteria with no analyte added), calculate an average fluorescence signal for the background.</li>
	<li>Subtract the average background signal from each fluorescence signal obtained for the sensor bacteria to get a background corrected fluorescence intensity.</li>
	<li>Estimate the signal-to-noise (S/N) ratio by dividing the background corrected fluorescence intensity by the average background signal. If the S/N ratio is greater than 3, the test is positive.</li>
</ol>

<ol>
	<li>Eschner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#34;The+Story+of+the+Real+Canary+in+the+Coal+Mine.&#34;.">&#34;The Story of the Real Canary in the Coal Mine.&#34;.</a> The Smithsonian Magazine. , (2016).</li><li>Roda, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+in+chemical+luminescence-based+biosensors:+A+critical+review.">Progress in chemical luminescence-based biosensors: A critical review.</a> Biosensors &#38; Bioelectronics. 76, 164-179 (2016).</li><li>He, W., Yuan, S., Zhong, W. H., Siddikee, M. A., Dai, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+genetically+engineered+microbial+whole-cell+biosensors+for+combined+chemosensing.">Application of genetically engineered microbial whole-cell biosensors for combined chemosensing.</a> Applied Microbiology and Biotechnology. 100 (3), 1109-1119 (2016).</li><li>Dalby, O., Butler, D., Birkett, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Gunshot+Residue+and+Associated+Materials-A+Review.">Analysis of Gunshot Residue and Associated Materials-A Review.</a> Journal of Forensic Sciences. 55 (4), 924-943 (2010).</li><li>Bell, S., Seitzinger, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+binary+presumptive+assays+to+probabilistic+assessments:+Differentiation+of+shooters+from+non-shooters+using+IMS,+OGSR,+neural+networks,+and+likelihood+ratios.">From binary presumptive assays to probabilistic assessments: Differentiation of shooters from non-shooters using IMS, OGSR, neural networks, and likelihood ratios.</a> Forensic Science International. 263, 176-185 (2016).</li><li>O&#39;Mahony, A. M., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+Detection+of+Gunshot+Residue+for+Forensic+Analysis:+A+Review.">Electrochemical Detection of Gunshot Residue for Forensic Analysis: A Review.</a> Electroanalysis. 25 (6), 1341-1358 (2013).</li><li>Vigneshvar, S., Sudhakumari, C. C., Senthilkumaran, B., Prakash, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+Advances+in+Biosensor+Technology+for+Potential+Applications+-+An+Overview.">Recent Advances in Biosensor Technology for Potential Applications - An Overview.</a> Frontiers in Bioengineering and Biotechnology. 4, 9 (2016).</li><li>Fernandez, M., Morel, B., Ramos, J. L., Krell, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paralogous+Regulators+ArsR1+and+ArsR2+of+Pseudomonas+putida+KT2440+as+a+Basis+for+Arsenic+Biosensor+Development.">Paralogous Regulators ArsR1 and ArsR2 of Pseudomonas putida KT2440 as a Basis for Arsenic Biosensor Development.</a> Applied and Environmental Microbiology. 82 (14), 4133-4144 (2016).</li><li>Porter, S. E. G., Barber, A. E., Colella, O. K., Roach, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+Biological+Organisms+as+Chemical+Sensors:+The+MicRoboCop+Project.">Using Biological Organisms as Chemical Sensors: The MicRoboCop Project.</a> Journal of Chemical Education. 95 (8), 1392-1397 (2018).</li><li>Borremans, B., Hobman, J. L., Provoost, A., Brown, N. L., Van der Lelie, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+functional+analysis+of+the+pbr+lead+resistance+determinant+of+Ralstonia+metallidurans+CH34.">Cloning and functional analysis of the pbr lead resistance determinant of Ralstonia metallidurans CH34.</a> Journal of Bacteriology. 183 (19), 5651-5658 (2001).</li><li>Hobman, J. L., Julian, D. J., Brown, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cysteine+coordination+of+Pb(II)+is+involved+in+the+PbrR-dependent+activation+of+the+lead-resistance+promoter,+PpbrA,+from+Cupriavidus+metallidurans+CH34.">Cysteine coordination of Pb(II) is involved in the PbrR-dependent activation of the lead-resistance promoter, PpbrA, from Cupriavidus metallidurans CH34.</a> Bmc Microbiology. 12, (2012).</li><li>Yagur-Kroll, S., Amiel, E., Rosen, R., Belkin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+2,4-dinitrotoluene+and+2,4,6-trinitrotoluene+by+an+Escherichia+coli+bioreporter:+performance+enhancement+by+directed+evolution.">Detection of 2,4-dinitrotoluene and 2,4,6-trinitrotoluene by an Escherichia coli bioreporter: performance enhancement by directed evolution.</a> Applied Microbiology and Biotechnology. 99 (17), 7177-7188 (2015).</li><li>Gorman, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#34;Guns+in+America:+The+Debate+Over+Lead+Based+Bullets.&#34;.">&#34;Guns in America: The Debate Over Lead Based Bullets.&#34;.</a> Newsweek. , (2017).</li><li>Yuksel, B., Ozler-Yigiter, A., Bora, T., Sen, N., Kayaalti, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFAAS+Determination+of+Antimony,+Barium,+and+Lead+Levels+in+Gunshot+Residue+Swabs:+An+Application+in+Forensic+Chemistry.">GFAAS Determination of Antimony, Barium, and Lead Levels in Gunshot Residue Swabs: An Application in Forensic Chemistry.</a> Atomic Spectroscopy. 37 (4), 164-169 (2016).</li><li>Blakey, L. S., Sharples, G. P., Chana, K., Birkett, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fate+and+Behavior+of+Gunshot+Residue-A+Review.">Fate and Behavior of Gunshot Residue-A Review.</a> Journal of Forensic Sciences. 63 (1), 9-19 (2018).</li><li>Yagur-Kroll, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+bioreporters+for+the+detection+of+2,4-dinitrotoluene+and+2,4,6-trinitrotoluene.">Escherichia coli bioreporters for the detection of 2,4-dinitrotoluene and 2,4,6-trinitrotoluene.</a> Applied Microbiology and Biotechnology. 98 (2), 885-895 (2014).</li></ol>

