Nous sommes reconnaissants à Scimone Gianni pour l&#39;assistance excellente de faire des vidéos.

Manipulation des échantillons sanguins infectés au VIH nécessite quelques recommandations importantes. Tous les échantillons de sang doivent être transportés dans robustes conteneurs étanches. Des précautions doivent être prises lors de la collecte du spécimen pour éviter toute contamination de l&#39;extérieur du conteneur et de tout document accompagnant le spécimen. Toutes les personnes de traitement du sang infectés doivent porter des gants. Les gants doivent être changés et lavés les mains après l&#39;achèvement du traitement des échantillons. Traitement des échantillons de sang infectés par le VIH doit être effectuée sous une hotte de classe II du cabinet Biohazard. Les aides mécaniques de pipetage doit être utilisé. L&#39;utilisation de seringues ou autres objets tranchants (y compris par exemple les pipettes en verre ou tubes capillaires) doit être limitée aux situations dans lesquelles il n&#39;ya pas d&#39;alternative. Surfaces de laboratoire doivent être décontaminés avec un désinfectant chimique approprié après un déversement de sang et quand les activités de travail sont terminés. Les matériaux contaminés utilisés doivent être décontaminés avant réutilisation ou doivent être éliminés correctement via la route des déchets cliniques. Chaque incident d&#39;exposition professionnelle à du sang potentiellement infectieux ou des liquides (ie, ceux nécessitant des précautions universelles) doivent être traités comme une urgence médicale comme les interventions doivent être initiées rapidement pour être efficace. Le protocole nécessite 5 jours pour son achèvement. Le calendrier est détaillé dans la Figure 1. Les espèces bactériennes sont identifiés en utilisant les méthodes décrites dans la Figure 2. 1. Prélèvement d&#39;échantillons <ol><li> 9 ml de sang total est prélevé dans des tubes contenant de l&#39;EDTA. </li><li> Les tubes sont centrifugés à 2000 rpm pendant 10 minutes à température ambiante pour obtenir un plasma. </li><li> Le plasma est recueilli dans une solution stérile de 2 ml Eppendorf tube. </li></ol> 2. Extraction d&#39;ADN d&#39;échantillons de plasma <ol><li> Suffisamment désinfecter le capot, des pipettes et le matériel nécessaire pour l&#39;expérience en vue de garantir la stérilité. </li><li> Placer tous les matériaux sous les lumières UV pendant au moins 30 minutes. </li><li> Essuyez les gants avec un désinfectant. </li><li> Tremper un essuie quelques dans l&#39;éthanol et les placer sous le capot. Chaque fois qu&#39;un pourboire est jeté essuyer la pipette sur les serviettes de papier humide. </li></ol> L&#39;ADN est extrait en utilisant un kit commercial en suivant les instructions du fabricant (Easy-DNA Kit, Invitrogen, Carlsbad CA, USA). <ol start="5"><li> 350 uL de plasma sont placés dans un tube stérile de 2 ml Eppendorf. </li><li> 350 uL d&#39;eau ultrapure filtrée sont utilisées comme contrôle négatif. </li><li> Ajouter 10 uL de lysozyme (1mg/ml) pour les échantillons. </li><li> Incuber pendant 30 minutes à 37 ° C. </li><li> Ajouter 500 ul de solution de lyse et mélanger délicatement pour les échantillons. </li><li> Incuber pendant 7 minutes à 65 ° C. </li><li> Ajouter 900 ul de chloroforme pour les échantillons. </li><li> Vortex vigoureusement jusqu&#39;à les échantillons sont uniformément visqueux. </li><li> Ajouter 200 pi de solution de précipitations et vortexer vigoureusement. </li><li> Centrifuger les échantillons à 10500 rpm pendant 10 minutes à température ambiante pour séparer les phases et la forme de l&#39;interface. </li><li> Transférer la phase aqueuse supérieure dans un tube à centrifuger frais contenant 1 ml d&#39;éthanol à 100%. </li><li> Centrifuger les échantillons à 10500 rpm pendant 10 minutes à 4 ° C. </li><li> Enlever l&#39;éthanol. </li><li> Ajouter 1 ml d&#39;éthanol à 70%. </li><li> Centrifuger les échantillons à vitesse maximale pendant 10 minutes à 4 ° C. </li><li> Enlever l&#39;éthanol. L&#39;éthanol