Ce travail a été soutenu par des subventions R01DE018138 de la National Institutes of Health (PX) et en partie par la Virginia Commonwealth University Research Programme d&#39;encouragement présidentielle (PRIP) 144602-3 (PX). Nous remercions les Drs. Lei Chen, Yuetan Dou et Xiaojing Wang pour aider à la construction de mutants du génome entier. Nous remercions également le Core Facility l&#39;ADN à l&#39;Université Virginia Commonwealth pour le séquençage de l&#39;ADN.

1. Conception Primer <ol><li> Les amorces sont conçues à l&#39;aide de scripts maison basé sur le S. séquence du génome sanguinis SK36. Trois ensembles d&#39;amorces, F1/R1, F2/R2, F3/R3 et sont conçus pour l&#39;amplification de la séquence 1-kb en amont du gène cible, la résistance aphA-3 du gène codant pour la kanamycine (Km r), et la protéine 3 1 -kb de séquence en aval du gène cible, respectivement (figure 1). Parmi ces amorces, F1 et R3 sont conçus à l&#39;aide de la suite ePrimer3 EMBOSS de programmes ( <a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a> ) pour amplifier des régions flanquantes en amont ou en aval de la cible gène. Amorces spécifiques de gènes, R1 et F3, sont conçus en fonction de la 5 &#39;et 3&#39; des séquences du gène cible. R1 et F3 amorces contiennent les séquences d&#39;adaptateur 25-BP à leur extrémité 5 &#39;qui sont complémentaires de la aphA-3gène. Les températures de fusion de chacune des amorces ont été conçues pour être aussi proche que possible de 60 ° C pour permettre l&#39;utilisation d&#39;une température de recuit uniforme pour toutes les réactions de PCR en format de 96-puits. </li><li> F1, R1, R3 F3 et les amorces sont synthétisées dans des plaques 96 puits sur la base d&#39;un ordre des gènes. Chaque plaque contient un type d&#39;amorces dans l&#39;ordre même gène. Diluer les amorces en plaque de 96 puits d&#39;amorce de travail à une concentration finale de 10 pM pour l&#39;amplification PCR à l&#39;aide d&#39;une pipette multicanaux. </li></ol> 2. À haut débit amplification par PCR et purification <ol><li> Pour amplifier à haut débit de 1 kb en amont ou en aval de la cible S. gènes sanguinis, assembler un mélange cocktail PCR sur de la glace dans un tube conique de 15 ml contenant 1640 pi ddH 2 O, 250 pi 10xHigh Fidelity PCR Buffer, 200 ul de 10 mM de dNTP mélange, 100 ul de 50 mM MgSO 4, 100 pi de 10 ng / ul S. l&#39;ADN génomique SK36 sanguinis et 10 pl Platinum Taq ADN polymerase de haute fidélité et de transfert 23 ul du mélange dans chaque puits de plaque de 96 puits PCR à l&#39;aide d&#39;une pipette multicanaux. Transférer 1 ul de chaque F1 et R1 (ou F3 et R3) à partir de 10 uM de travail plaques d&#39;amorces pour la plaque PCR en utilisant une pipette multicanaux. Sceller la plaque PCR et l&#39;amplification à 94 ° C pendant 1 min et 30 cycles de 94 ° C pendant 30 secondes, 54 ° C pendant 30 secondes et 68 ° C pendant 1,5 min. </li><li> Préparez 1% gel d&#39;agarose contenant du bromure d&#39;éthidium à 48 puits multicanal chargement pipette raccord. Mélanger 4 ul produit PCR avec 1 pi de tampon de chargement 5xDNA sur plaque de 96 puits et de charger les échantillons sur un gel d&#39;agarose à l&#39;aide d&#39;une pipette multicanaux 10 pi. Exécuter électrophorèse à 135 V pendant 30 min. Examinez la bande sur un gel de la documentation en vertu UVP et d&#39;analyse. </li><li> Purifier produits de PCR par 96 PureLink kit de purification PCR en utilisant la centrifugation conformément aux instructions du fabricant. Pour l&#39;élution de l&#39;ADN, ajouter 40 ul stériles ddH 2 O pour le bien de la bROUVER plaque. </li><li> Choisir au hasard plusieurs amplicons purifiés sur la plaque d&#39;examiner les concentrations d&#39;ADN en utilisant un spectrophotomètre NanoDrop. Ajuster la concentration d&#39;amplicons sur la plaque à ~ 10 ng / ul. </li><li> Un plasmide contenant la cassette kilomètres r est digéré par EcoRI comme matrice de PCR. Le plasmide digéré est purifié par le kit QIAquick PCR purification et l&#39;ADN plasmidique linéaire est ajustée à la concentration finale d&#39;ADN à 10 ng / ul. Monter 25 ul de mélange amplicon km cassettes r dont 16,4 ul O ddH 2, 2,5 pi 10xHigh Fidelity PCR Buffer, 2 ul de 10 mM de dNTP mélange, 1 ul de 50 mM de Mg SO 4, 1 pl de 10 uM F2, 1 pl de 10 R2 uM, 1 pi d&#39;ADN plasmidique linéaire et 0,1 ul fidélité Platinum Taq ADN polymérase haute. Effectuer une amplification PCR à 94 ° C pendant 1 min, et 30 cycles de 94 ° C pendant 30 