The authors have no competing financial interests or other conflicts of interest to disclose.

Modifications and troubleshooting
The experiment described in Table 4 can be modified in any way appropriate to the sensors that have been designed. The most important aspect of a chemical sensor is to evaluate its sensitivity and specificity. It is beneficial to ensure that a wide range of concentrations of the analyte is analyzed to determine the useful analytical range of the sensor. It is also worth determining a maximum level of analyte for the cells. Bec...

A biosensor is any analytical device that uses biological components (such as proteins, nucleic acids, or whole organisms) that produce a response that can be used for the detection of a chemical substance or analyte. As an example, the coal mining industry used a biosensor for much of the 20th century to detect the presence of toxic mine gases: the canary in the coal mine1. The biological organism&#39;s (canary&#39;s) response (death or distress) to a chemical analyte (carbon monoxide) was observed by the miners in order to protect the workers. In a more modern and sophisticated example, bacteria can be altered using synthetic biology techniques to respond to the presence of a certain chemical analyte by exhibiting a specific response, such as the expression of a fluorescent protein.
Synthetic biology is a broad term that refers to the construction of biological devices and systems that do not exist naturally, or the re-design of existing biological systems for a specific purpose2. Synthetic biology is distinguished from genetic engineering by a standard methodology and the existence of standardized parts (standard synthetic biology genetic elements) that can be used to synthesize devices and systems. A part is introduced into the genome of a device, an organism such as a bacterium, to express a certain trait that will serve as an indication of function. For example, in many synthetic devices, the expression of a fluorescent protein is introduced into a single celled organism as a reporter protein. Multiple devices can be combined into a system. The genomes of microorganisms such as bacteria are easy to manipulate in this manner. Numerous examples of biosensors specific to a wide range of chemical analytes have been reported in the literature over the last decade3,4.
In this work, the MicRoboCop system is presented as an example of a biosensor designed using synthetic biology techniques with novel applications in forensic and environmental chemistry. MicRoboCop is a system of three separate devices that, when combined, will allow Escherichia coli to express red fluorescent protein (RFP) in the presence of gunshot residue (GSR) that has been collected from a person&#8217;s hands or a surface. Each of the three devices responds to a specific chemical analyte that is known to be a component of GSR5. The three analytes to which the system responds are I. 2,4,6-trinitrotoluene (TNT) and related compounds, II. lead (in the form of lead ions), and III. antimony (also in the form of ions).
GSR consists of many different chemical substances, but the three usually used to identify a residue as GSR are barium, lead, and antimony5. The standard evidentiary test for the identification of GSR is to use scanning electron microscopy (SEM) with energy dispersive X-ray fluorescence (EDX)5. SEM-EDX allows analysts to identify the unique morphology and the elemental components of GSR. Presently, there are few widely used binary presumptive tests available. One recently published presumptive test uses ion-mobility spectroscopy (IMS), which is specialized equipment that might not be available in many labs6. There are also a few color &#8220;spot&#8221; tests that can be used, though they are typically used for distance determination or for GSR identification on bullet holes and wounds5. Additionally, there has been some limited attention in the literature to electrochemical tests for GSR that employ voltammetric analysis, which has the advantage of potentially being field portable, or anodic stripping voltammetry, which is an extremely sensitive method for metallic elements7. There is very little mention in the literature of biosensors designed specifically for the purpose of detecting GSR, though some biosensors for other forensic applications have been published8.
The biological elements for each device in the MicRoboCop system, and the plasmid construction, are illustrated in Figure 1. The curved arrow in Figure 1b represents the promoter region that is activated in the presence of the analyte, the oval is the ribosomal binding site that allows translation of the reporter protein, the gray box labeled RFP is the gene that expresses red fluorescent protein, and the red octagon is the transcription termination site. All three devices will be used together as a system to detect GSR. Each device with a specific promoter (SbRFP, PbRFP, and TNT-RFP) will be incubated with the sample that is being tested and fluorescence of RFP will be measured. RFP will only be expressed if the appropriate chemical analyte is present and activates the promoter region. Three devices that respond to some of the chemical substances present in GSR have been designed and are presented in this work.
The promoters used in the three MicRoboCop devices are an arsenic and antimony sensitive promoter, SbRFP9,10, a lead sensitive promoter, PbRFP11,12 and a TNT sensitive promoter, TNT-RFP13. Because a search in the literature revealed no promoter designed to respond to barium, the TNT promoter was selected instead since this promoter is sensitive to a number of structurally related compounds (in particular, 2,4-dinitrotoluene and dinitrobenzene) that are known to be a part of the organic compounds left behind in GSR. This promoter has successfully been used to specifically detect minute quantities of TNT and 2,4-dinitrotoluene (2,4-DNT) in buried land mines13. Using the three devices together as a system, a positive test for GSR will produce fluorescence in all three devices. A fluorescence signal in only one or two devices will indicate another environmental source of the analyte(s) or in the case of the TNT promoter, activation by a compound that is not an organic compound left behind in GSR. By using all three devices together, the possibility of a false positive results due to environmental sources is minimized. Lead-free ammunition, which is gaining in popularity, still represents only about 5% of ammunition sales in the United States; hence, false negative results due to the absence of lead may be a possibility but there is still utility in a sensor that uses lead as a marker for GSR14. In addition to this specific forensic application, each device can be used separately for purposes of detecting environmental contaminants.
The protocols presented include the synthetic biology techniques used to create the devices (sensor bacteria) and the analytical techniques to check the function of the devices and analyze the fluorescence signals obtained. The protocol also includes collection of forensic evidence in the form of hand wiping to collect GSR from the hands of a suspect or swabbing to collect GSR from a surface. Results from the lead sensor device are presented as example results, along with a demonstration of a positive test for GSR using a spent cartridge casing.