résiduelle doit être éliminée avec un pipettator. </li><li> Reprendre le culot dans 50 ul d&#39;eau ultrapure. </li><li> Lire la concentration d&#39;ADN avec un spectrophotomètre. </li></ol> 3. ARNr 16S par PCR L&#39;amplification par PCR est effectuée comme décrit précédemment 9. <ol><li> Amplifier l&#39;ADN dans un mélange réactionnel de 100 uL composé de 10 pi de tampon PCR 10X, 5 pi de 25 mM de MgCl2, 5 pi de 2 mM dNTP total, 1 pl de 50 uM apprêt RW01 (AACTGGAGGAAGGTGGGGAT), 1 pl de 50 uM apprêt DG74 (AGGAGGTGATCCAACCGCA), 34 uL d&#39;H20 et 0,5 uL de Taq polymérase (AmpliTaq Gold, Applied Biosystem, Foster City, CA, USA). </li><li> Transférer le mélange PCR dans les filtres afin d&#39;éviter toute contamination possible par Taq polymérase bactérienne. </li><li> Filtres à centrifuger (Microcon, Millipore, Billerica, MA, USA) pendant 30 minutes à 500 FCR à 4 ° C. </li><li> Aliquoter le mélange PCR selon le nombre d&#39;échantillons qui doivent être amplifiés (positifs et négatifs contrôles PCR, les échantillons et de l&#39;eau extraite). </li><li> Utiliser les conditions suivantes thermocycleur: 94 ° C pendant 10 minutes, 40 fois 1 minute à chaque fois à 94 ° C, 55 ° C et 72 ° C, et 10 min à 72 ° C. </li><li> Visualisez le produit de PCR sur un gel agarose 2%. Utiliser 100 pb échelle d&#39;ADN. Taille du produit PCR est d&#39;environ 360 pb (figure 3). </li></ol> 4. Purification de produits PCR Seuls les échantillons positifs par PCR doit être purifiée. La purification est réalisée à l&#39;aideun fabricant de kit commercial suivant les instructions du (PCR Purelink MICROKIT, Invitrogen, Carlsbad CA, USA). <ol><li> Ajouter 4 volumes de tampon de liaison contenant de l&#39;isopropanol pour 1 volume de produit de PCR. </li><li> Transfert de produits PCR avec Binding Buffer à une colonne. </li><li> Centrifuger pendant 1 minute à 10000 rcf à température ambiante. </li><li> Laver la colonne avec le tampon de lavage contenant de l&#39;éthanol. </li><li> Centrifuger pendant 1 minute à 10000 rcf à température ambiante. </li><li> Centrifuger à vitesse maximale pendant 1 minute à température ambiante pour sécher la membrane de silice et d&#39;enlever tout le tampon de lavage résiduelle avec de l&#39;éthanol. </li><li> Ajouter 10 uL d&#39;eau ultrapure. </li><li> Incuber pendant 1 minute à température ambiante. </li><li> Centrifuger à vitesse maximale pendant 2 minutes à température ambiante pour recueillir l&#39;ADN purifié. </li></ol> 5. Le clonage Lysogénie Broth (LB) la préparation des plaques <ol><li> Dissoudre 25 gr de mélange de LB dans environ 800 ml d&#39;eau. </li><li> Amener le volume final à 1 L. </li><li> Ajouter 15 gr de Bactoagar. </li><li> Autoclave pendant 20 minutes. </li><li> Après autoclavage, agiter énergiquement par rotation de la solution dans le flacon pour mélanger agar fondu. </li><li> Refroidir la solution à 50 ° C. </li><li> Ajouter l&#39;ampicilline (50 ug / ml) et agiter jusqu&#39;à ce qu&#39;il soit dissout. </li><li> Verser dans les boîtes à une profondeur d&#39;environ 3mm. </li><li> Laisser les plaques à température ambiante. </li><li> Fais X-Gal (40mg/ml) et IPTG (100 mM) sur chaque plaque LB et incuber à 37 ° C jusqu&#39;à utilisation. </li></ol> Transformation des cellules compétentes La transformation est réalisée à l&#39;aide des instructions d&#39;un fabricant kit commercial suivante (TOPO TA cloning kit, Invitrogen, Carlsbad CA, USA). <ol><li> Préparer le mélange de réaction de clonage (1-4 uL de PCR produit frais, 1 ml de solution de sel, 1 pl de vecteur et de l&#39;eau si nécessaire). </li><li> Mélanger délicatement la réaction et incuber pendant 5-10 minutes à température ambiante. </li><li> Placez la réaction sur la glace. </li><li> Ajouter 2 ul de la réaction de clonage dans un flacon de cellules compétentes et mélanger doucement. </li><li> Incuber dans la glace pendant 30 minutes. </li><li> Choc thermique des cellules pendant 30 secondes à 42 ° C. </li><li> Transférer immédiatement le tube dans la glace. </li><li> Ajouter 