sec, 55 ° C pendant 30 s et 68 ° C pendant 1 min. Examiner le produit de PCR par électrophorèse sur gel d&#39;agarose 1%. Poola majeure partie de l&#39;amplicon km cassettes r de 10 individus PCR purifié par le kit QIAquick PCR purification. Ajuster la concentration amplicon à 10 ng / ul. </li><li> Pour obtenir le dernier linéaire amplicon de PCR recombinant, trois amplicons PCR sont combinés les uns avec les pl 1 (en des quantités à peu près égales molaire) dans une plaque de PCR ainsi que la matrice de PCR. D&#39;autres composants PCR est ajouté dont 14,4 ul O ddH 2, 2,5 pi 10xHigh Fidelity PCR Buffer, 2 ul de 10 mM de dNTP mélange, 1 ul de 50 mM de Mg SO 4, 1 ul de 10 uM F1, 1 pl de 10 uM R3, 0,1 pi d&#39;ADN Platinum Taq polymérase haute fidélité. L&#39;amplification par PCR est effectuée à 94 ° C pendant 2 min, 30 cycles de 94 ° C pendant 30 sec à 55 ° C pendant 30 s et 68 ° C pendant 3,5 min, et enfin 68 ° C pendant 4 min. </li><li> Examinez le amplicons PCR sur gel d&#39;agarose. Purifier et quantifier les amplicons de PCR comme décrit ci-dessus. Geler les amplicons PCR recombinés à -20 ° C. </li></ol> 3. Comcompétente Préparation des cellules <ol><li> Bouillon Todd Hewitt est préparé, pH ajusté à 7,6 avec du NaOH 10 N, on chauffe à ébullition, puis refroidi à température ambiante et on stérilise à l&#39;aide de polystyrène 0,22 um filtre 4. Ajouter 300 ul cheval inactivé par la chaleur sérums (concentration finale de 2,5%) à 11,7 ml de bouillon Todd Hewitt dans 15 ml tube conique de rattraper TH + support HS. TH + HS aliquote milieu dans 2 ml et 10 ml dans des tubes. </li><li> Inoculer 5 ul de stock S. sanguinis SK36 congelé à -80 ° C en 2 TH ml + support HS et incuber la culture d&#39;une nuit avec le plafonnement bien à 37 ° C, accompagnée de pré-incubation de 10 ml-TH + HS tube. </li><li> Après une nuit, transférer 50 ul culture dans 10 ml TH + HS et incuber le tube à 37 ° C pendant 3 heures (correspondant à DO 660 de 0,07 à 0,08), immédiatement à l&#39;aide d&#39;une transformation. </li></ol> 4. Transformation cellulaire et de sélection des antibiotiques <ol><li> Ajouter 2 ul de 70 ng S. sanguinis SK36 compétence peptide stimulant (CSP) et 2 pi linéaire recombinant amplicon de PCR (~ 50 ng) pour tubes Eppendorf de 96 puits à bloc et préchauffer les à 37 ° C. Transfert 330 ul de 3 h-incubé SK36 la culture dans chaque tube. Incuber à 37 ° C pendant 1 heure. Remplacer l&#39;ADN avec O stérile ddH 2 comme contrôle. </li><li> Placez le bloc sur la glace et se propager 100 ul de chaque transformation sur bouillon coeur-cervelle (BHI) plaque de gélose avec 500 ug / ml de kanamycine. Incuber les plaques à 37 ° C pendant 2 jours dans des conditions micro-aérobies. </li></ol> 5. Confirmation mutant et de stockage <ol><li> Pour chaque mutant remplacement, au hasard, relever 2 colonies individuelles, inoculer la colonie dans 5 ml de BHI contenant 500 ug / ml de kanamycine et incuber l&#39;inoculum microaérobie une nuit à 37 ° C. Cryoconservation de chaque culture dans du glycérol 30% à -80 ° C </li><li> Afin de déterminer si le mutant contenant le gène de remplacement prévu, effectuer une PCR sur colonie pour chaque mutant en utilisant F1 et R3amorces dans plaque de 96 puits PCR. Environ 1-pi culture d&#39;une nuit de colonie individuelle est utilisée en tant que matrice d&#39;ADN dans le 25-pl réaction d&#39;amplification par PCR. La PCR est réalisée à 94 ° C pendant 5 min, 35 cycles de 94 ° C pendant 30 sec, 55 ° C pendant 30 s et 68 ° C pendant 3,5 min, et enfin 68 ° C pendant 4 min. </li><li> Pour identifier avec précision double bande mutants ou contaminant amplicons PCR, d&#39;examiner l&#39;amplicon PCR par électrophorèse pendant 4 heures sur&gt; 12 cm de long 2% gel d&#39;agarose avec coloration au bromure d&#39;éthidium. Sous cette condition électrophorèse sur gel d&#39;agarose, les amplicons avec ≥ 100 pb différence ont été clairement identifiés. Lorsque des bandes résultant de l&#39;amplification de la cassette de r km et le gène de type sauvage sont prévus pour différer par &lt;100 pb, une amorce T1 interne est utilisée pour déterminer si un gène de type sauvage peut être détecté par PCR. </li><li> Pour confirmer la suppression, les amplicons sont purifiés par PureLink 96 PCR purification kit et séquencé en utilisant l&#39;amorce P1 quise lie à la cassette r km. Ne garder que les mutants correctes confirmés par séquençage. </li></ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