<table>
	<tbody>
		<tr>
			<td>1,3-dinitrobenzene, 97%</td>
			<td>Aldrich</td>
			<td>D194255-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>2,4-dinitrotoluene, 97%</td>
			<td>Aldrich</td>
			<td>101397-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>Fisher Scientific</td>
			<td>BP1423-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Fisher Scientific</td>
			<td>BP1760-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Antimony, Reference Standard Solution (1000ppm &#177;1%/Certified)</td>
			<td>Fisher Scientific</td>
			<td>SA450-100</td>
			<td>Standard in dilute HNO3</td>
		</tr>
		<tr>
			<td>Cut Smart Buffer</td>
			<td>New England BioLabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr>
			<td>Duplex Buffer</td>
			<td>Integrated DNA Technologies</td>
			<td>11-01-03-00</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRI-HF Restriction Enzyme</td>
			<td>New England BioLabs</td>
			<td>R3101S</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol, HPLC grade, denatured</td>
			<td>Acros Organics</td>
			<td>AC611050040</td>
			<td>Solvents do not need to be HPLC grade, ACS or reagent grade will work.</td>
		</tr>
		<tr>
			<td>Eurofins Genomics SimpleSeq DNA Sequencing Kits</td>
			<td>Eurofins Genomics</td>
			<td>SimpleSeq Kit Standard</td>
			<td></td>
		</tr>
		<tr>
			<td>Forward primer for colony PCR</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GCCGCTTGAATTCGTCATATAT-3&#8217;</td>
		</tr>
		<tr>
			<td>Forward primer for DNA sequencing</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GTAAAACGACGGCCAGTG-3&#8217;</td>
		</tr>
		<tr>
			<td>IBI Science High Speed Plasmid Mini-kit</td>
			<td>IBI Scientific</td>
			<td>IB47101</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Broth, Miller</td>
			<td>Fisher Scientific</td>
			<td>BP1426-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Lead, Reference Standard Solution (1000ppm &#177;1%/Certified)</td>
			<td>Fisher Scientific</td>
			<td>SL21-100</td>
			<td>Standard in dilute HNO3</td>
		</tr>
		<tr>
			<td>LeadOff Disposable Cleaning and Decon Wipes</td>
			<td>Hygenall</td>
			<td>45NRCN</td>
			<td>Sold in canisters or individually wrapped, any alcohol based wipe will work.</td>
		</tr>
		<tr>
			<td>Methanol, HPLC grade</td>
			<td>Fisher Scientific</td>
			<td>A452-4</td>
			<td>Solvents do not need to be HPLC grade, ACS or reagent grade will work.</td>
		</tr>
		<tr>
			<td>NEB 5-alpha Competent E. coli cells</td>
			<td>New England BioLabs</td>
			<td>C2987I</td>
			<td></td>
		</tr>
		<tr>
			<td>NheI-HF Restriction Enzyme</td>
			<td>New England BioLabs</td>
			<td>R3131S</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease free water</td>
			<td>New England BioLabs</td>
			<td>B1500S</td>
			<td></td>
		</tr>
		<tr>
			<td>OneTaq 2X Master Mix with Standard Buffer</td>
			<td>New England BioLabs</td>
			<td>M0482S</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmids from the registry of standard biological parts used for synthetic biology</td>
			<td>Registry of Standard Biological Parts</td>
			<td></td>
			<td>http://parts.igem.org/Main_Page</td>
		</tr>
		<tr>
			<td>Promoter Sequences</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>Sb promoter: 5&#8217;-GCATGAATTCAGTCAT 
			ATATGTTTTTGACTTATCCGCTTCGAAGAGAG 
			AGACACTACCTGCAACAATCGCTAGCGCAT-3&#8217; 3&#8217;-CGTACTTAAGCTCACTATATACAAAAACT 
			GAATAGGCGAAGCTTCTCTCTCTGTGATGGAC 
			GTTGTTAGCGATCGCGTA-5&#8217; 
			Pb promoter: 5&#8217;-GCATGAATTCGTCTTG 
			ACTCTATAGTAACTAAGGGTGTATAATCGGCA 
			ACGCGAGCTAGCGCAT-3&#8217; 3&#8217;-CGTACTTAAGCAGAACTGAGATATCATTG 
			ATCTCCCACATCTTAGCCGTTGCGCTGCGATCGCGTA-5&#8217; 
			TNT promoter: 5&#8217;GCATTCTAGATCAATT 
			TATTTGAACAAGGCGGTCAATTCTCTTCGATT 
			TTATCTCTCGTAAAAAAACGTGATACTCATCA 
			CATCGACGAAACAACGTCACTTATACAAAAAT 
			CACCTGCGAGAGATTAATTGAATTCGCAT3&#8217; 3&#8217;CGTAAGATCTAGTTAAATAAACTTGTTCCG 
			CCAGTTAAGAGAAGCTAAAATAGAGAGCATTT 
			TTTTGCACTATGAGTAGTGTAGCTGCTTTGTT 
			GCAGTGAATATGTTTTTAGTGGACGCTCTCTA 
			ATTAACTTAAGCGTA5&#8217;</td>
		</tr>
		<tr>
			<td>Reverse primer for colony PCR</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GCCGCTTGAATTCGTCTAGACT- 3&#8217;</td>
		</tr>
		<tr>
			<td>Reverse primer for DNA sequencing</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GGAAACAGCTATGACCATG-3&#8217;</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>New England BioLabs</td>
			<td>M0202S</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and application of a new bacterial biosensor for the presumptive detection of gunshot residue