250 ul de milieu. </li><li> Boucher le tube hermétiquement et secouer le tube horizontal à 37 ° C pendant 1 heure. </li><li> Fais 50 ul de chaque transformation sur une plaque préchauffée sélective. </li><li> Incuber une nuit à 37 ° C. </li></ol> Après incubation, les colonies blanches et bleues se développent sur les plaques. Colonies blanches sont positifs pour l&#39;insertion des produits de PCR et des colonies bleues sont négatifs pour l&#39;insertion des produits de PCR. 6. L&#39;analyse par séquençage Réaction de séquençage <ol><li> Un mélange est faite en utilisant ces réactifs: 2,5 ul d&#39;ADN, une primaire ul (5pmol / ul) 1,1 BigDye ul (Applied Biosystem, Foster City, CA, USA). </li><li> Conditions Thermocycleur: 96 ° C pendant 1 minutes, 25 fois pour 96 ° C pendant 10 sec, 55 ° C pendant 15 sec et 60 ° C pendant 4 min. </li></ol> Purification sur colonne <ol><li> Pour chaque réaction, préparer une colonne MicroSpin (Qiagen, Milan, Italie). </li><li> Inverser la colonne et de vortex pour mélanger la résine. </li><li> Aligner le fond de colonne, desserrer le couvercle ¼ de tour, et la colonne dans un microtube. </li><li> Centrifugeuse 3200 rpm pendant 1 minute. </li><li> Transfert colonne à un microtube propre. </li><li> Soigneusement pipette la réaction de séquençage complet PCR dans le centre de la colonne. </li><li> Centrifugeuse 3200 rpm pendant 1 minute. </li><li> ADN purifié sera eluite dans le tube (20 pi d&#39;eau ultra-pure). </li></ol> L&#39;analyse par séquençage <ol><li> Charger l&#39;échantillon purifié (20 pi) dans 96 multipuits assiette. </li><li> Charger la plaque dans le séquenceur. Séquenceurs d&#39;ADN automatisé générer un chromatogramme en quatre couleurs montrant les résultats de l&#39;exécution de séquençage. </li><li> Entrée de la séquence nucléotidique comme une requête contre les banques de séquences publiques. La recherche est effectuée sur les bases de données NCBI et les serveurs, avec Basic Alignment Tool Recherche locale (BLAST). </li><li> Considérons seulement les bactéries avec des homologies 98-100%. </li></ol> 7. Les résultats représentatifs <img src="/files/ftp_upload/2830/2830fig1.jpg" alt="Figure 1" /> Figure 1. Chronologie de la procédure. <img src="/files/ftp_upload/2830/2830fig2.jpg" alt="Figure 2" /> Figure 2. Diagrammes de flux de la procédure d&#39;identification bactérienne entière. <img src="/files/ftp_upload/2830/2830fig3.jpg" alt="Figure 3" /> Figure 3. Gel à 2% d&#39;agarose montrant large gamme de 16S ARNr produits de PCR. Voie 1 contient une échelle d&#39;ADN de 100 pb, piste 2 contient le contrôle PCR positive, piste 3 montre le contrôle négatif de PCR. Lane 4 montre des échantillons provenant d&#39;un patient séropositif, et la piste 5 contient de l&#39;eau. Voie 6 shOWS échantillons à partir d&#39;un individu sain et une réaction négative par PCR; piste 7 contient de l&#39;eau. Seuls les patients VIH positifs affiche une amplification PCR positive. Eau ultrapure utilisée comme contrôle négatif pendant l&#39;étape d&#39;extraction, indique qu&#39;aucune contamination s&#39;est produite. <img src="/files/ftp_upload/2830/2830fig4.jpg" alt="Figure 4" /> Figure 4. Gel à 0,7% d&#39;agarose montrant plasmidique extrait avec la procédure miniprep. Voie 1 contient une échelle 1 ADN Kilobase, piste 2 contient la colonie de contrôle bleu, les voies 3 à 12 contiennent des colonies blanches. Le plasmide de la colonie bleue ne contient pas la notice du produit PCR. Tous les 10 colonies blanches contiennent plasmide avec l&#39;insert correct. <img src="/files/ftp_upload/2830/2830fig5.jpg" alt="Figure 5" /> Figure 5. Indique l&#39;exemple d&#39;analyse par séquençage des bactéries dans le plasma d&#39;un VIH-positifs individuels. Nos résultats montrent que la translocation microbienne dans l&#39;infection à VIH implique une flore polimicrobic, qui n&#39;est pas vu dans le VIH-négatifs sujets, suggérant l&#39;échec substantiel de l&#39;immunité intestinale dans le contrôle de la translocation bactérienne.