Aucun conflit d&#39;intérêt déclaré.

Pour minimiser les effets possibles polaires du remplacement d&#39;un gène ciblé avec le gène exogène antibiotiques sur les gènes voisins, deux mesures sont prises en amorce initiale de conception. Pour la plupart des gènes délétés, la amorces R1 et F3 sont conçus pour supprimer de la région codante de 6 pb après le codon d&#39;initiation de 30 pb avant le codon stop. Les 30 dernières paires de bases sont conservées pour protéger le potentiel du site de liaison ribosomique utilisé par le gène adjacent e...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; Noms des</strong</td&gt;<td<strong&gt; Société</strong</td&gt;<td<strong&gt; Catalogue</strong</td&gt;<td<strong&gt; Commentaires (optionnel)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; Primer F2</td&gt;<td&gt; Integrated DNA Technologies</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<tdR2 Primer&gt;</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<tdPrimer&gt; F2p</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<tdP1 Primaire&gt;</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<tdP2 Primer&gt;</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_R1_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_F3_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_R1p_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; Séquence: NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<tdADN polymérase&gt;</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; 11304-102</td&gt;<td&gt; Platinum Taq DNA Polymerase High Fidelity</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; New England Biolabs Inc</td&gt;<td&gt; R0101S</td&gt;<tdDes enzymes de restriction&gt;</td&gt;</tr&gt;<tr&gt;<td&gt; Agar</td&gt;<td&gt; Bioanalytique américain</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Agarose</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 237500</td&gt;<td&gt; Brain Heart Infusion</td&gt;</tr&gt;<tr&gt;<td&gt; Sérum de cheval</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; SH3007403</td&gt;<td&gt; Sérum de cheval</td&gt;</tr&gt;<tr&gt;<td&gt; KM</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; BP906-5</td&gt;<td&gt; Kanamycine</td&gt;</tr&gt;<tr&gt;<td&gt; TH bouillon</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 249240</td&gt;<td&gt; Bouillon Todd Hewitt</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 PCR purification kit</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td&gt; 28106</td&gt;<td&gt; Kit QIAquick PCR purification</td&gt;</tr&gt;<tr&gt;<td&gt; Filtre</td&gt;<td&gt; Corning</td&gt;<td&gt; 431117</td&gt;<td&gt; Filtre de 0,22 um polystyrène</td&gt;</tr&gt;<tr&gt;<td&gt; Système Anoxomat</td&gt;<td&gt; Mart Microbiology BV</td&gt;<td&gt; Anoxomat Mark II</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Centrifugeuse de paillasse</td&gt;<td&gt; Thermo Scientific</td&gt;<td&gt; 75004377</td&gt;<td&gt; Sorvall Legend RT plus microplaque rotor</td&gt;</tr&gt;<tr&gt;<tdDocumentation&gt; Gel</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc-It 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Incubateur</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; 11-690-625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet Gel XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; Labnet Gel XL</td&gt;</tr&gt;<tr&gt;<td&gt; Microcentrifugeuse</td&gt;<td&gt; Eppendorf</td&gt;<td&gt; 22621408</td&gt;<td&gt; Microcentrifugeuse 5415 R</td&gt;</tr&gt;<tr&gt;<tdPipettes multicanaux&gt;</td&gt;<td&gt; Thermo Scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; Thermocycleur</td&gt;<td&gt; Applied Biosystems Inc</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR System 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagenèse et un seul gène suppression ya deux méthodes appliquées dans inactivation du gène du génome entier dans 1,2 bactéries. Bien mutagenèse par transposon prend moins de temps, moins coûteux, et ne nécessite pas l&#39;information du génome terminée, il ya deux faiblesses de cette méthode: (1) la possibilité d&#39;une mutants disparates dans la bibliothèque mixte mutant qui contre-sélectionne les mutants où la concurrence est diminué; et (2) la possibilité d&#39;inactivation partielle de gène par lequel les gènes ne sont pas entièrement perdent leur fonction après l&#39;insertion d&#39;un transposon. Analyse par deletion seul gène peut compenser les inconvénients liés à la mutagenèse par transposon. Pour améliorer l&#39;efficacité de l&#39;ensemble du génome délétion du gène unique, nous essayons de mettre en place une technique à haut débit pour l&#39;ensemble du génome délétion du gène unique à l&#39;aide sanguinis Streptococcus comme organisme modèle. Chaque délétion du gène construire dans S. sanguinis génome est conçu pour comporter 1Kb en amont du gène ciblé, le gène aphA-3, codant pour la protéine de résistance à la kanamycine et le 1-ko aval du gène ciblé. Trois ensembles d&#39;amorces F1/R1, F2/R2 et F3/R3, respectivement, sont conçues et synthétisées dans un format de plaque à 96 puits pour PCR des amplifications de ces trois composantes de chaque suppression construire. R1 et F3 amorces contiennent 25-pb des séquences qui sont complémentaires de régions de la aphA-3 du gène à leur extrémité 5 &#39;. A grande échelle amplification par PCR du gène aphA-3 est effectuée une fois pour toutes les constructions de deletion création d&#39;un seul gène. Le promoteur de gène aphA-3 est initialement exclu de réduire au minimum l&#39;effet potentiel polaire de cassette kanamycine. Pour créer les constructions de deletion du gène à haut débit amplification par PCR et la purification sont effectuées dans un format de plaque à 96 puits. Un amplicon PCR recombinante linéaire pour chaque délétion du gène sera constitué par quatre réactions PCR en utilisant l&#39;ADN polymérase haute fidélité. Le expon initialephase de croissance préférentiel de S. sanguinis cultivées en bouillon Todd Hewitt supplémenté avec 2,5% de sérum de cheval inactivé est utilisé pour augmenter la compétence pour la transformation de la PCR recombinante constructions. Sous cette condition, jusqu&#39;à 20% de S. sanguinis cellules peuvent être transformées en utilisant ~ 50 ng d&#39;ADN. Sur la base de cette approche, 2.048 mutants avec un seul gène de suppression ont finalement été obtenus à partir des gènes chez S. 2270 sanguinis l&#39;exclusion des quatre ORF du gène entièrement contenue dans d&#39;autres ORF de S. SK36 sanguinis et 218 gènes potentiels essentielles. La technique sur la création de constructions de deletion du gène est un débit élevé et pourrait être facile à utiliser dans l&#39;ensemble du génome délétions de gènes uniques pour toutes les bactéries transformables.