MicRoboCop is a biosensor that has been designed for a unique application in forensic chemistry. MicRoboCop is a system made up of three devices that, when used together, can indicate the presence of gunshot residue (GSR) by producing a fluorescence signal in the presence of three key analytes (antimony, lead, and organic components of GSR). The protocol describes the synthesis of the biosensors using Escherichia coli (E. coli), and the analytical chemistry methods used to evaluate the selectivity and sensitivity of the sensors. The functioning of the system is demonstrated by using GSR collected from the inside of a spent cartridge casing. Once prepared, the biosensors can be stored until needed and can be used as a test for these key analytes. A positive response from all three analytes provides a presumptive positive test for GSR, while each individual device has applications for detecting the analytes in other samples (e.g., a detector for lead contamination in drinking water). The main limitation of the system is the time required for a positive signal; future work may involve studying different organisms to optimize the response time.

Fluorescence spectra for the RFP variant used in this work are shown in Figure 2. These data are from the PbRFP device as it responds to lead and the TNT-RFP device as it responds to two analytes, 2,4-DNT and 1,3-DNB. This figure shows the spectrum of a negative control (no analyte added), and the spectra at two different levels of analyte added. The maximum fluorescence signal for the RFP variant used was observed at 575 nm (excitation wavelength 500 nm). The data in <st...

Watch this Scientific Journal Video about Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue at JoVE.com

Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue

A protocol is presented using synthetic biology techniques to synthesize a set of bacterial biosensors for the analysis of gunshot residue, and to test the functioning of the devices for their intended use using fluorescence spectroscopy.