<ol>
	<li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+commensal+intestinal+bacteria+and+the+immune+system.">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li><li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease.">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li><li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection.">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li><li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+disease:+fallout+from+a+mucosal+catastrophe.">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li><li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection.">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+associated+with+sustained+failure+in+CD4++T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy.">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Microbial+Translocation+and+Immune+Hyperactivation+in+Disease+Progression+of+HIV++Patients+with+Preserved+CD4+Count+in+the+Absence+of+ART.">Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART.</a> , (2010).</li><li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria,+including+bacteria+found+in+cerebrospinal+fluid.">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li></ol>

<p class="jove_content"&gt; Par la présente nous montrent un protocole PCR / séquençage de caractériser la translocation de bactéries dans le sang périphérique d&#39;individus infectés par le VIH.</p&gt;<p class="jove_content"&gt; Résultats les plus fiables sont obtenus en utilisant le plasma recueilli dans des tubes contenant de l&#39;EDTA-. Après prélèvement de sang, le plasma doit être séparé par centrifugation dans les 2 / 3 heures, pour éviter l&#39;hémolyse et la dégradation de fragment d&#39;ADN. Les échantillons sont ...

<table border="1"><tbody><tr><th> Nom de réactif </th><th> Société </th><th> Numéro de catalogue </th><th> Commentaires (optionnel) </th></tr><tr><td> Easty-DNA Kit </td><td> Invitrogen </td><td> K 180001 </td><td></td></tr><tr><td> Chloroforme </td><td> Sigma-Aldrich </td><td> C2432 </td><td></td></tr><tr><td> Éthanol </td><td> Sigma-Aldrich </td><td> E7203 </td><td></td><tr/><tr><td> UltraPure Waer </td><td> Invitrogen </td><td> 10977049 </td><td></td></tr><tr><td> Le lysozyme </td><td> Fluka </td><td> 62970 </td><td> 10 ug / ml dans l&#39;eau distillée </td></tr><tr><td> AmpliTaq Gold </td><td> Applied Biosystem </td><td> 26478701 </td><td></td></tr><tr><td> Microcon 100 </td><td> Millipore </td><td> 42413 </td><td></td></tr><tr><td> Des amorces de PCR </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Agarose </td><td> Eppendorf </td><td> C1343 </td><td></td></tr><tr><td> Échelle d&#39;ADN </td><td> Invitrogen </td><td> 15628019 </td><td></td></tr><tr><td> Purelink PCR kit micro </td><td> Invitrogen </td><td> K310050 </td><td></td></tr><tr><td> LB agar, la poudre </td><td> Invitrogen </td><td> 22700025 </td><td></td></tr><tr><td> Bactoagar </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Ampicilline </td><td> Invitrogen </td><td> 11593027 </td><td> 10 mg / mL dans l&#39;eau distillée </td></tr><tr><td> X-gal </td><td> Invitrogen </td><td> 15520034 </td><td> 40mg/mL dans le DMF </td></tr><tr><td> IPTG </td><td> Invitrogen </td><td> 15529019 </td><td> 100 mM dans de l&#39;eau distillée </td></tr><tr><td> TOPO TA Cloning kit </td><td> Invitrogen </td><td> K450002 </td><td></td></tr><tr><td> Purelink rapide kit Plasmid Miniprep </td><td> Invitrogen </td><td> K210010 </td><td></td></tr><tr><td> Big Dye </td><td> Applied Biosystem </td><td> 4337455 </td><td></td></tr><tr><td> DyeEx 2,0 tour kit </td><td> Qiagen </td><td> 63204 </td><td></td></tr></tbody></table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

Le tractus gastro-intestinal sain est physiologiquement colonisé par une grande variété de microbes commensaux qui influencent le développement de l&#39;1,2 humorales et cellulaires du système immunitaire muqueux. Microbiote est protégé par le système immunitaire par une barrière forte muqueuses. Infections et antibiotiques sont connus pour altérer la barrière normale tractus gastro-intestinal et la composition des bactéries résidentes, ce qui peut entraîner des possibles anomalies immunitaires 3. VIH provoque une brèche dans la barrière gastro-intestinaux avec défaillance progressive de l&#39;immunité des muqueuses et des fuites dans la circulation systémique des bioproduits bactériennes, telles que des lipopolysaccharides et des fragments d&#39;ADN bactérien, qui contribuent à l&#39;activation immunitaire systémique 4-7. Translocation microbienne est impliqué dans le VIH / SIDA immunopathogenèse et réponse au traitement 4,8. Nous avons cherché à caractériser la composition des bactéries translocation dans le sang périphérique des patients infectés par le VIH. Pour poursuivre notre but, nous avons créé une réaction PCR pour le gène 16S panbacteric ribosomial suivie d&#39;une analyse par séquençage. Brièvement, le sang total à la fois de sujets infectés par le VIH et sain est utilisé. Étant donné que les individus sains normaux présents homéostasie intestinale aucune translocation de la microflore est attendu chez ces patients. Après la collecte de sang total par ponction veineuse et la séparation du plasma, l&#39;ADN est extrait du plasma et utilisés pour effectuer un large éventail de réaction PCR pour le gène 16S panbacteric ribosomial 9. Après purification des analyses de produits PCR, le clonage et le séquençage sont effectuées.

Watch this Scientific Journal Video about Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients at JoVE.com

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Notre expérience montrera comment effectuer une analyse par séquençage des espèces bactériennes translocation dans le sang périphérique des patients VIH positifs.

Séquençage de la microflore bactérienne dans le sang périphérique: notre expérience avec des patients infectés par le VIH

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Research

JoVE Journal

Medicine

12.2K vues.  San Paolo Hospital University of Milan, Italy. Notre expérience montrera comment effectuer une analyse par séquençage des espèces bactériennes translocation dans le sang périphérique des patients VIH positifs.

Vidéo: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Modeling Intracerebral Hemorrhage in Mice: Injection of Autologous Blood or Bacterial Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related hospitalizations and for which no effective treatments are available to date1,2. Because of the heterogeneity of ICH in humans, various preclinical models are needed to thoroughly explore prospective therapeutic strategies3. Experimental ICH is commonly induced in rodents by intraparenchymal injection of either autologous blood or bacterial collagenase4. The appropriate model is selected based on the pathophysiology of hemorrhage induction and injury progression. The blood injection model mimics a rapidly progressing hemorrhage. Alternatively, bacterial collagenase enzymatically disrupts the basal lamina of brain capillaries, causing an active bleed that generally evolves over several hours5. Resultant perihematomal edema and neurofunctional deficits can be quantified from both models. In this study, we described and evaluated a modified double injection model of autologous whole blood6 as well as an ICH injection model of bacterial collagenase7, both of which target the basal ganglia (corpus striatum) of male CD-1 mice. We assessed neurofunctional deficits and brain edema at 24 and 72 hr after ICH induction. Intrastriatal injection of autologous blood (30 &mu;l) or bacterial collagenase (0.075U) caused reproducible neurofunctional deficits in mice and significantly increased brain edema at 24 and 72 hr after surgery (p&lt;0.05). In conclusion, both models yield consistent hemorrhagic infarcts and represent basic methods for preclinical ICH research.

Clinically relevant animal models of intracerebral hemorrhage (ICH) are needed to extend our knowledge of hemorrhagic stroke and to examine novel therapeutic strategies. In this study, we describe and evaluate two ICH models that implement unilateral injections of either autologous whole blood or bacterial collagenase into the basal ganglia (corpus striatum) of mice.

Hémorragie intracérébrale chez la souris Modélisation: L&#39;injection de sang autologue ou collagénase bactérienne

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related ...