MicRoboCop is a biosensor that has been designed for a unique application in forensic chemistry. MicRoboCop is a system made up of three devices that, ...

preparation-application-new-bacterial-biosensor-for-presumptive

Research

JoVE Journal

Chemistry

7.9K Views.  Longwood University. A protocol is presented using synthetic biology techniques to synthesize a set of bacterial biosensors for the analysis of gunshot residue, and to test the functioning of the devices for their intended use using fluorescence spectroscopy.

Video: Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue

Preparation and Use of Samarium Diiodide (SmI2) in Organic Synthesis: The Mechanistic Role of HMPA and Ni(II) Salts in the Samarium Barbier Reaction

Although initially considered an esoteric reagent, SmI2 has become a common tool for synthetic organic chemists. SmI2 is generated through the addition of molecular iodine to samarium metal in THF.1,2-3 It is a mild and selective single electron reductant and its versatility is a result of its ability to initiate a wide range of reductions including C-C bond-forming and cascade or sequential reactions. SmI2 can reduce a variety of functional groups including sulfoxides and sulfones, phosphine oxides, epoxides, alkyl and aryl halides, carbonyls, and conjugated double bonds.2-12 One of the fascinating features of SmI-2-mediated reactions is the ability to manipulate the outcome of reactions through the selective use of cosolvents or additives. In most instances, additives are essential in controlling the rate of reduction and the chemo- or stereoselectivity of reactions.13-14 Additives commonly utilized to fine tune the reactivity of SmI2 can be classified into three major groups: (1) Lewis bases (HMPA, other electron-donor ligands, chelating ethers, etc.), (2) proton sources (alcohols, water etc.), and (3) inorganic additives (Ni(acac)2, FeCl3, etc).3
Understanding the mechanism of SmI2 reactions and the role of the additives enables utilization of the full potential of the reagent in organic synthesis. The Sm-Barbier reaction is chosen to illustrate the synthetic importance and mechanistic role of two common additives: HMPA and Ni(II) in this reaction. The Sm-Barbier reaction is similar to the traditional Grignard reaction with the only difference being that the alkyl halide, carbonyl, and Sm reductant are mixed simultaneously in one pot.1,15 Examples of Sm-mediated Barbier reactions with a range of coupling partners have been reported,1,3,7,10,12 and have been utilized in key steps of the synthesis of large natural products.16,17 Previous studies on the effect of additives on SmI2 reactions have shown that HMPA enhances the reduction potential of SmI2 by coordinating to the samarium metal center, producing a more powerful,13-14,18 sterically encumbered reductant19-21 and in some cases playing an integral role in post electron-transfer steps facilitating subsequent bond-forming events.22 In the Sm-Barbier reaction, HMPA has been shown to additionally activate the alkyl halide by forming a complex in a pre-equilibrium step.23
Ni(II) salts are a catalytic additive used frequently in Sm-mediated transformations.24-27 Though critical for success, the mechanistic role of Ni(II) was not known in these reactions. Recently it has been shown that SmI2 reduces Ni(II) to Ni(0), and the reaction is then carried out through organometallic Ni(0) chemistry.28
These mechanistic studies highlight that although the same Barbier product is obtained, the use of different additives in the SmI2 reaction drastically alters the mechanistic pathway of the reaction. The protocol for running these SmI2-initiated reactions is described.

Preparation and Use of Samarium Diiodide SmI2 in Organic Synthesis: The Mechanistic Role of HMPA and NiII Salts in the Samarium Barbier Reaction

A straightforward procedure for the preparation of samarium diiodide (SmI2) in THF is described. The role of two main additives namely hexamethylphosphoramide (HMPA) and Ni(acac)2 in Sm mediated reactions is demonstrated in the Sm-Barbier reaction.

Although initially considered an esoteric reagent, SmI2 has become a common tool for synthetic organic chemists. SmI2 is generated through the addition of ...

Synthesis of Hypervalent Iodonium Alkynyl Triflates for the Application of Generating Cyanocarbenes

The procedures described in this article involve the synthesis and isolation of hypervalent iodonium alkynyl triflates (HIATs) and their subsequent reactions with azides to form cyanocarbene intermediates. The synthesis of hypervalent iodonium alkynyl triflates can be facile, but difficulties stem from their isolation and reactivity. In particular, the necessity to use filtration under inert atmosphere at -45 &deg;C for some HIATs requires special care and equipment. Once isolated, the compounds can be stored and used in reactions with azides to form cyanocarbene intermediates. 
The evidence for cyanocarbene generation is shown by visible extrusion of dinitrogen as well as the characterization of products that occur from O-H insertion, sulfoxide complexation, and cyclopropanation. A side reaction of the cyanocarbene formation is the generation of a vinylidene-carbene and the conditions to control this process are discussed. There is also potential to form a hypervalent iodonium alkenyl triflate and the means of isolation and control of its generation are provided. The O-H insertion reaction involves using a HIAT, sodium azide or tetrabutylammonium azide, and methanol as solvent/substrate. The sulfoxide complexation reaction uses a HIAT, sodium azide or tetrabutylammonium azide, and dimethyl sulfoxide as solvent. The cyclopropanations can be performed with or without the use of solvent. The azide source must be tetrabutylammonium azide and the substrate shown is styrene.