Recherche

Médecine

Measuring Frailty in HIV-infected Individuals. Identification of Frail Patients is the First Step to Amelioration and Reversal of Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased reserve and resistance to stressors increases in incidence with increasing age. In the elderly, frailty may pursue a step-wise loss of function from non-frail to pre-frail to frail. We studied frailty in HIV-infected patients and found that ~20% are frail using the Fried phenotype using stringent criteria developed for the elderly1,2. In HIV infection the syndrome occurs at a younger age.
HIV patients were checked for 1) unintentional weight loss; 2) slowness as determined by walking speed; 3) weakness as measured by a grip dynamometer; 4) exhaustion by responses to a depression scale; and 5) low physical activity was determined by assessing kilocalories expended in a week's time. Pre-frailty was present with any two of five criteria and frailty was present if any three of the five criteria were abnormal.
The tests take approximately 10-15 min to complete and they can be performed by medical assistants during routine clinic visits. Test results are scored by referring to standard tables. Understanding which of the five components contribute to frailty in an individual patient can allow the clinician to address relevant underlying problems, many of which are not evident in routine HIV clinic visits.

Frailty syndrome is commonly seen in the aged and reflects multi-system physiological change. However, with reduced functional reserve and resilience frailty is also known to be common in the HIV infected population. This study outlined an easily administered screening test to identify HIV patients with frailty. When significant components of frailty are identified, clinicians will be able to focus on amelioration of the problem and promote reversion to the pre-frail state.

Mesure de la fragilité chez les individus infectés par le VIH. L&#39;identification des patients fragiles est le premier pas vers l&#39;amélioration et l&#39;inversion de la fragilité

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased ...

Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic conditions. As part of a diagnostic assessment, the early detection of postural deficits is important so that appropriate and targeted interventions can be prescribed. The Sensory Organization Test (SOT) on the EquiTest determines an individual&#39;s use of the sensory systems (somatosensory, visual, and vestibular) that are responsible for postural control. Somatosensory and visual input are altered by the calibrated sway-referenced support surface and visual surround, which move in the anterior-posterior direction in response to the individual&#39;s postural sway. This creates a conflicting sensory experience. The Motor Control Test (MCT) challenges postural control by creating unexpected postural disturbances in the form of backwards and forwards translations. The translations are graded in magnitude and the time to recover from the perturbation is computed.
Intermittent claudication, the most common symptom of peripheral arterial disease, is characterized by a cramping pain in the lower limbs and caused by muscle ischemia secondary to reduced blood flow to working muscles during physical exertion. Claudicants often display poor balance, making them susceptible to falls and activity avoidance. The Ankle Brachial Pressure Index (ABPI) is a noninvasive method for indicating the presence of peripheral arterial disease and intermittent claudication, a common symptom in the lower extremities. ABPI is measured as the highest systolic pressure from either the dorsalis pedis or posterior tibial artery divided by the highest brachial artery systolic pressure from either arm. This paper will focus on the use of computerized dynamic posturography in the assessment of balance in claudicants.

Individuals with intermittent claudication exhibit poor balance compared to healthy controls. Computerized dynamic posturography is an objective method for measuring an individual's postural responses to balance disturbances. This provides an objective reflection of the person&#x2019;s ability to respond to situations under which sensory stimuli are altered and unexpected perturbations occur.

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic ...

Assessment of Vascular Function in Patients With Chronic Kidney Disease

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this is only partially explained by traditional CVD risk factors. Vascular dysfunction is an important non-traditional risk factor, characterized by vascular endothelial dysfunction (most commonly assessed as impaired endothelium-dependent dilation [EDD]) and stiffening of the large elastic arteries. While various techniques exist to assess EDD and large elastic artery stiffness, the most commonly used are brachial artery flow-mediated dilation (FMDBA) and aortic pulse-wave velocity (aPWV), respectively. Both of these noninvasive measures of vascular dysfunction are independent predictors of future cardiovascular events in patients with and without kidney disease. Patients with CKD demonstrate both impaired FMDBA, and increased aPWV. While the exact mechanisms by which vascular dysfunction develops in CKD are incompletely understood, increased oxidative stress and a subsequent reduction in nitric oxide (NO) bioavailability are important contributors. Cellular changes in oxidative stress can be assessed by collecting vascular endothelial cells from the antecubital vein and measuring protein expression of markers of oxidative stress using immunofluorescence. We provide here a discussion of these methods to measure FMDBA, aPWV, and vascular endothelial cell protein expression.

The degree of vascular dysfunction and contributing physiological mechanisms can be assessed in patients with chronic kidney disease by measuring brachial artery flow-mediated dilation, aortic pulse-wave velocity, and vascular endothelial cell protein expression.

L&#39;évaluation de la fonction vasculaire chez les patients atteints de maladie rénale chronique

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

Orthotopique Implantation et périphérique des cellules immunitaires surveillance dans le modèle II-45 Syngénique Rat mésothéliome

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Endotoxin Activity Assay for the Detection of Whole Blood Endotoxemia in Critically Ill Patients

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis and septic shock. The early identification of an infectious process that is rapidly evolving to a critical illness might prompt a quicker and more intensive treatment, thereby potentially leading to better patient outcomes. The Endotoxin Activity (EA) assay can be used at the bedside as a reliable biomarker of systemic endotoxemia. The detection of elevated endotoxin activity levels has been repeatedly shown to be associated with an increased disease severity in patients with sepsis and septic shock. The assay is quick and easy to perform. Briefly, after sampling, an aliquot of whole blood is mixed with an anti-endotoxin antibody and with added LPS. Endotoxin activity is measured as the relative oxidative burst of primed neutrophils as detected by chemioluminescence. The assay&#39;s output is expressed on a scale from 0 (absent) to 1 (maximal) and categorized as &#8220;low&#8221; (&#60;0.4 units), &#8220;intermediate&#8221; (0.4&#8211;0.59 units), or &#8220;high&#8221; (&#8805;0.6 units). The detailed methodology and rationale for the implementation of the EA assay are reported in this manuscript.

We hereby present a protocol to measure at the bedside the endotoxin activity of human whole blood samples. The Endotoxin Activity assay is a simple test to perform and may be a useful biomarker in critically ill patients with sepsis.

Test d'activité d'endotoxine pour la détection de l'endotoxémie de sang entier dans les patients gravement malades

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis ...

Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) can manifest fine motor disorders of the upper extremities. Handwriting is a complex and unique human activity involving both motor and cognitive coordination. Researchers from western countries have discovered that patients with MCI have abnormal handwriting features. However, no relevant studies have been conducted in the Chinese population. Owing to the cross-culture phenomenon of handwriting, the aim of this study is to find new handwriting tasks to demonstrate the differences in handwriting features between elderly patients with MCI and age-matched healthy individuals.

This study proposed a digital handwriting analysis of characters in individuals with mild cognitive impairment to find more information than is revealed by traditional pencil&#8211;paper handwriting analysis.

Analyse numérique de l’écriture manuscrite des caractères chez les patients chinois présentant une déficience cognitive légère

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) ...

Fertility Preservation in Patients with Severe Ovarian Dysfunction

Ovarian function progressively declines during aging and in some pathophysiological conditions including karyotype abnormality, autoimmune diseases, chemo- and radiation-therapies, as well as ovarian surgeries. In unmarried women with severe ovarian dysfunction, fertility preservation is important for future pregnancies. Although oocyte cryopreservation is an established method for fertility preservation, these patients could only preserve a limited number of oocytes even after ovarian hyperstimulation, leading to repeated stimulations to ensure sufficient oocytes to guarantee future pregnancy. To solve this issue, we have recently developed a drug-free in vitro activation (IVA) procedure, which enable us to stimulate early stages of ovarian follicles to develop to the preantral follicle stage. These preantral follicles can respond to the unique protocol of gonadotropin stimulation, resulting in increased number of retrieved oocytes per ovarian stimulation for cryopreservation. The drug-free IVA comprised from the surgical approach and ovarian stimulation. We removed a part of cortex from one or both ovaries from patients under laparoscopic surgery. The ovarian cortical tissues were cut into small cubes to disrupt the Hippo signaling pathway and stimulate the development of early stage follicles. These cubes were grafted orthotropically into remaining ovaries as well as beneath the serosa of both Fallopian tubes. We have already published the surgical procedure of the drug-free IVA and the protocol of subsequent ovarian stimulation, but herein we present the details of laboratory methods required for drug-free IVA.

We present details of laboratory procedures for drug-free in vitro activation (IVA) of ovarian follicles for patients with severe ovarian dysfunction. This method could increase the number of retrievable oocytes per ovarian hyperstimulation and benefit fertility preservation for those patients.

Préservation de la fertilité chez les patientes présentant un dysfonctionnement ovarien sévère

Ovarian function progressively declines during aging and in some pathophysiological conditions including karyotype abnormality, autoimmune diseases, ...