Herein is described the synthesis, isolation, and reactions of hypervalent iodonium alkynyl triflates (HIATs) with azides to generate cyanocarbenes. The procedures will involve air-sensitive and cryogen techniques, including cold filtration under an inert atmosphere. Handling and safety of the synthesized compounds will also be discussed.

The procedures described in this article involve the synthesis and isolation of hypervalent iodonium alkynyl triflates (HIATs) and their subsequent ...

Isolation and Preparation of Bacterial Cell Walls for Compositional Analysis by Ultra Performance Liquid Chromatography

The bacterial cell wall is critical for the determination of cell shape during growth and division, and maintains the mechanical integrity of cells in the face of turgor pressures several atmospheres in magnitude. Across the diverse shapes and sizes of the bacterial kingdom, the cell wall is composed of peptidoglycan, a macromolecular network of sugar strands crosslinked by short peptides. Peptidoglycan&#8217;s central importance to bacterial physiology underlies its use as an antibiotic target and has motivated genetic, structural, and cell biological studies of how it is robustly assembled during growth and division. Nonetheless, extensive investigations are still required to fully characterize the key enzymatic activities in peptidoglycan synthesis and the chemical composition of bacterial cell walls. High Performance Liquid Chromatography (HPLC) is a powerful analytical method for quantifying differences in the chemical composition of the walls of bacteria grown under a variety of environmental and genetic conditions, but its throughput is often limited. Here, we present a straightforward procedure for the isolation and preparation of bacterial cell walls for biological analyses of peptidoglycan via HPLC and Ultra Performance Liquid Chromatography (UPLC), an extension of HPLC that utilizes pumps to deliver ultra-high pressures of up to 15,000 psi, compared with 6,000 psi for HPLC. In combination with the preparation of bacterial cell walls presented here, the low-volume sample injectors, detectors with high sampling rates, smaller sample volumes, and shorter run times of UPLC will enable high resolution and throughput for novel discoveries of peptidoglycan composition and fundamental bacterial cell biology in most biological laboratories with access to an ultracentrifuge and UPLC.

The bacterial cell wall is composed of peptidoglycan, a macromolecular network of sugar strands crosslinked by peptides. Ultra Performance Liquid Chromatography provides high resolution and throughput for novel discoveries of peptidoglycan composition. We present a procedure for the isolation of cell walls (sacculi) and their subsequent preparation for analysis via UPLC.

The bacterial cell wall is critical for the determination of cell shape during growth and division, and maintains the mechanical integrity of cells in the ...

Protocol for the Synthesis of Ortho-trifluoromethoxylated Aniline Derivatives

Molecules bearing trifluoromethoxy (OCF3) group often show desired pharmacological and biological properties. However, facile synthesis of trifluoromethoxylated aromatic compounds remains a formidable challenge in organic synthesis. Conventional approaches often suffer from poor substrate scope, or require use of highly toxic, difficult-to-handle, and/or thermally labile reagents. Herein, we report a user-friendly protocol for the synthesis of methyl 4-acetamido-3-(trifluoromethoxy)benzoate using 1-trifluoromethyl-1,2-benziodoxol-3(1H)-one (Togni reagent II). Treating methyl 4-(N-hydroxyacetamido)benzoate (1a) with Togni reagent II in the presence of a catalytic amount of cesium carbonate (Cs2CO3) in chloroform at RT afforded methyl 4-(N-(trifluoromethoxy)acetamido)benzoate (2a). This intermediate was then converted to the final product methyl 4-acetamido-3-(trifluoromethoxy)benzoate (3a) in nitromethane at 120 &#176;C. This procedure is general and can be applied to the synthesis of a broad spectrum of ortho-trifluoromethoxylated aniline derivatives, which could serve as useful synthetic building blocks for the discovery and development of new pharmaceuticals, agrochemicals, and functional materials.

Protocol for the Synthesis of Ortho-trifluoromethoxylated Aniline Derivatives

An operationally simple procedure for the synthesis of ortho-trifluoromethoxylated aniline derivatives via a two-step sequence of O-trifluoromethylation of N-aryl-N-hydroxyacetamide followed by thermally induced intramolecular OCF3-migration is reported.

Molecules bearing trifluoromethoxy (OCF3) group often show desired pharmacological and biological properties. However, facile synthesis of ...