Evaluation of a Point-of-Care Testing Analyzer for Measuring Peripheral Blood Leukocytes

White blood cell (WBC) is an important indicator of inflammation in the body, and it can help distinguish between bacterial and viral infections. At present, most primary medical institutions in China have a poor percentage of adoption of blood-testing technology, and a hematology detection system with a high price to performance ratio and easy operation is urgently needed in primary healthcare centers. This paper introduces the principle and operation procedures of a point-of-care testing (POCT) card-based leukocyte analyzer (evaluated system), which was used to detect WBC indexes such as neutrophils, lymphocytes, and intermediate group cells (including eosinophils, basophils, and monocytes) in whole blood. The results from the evaluated system were compared to those from two commercial automatic hematology analyzers (reference system). The correlation and consistency between the evaluated system and the commercial reference systems were analyzed. The results showed that WBC count and number of granulocytes detected by the evaluated and reference systems showed a strong positive correlation (rs = 0.972 and 0.973, respectively), while the number of lymphocytes showed a relatively low correlation (rs = 0.851). A Bland-Altman plot showed that the major difference between the values detected by the evaluated system and the reference systems is within 95% limits of agreement (LoA), indicating that the two systems are in good agreement. In conclusion, the evaluated system has an excellent correlation, robust consistency, and a reliable comparison with the results of the widely used automatic hematology analyzers. It is ideal for WBC detection in primary medical institutions where a full-automatic five-category hematology analyzer is unavailable, especially during the COVID-19 normalized prevention and control period.

A protocol to measure peripheral blood leukocytes using a POCT card-based leukocyte analyzer is presented here. Same blood samples were tested by two automated hematology analyzers to evaluate the consistency and accuracy of the results. The results showed that the evaluated analyzer had a good correlation with the reference system.

Évaluation d’un analyseur de test au point de service pour la mesure des leucocytes du sang périphérique

White blood cell (WBC) is an important indicator of inflammation in the body, and it can help distinguish between bacterial and viral infections. At ...

Cox-Maze IV Procedure Concomitant with Valvular Surgery In Situs Inversus Dextrocardia: A Single-Center Experience in China

Atrial fibrillation (AF) is the most common cardiac arrhythmia. The use of ablation technologies made the Cox-Maze IV procedure (CMP-IV) technically easier, faster, becoming the gold standard for the surgical treatment of AF. However, the efficacy and safety of CMP-IV in situs inversus dextrocardia are largely unknown. This paper summarizes the CMP-IV procedure performed concomitantly with valvular surgery in patients with situs inversus dextrocardia at this institution.
From February 2016 to September 2020, three dextrocardia patients with persistent AF and valvular diseases were referred to this institution for valvular and CMP-IV surgery. CMP-IV was performed using either cryoablation with a nitrous oxide (N2O)-based cryoprobe or a bipolar radiofrequency clamp and bipolar radiofrequency pen. Mechanical valve replacement or mitral vavuloplasty was performed in another patient in addition to tricuspid annuloplasty. Transmurality of the ablated atrial tissues was evaluated by electron microscopy. Heart function was assessed by transthoracic echocardiography. Cardiac rhythm was monitored by 24 h Holter at 3, 6, 12, 18, 24, and 48 months follow-up. 
All the AF was successfully eliminated in the ablation procedure without recurrence or other complications during hospitalization. The mean bypass and crossclamp times were similar in all the patients. The postoperative ventilator support time, the duration of stay in the ICU, and postoperative residence time were also not significantly different among the patients. Transmural atrial necrosis was detected in the ablated atrial tissues. Sinus rhythm maintenance was achieved at 3, 6, 12, 18, 24, and 48 months follow-up in all the patients. All valve protheses switched freely; no tricuspid regurgitation was observed. The results of the present study demonstrate that the CMP-IV is safe and effective in eliminating AF in dextrocardia patients concomitant with valvular surgery.

We summarize the Cox-Maze IV procedure concomitant with valvular surgery performed in patients with situs inversus dextrocardia at this institution.

Procédure de Cox-Maze IV concomitante à la chirurgie valvulaire in situs inversus dextrocardia : une expérience monocentrique en Chine

Atrial fibrillation (AF) is the most common cardiac arrhythmia. The use of ablation technologies made the Cox-Maze IV procedure (CMP-IV) technically ...