Synthesis of Protein Bioconjugates via Cysteine-maleimide Chemistry

The chemical linking or bioconjugation of proteins to fluorescent dyes, drugs, polymers and other proteins has a broad range of applications, such as the development of antibody drug conjugates (ADCs) and nanomedicine, fluorescent microscopy and systems chemistry. For many of these applications, specificity of the bioconjugation method used is of prime concern. The Michael addition of maleimides with cysteine(s) on the target proteins is highly selective and proceeds rapidly under mild conditions, making it one of the most popular methods for protein bioconjugation.
We demonstrate here the modification of the only surface-accessible cysteine residue on yeast cytochrome c with a ruthenium(II) bisterpyridine maleimide. The protein bioconjugation is verified by gel electrophoresis and purified by aqueous-based fast protein liquid chromatography in 27% yield of isolated protein material. Structural characterization with MALDI-TOF MS and UV-Vis is then used to verify that the bioconjugation is successful. The protocol shown here is easily applicable to other cysteine - maleimide coupling of proteins to other proteins, dyes, drugs or polymers.

Synthesis of Protein Bioconjugates via Cysteine-maleimide Chemistry

This protocol details the important steps required for the bioconjugation of a cysteine containing protein to a maleimide, including reagent purification, reaction conditions, bioconjugate purification and bioconjugate characterization.

The chemical linking or bioconjugation of proteins to fluorescent dyes, drugs, polymers and other proteins has a broad range of applications, such as the ...

Facile Synthesis of Worm-like Micelles by Visible Light Mediated Dispersion Polymerization Using Photoredox Catalyst

Presented herein is a protocol for the facile synthesis of worm-like micelles by visible light mediated dispersion polymerization. This approach begins with the synthesis of a hydrophilic poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA) homopolymer using reversible addition-fragmentation chain-transfer (RAFT) polymerization. Under mild visible light irradiation (&#955; = 460 nm, 0.7 mW/cm2), this macro-chain transfer agent (macro-CTA) in the presence of a ruthenium based photoredox catalyst, Ru(bpy)3Cl2 can be chain extended with a second monomer to form a well-defined block copolymer in a process known as Photoinduced Electron Transfer RAFT (PET-RAFT). When PET-RAFT is used to chain extend POEGMA with benzyl methacrylate (BzMA) in ethanol (EtOH), polymeric nanoparticles with different morphologies are formed in situ according to a polymerization-induced self-assembly (PISA) mechanism. Self-assembly into nanoparticles presenting POEGMA chains at the corona and poly(benzyl methacrylate) (PBzMA) chains in the core occurs in situ due to the growing insolubility of the PBzMA block in ethanol. Interestingly, the formation of highly pure worm-like micelles can be readily monitored by observing the onset of a highly viscous gel in situ due to nanoparticle entanglements occurring during the polymerization. This process thereby allows for a more reproducible synthesis of worm-like micelles simply by monitoring the solution viscosity during the course of the polymerization. In addition, the light stimulus can be intermittently applied in an ON/OFF manner demonstrating temporal control over the nanoparticle morphology.

This article describes a process for producing polymeric self-assembled nanoparticles using visible light mediated dispersion polymerization. Using low energy visible light to control the polymerization allows for the reproducible formation of self-assembled worm-like micelles at high solids content.

Presented herein is a protocol for the facile synthesis of worm-like micelles by visible light mediated dispersion polymerization. This approach begins ...

Preparation of Chitosan-based Injectable Hydrogels and Its Application in 3D Cell Culture

The protocol presents a facile, efficient, and versatile method to prepare chitosan-based hydrogels using dynamic imine chemistry. The hydrogel is prepared by mixing solutions of glycol chitosan with a synthesized benzaldehyde terminated polymer gelator, and hydrogels are efficiently obtained in several minutes at room temperature. By varying ratios between glycol chitosan, polymer gelator, and water contents, versatile hydrogels with different gelation times and stiffness are obtained. When damaged, the hydrogel can recover its appearances and modulus, due to the reversibility of the dynamic imine bonds as crosslinkages. This self-healable property enables the hydrogel to be injectable since it can be self-healed from squeezed pieces to an integral bulk hydrogel after the injection process. The hydrogel is also multi-responsive to many bio-active stimuli due to different equilibration statuses of the dynamic imine bonds. This hydrogel was confirmed as bio-compatible, and L929 mouse fibroblast cells were embedded following standard procedures and the cell proliferation was easily assessed by a 3D cell cultivation process. The hydrogel can offer an adjustable platform for different research where a physiological mimic of a 3D environment for cells is profited. Along with its multi-responsive, self-healable, and injectable properties, the hydrogels can potentially be applied as multiple carriers for drugs and cells in future bio-medical applications.

Here we describe a facile preparation of chitosan-based injectable hydrogels using dynamic imine chemistry. Methods to adjust the hydrogel&#8217;s mechanical strength and its application in 3D cell culture are presented.

The protocol presents a facile, efficient, and versatile method to prepare chitosan-based hydrogels using dynamic imine chemistry. The hydrogel is ...

Total Internal Reflection Absorption Spectroscopy (TIRAS) for the Detection of Solvated Electrons at a Plasma-liquid Interface

The total internal reflection absorption spectroscopy (TIRAS) method presented in this article uses an inexpensive diode laser to detect solvated electrons produced by a low-temperature plasma in contact with an aqueous solution. Solvated electrons are powerful reducing agents, and it has been postulated that they play an important role in the interfacial chemistry between a gaseous plasma or discharge and a conductive liquid. However, due to the high local concentrations of reactive species at the interface, they have a short average lifetime (~1 &#181;s), which makes them extremely difficult to detect. The TIRAS technique uses a unique total internal reflection geometry combined with amplitude-modulated lock-in amplification to distinguish solvated electrons&#39; absorbance signal from other spurious noise sources. This enables the in situ detection of short-lived intermediates in the interfacial region, as opposed to the bulk measurement of stable products in the solution. This approach is especially attractive for the field of plasma electrochemistry, where much of the important chemistry is driven by short-lived free radicals. This experimental method has been used to analyze the reduction of nitrite (NO2-(aq)), nitrate (NO3-(aq)), hydrogen peroxide (H2O2(aq)), and dissolved carbon dioxide (CO2(aq)) by plasma-solvated electrons and deduce effective rate constants. Limitations of the method may arise in the presence of unintended parallel reactions, such as air contamination in the plasma, and absorbance measurements may also be hindered by the precipitation of reduced electrochemical products. Overall, the TIRAS method can be a powerful tool for studying the plasma-liquid interface, but its effectiveness depends on the particular system and reaction chemistry under study.

Total Internal Reflection Absorption Spectroscopy TIRAS for the Detection of Solvated Electrons at a Plasma-liquid Interface

This article presents a total internal reflection absorption spectroscopy (TIRAS) method for measuring short-lived free radicals at a plasma-liquid interface. In particular, TIRAS is used to identify solvated electrons based on their optical absorbance of red light near 700 nm.

The total internal reflection absorption spectroscopy (TIRAS) method presented in this article uses an inexpensive diode laser to detect solvated ...

Color Spot Test As a Presumptive Tool for the Rapid Detection of Synthetic Cathinones

Synthetic cathinones are a large class of new psychoactive substances (NPS) that are increasingly prevalent in drug seizures made by law enforcement and other border protection agencies globally. Color testing is a presumptive identification technique indicating the presence or absence of a particular drug class using rapid and uncomplicated chemical methods. Owing to their relatively recent emergence, a color test for the specific identification of synthetic cathinones is not currently available. In this study, we introduce a protocol for the presumptive identification of synthetic cathinones, employing three aqueous reagent solutions: copper(II) nitrate, 2,9-dimethyl-1,10-phenanthroline (neocuproine) and sodium acetate. Small pin-head sized amounts (approximately 0.1-0.2 mg) of the suspected drugs are added to the wells of a porcelain spot plate, and each reagent is then added dropwise sequentially before heating on a hotplate. A color change from very light blue to yellow-orange after 10 min indicates the likely presence of synthetic cathinones. The highly stable and specific test reagent has the potential for use in the presumptive screening of unknown samples for synthetic cathinones in a forensic laboratory. However, the nuisance of an added heating step for the color change result limits the test to laboratory application and decreases the likelihood of an easy translation to field testing.

Here we present a simple, inexpensive, and selective chemical spot test protocol for the detection of synthetic cathinones, a class of new psychoactive substances. The protocol is suitable for use in various areas of law enforcement that encounter illicit material.

Synthetic cathinones are a large class of new psychoactive substances (NPS) that are increasingly prevalent in drug seizures made by law enforcement and ...

A New Straightforward Method for Lipophilicity (logP) Measurement using 19F NMR Spectroscopy

Fluorination has become an effective tool to optimize physicochemical properties of bioactive compounds. One of the applications of fluorine introduction is to modulate the lipophilicity of the compound. In our group, we are interested in the study of the impact of fluorination on lipophilicity of aliphatic fluorohydrins and fluorinated carbohydrates. These are not UV-active, resulting in a challenging lipophilicity determination. Here, we present a straightforward method for the measurement of lipophilicity of fluorinated compounds by 19F NMR spectroscopy. This method requires no UV-activity. Accurate solute mass, solvent and aliquot volume are also not required to be measured. Using this method, we measured the lipophilicities of a large number of fluorinated alkanols and carbohydrates.

A New Straightforward Method for Lipophilicity logP Measurement using 19F NMR Spectroscopy

A novel and straightforward variation of the shake-flask method was developed for accurate lipophilicity measurement of fluorinated compounds by 19F NMR spectroscopy.

Fluorination has become an effective tool to optimize physicochemical properties of bioactive compounds. One of the applications of fluorine introduction ...