Après amplification par PCR en utilisant des amorces F1 et R1, R3 et F3 et, approximativement 1-kb en amont et en aval de chaque S. sanguinis gène ont été obtenus dans le format 96-puits, respectivement (figure 2A). Dans nos conditions de PCR utilisant des amorces conçues et, un produit spécifique a été amplifié à partir de S. sanguinis ADN génomique dans chaque réaction PCR. Ce résultat indique les amorces étaient très spécifiques à la cible de S. sanguinis. ...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Une échelle du génome unique efficace méthode de mutation du gène a été établie à l&#39;aide<em&gt; Streptococcus sanguinis</em&gt; Comme organisme modèle. Cette méthode a réalisé via PCR à haut débit recombinantes et des transformations.

La délétion de gènes dans le génome entier<em&gt; Streptococcus sanguinis</em&gt; Par PCR à haut débit

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

16.4K vues.  Virginia Commonwealth University. Une échelle du génome unique efficace méthode de mutation du gène a été établie à l'aide Streptococcus sanguinis Comme organisme modèle. Cette méthode a réalisé via PCR à haut débit recombinantes et des transformations.

Vidéo: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Analyse du génome entier en utilisant ChIP d&#39;identifier les gènes cibles spécifiques Isoform

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Recherche

Biologie

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

L&#39;échelle du génome d&#39;écran pour cibles des miRNA l&#39;aide de l&#39;ID de bibliothèque MISSION cible

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. elegans, gene function can be knocked down simply and efficiently by feeding worms with bacteria expressing a dsRNA corresponding to a specific gene 1. While the creation of libraries of RNAi clones covering most of the C. elegans genome 2,3 opened the way for true functional genomic studies (see for example 4-7), most established methods are laborious. Moy and colleagues have developed semi-automated protocols that facilitate genome-wide screens 8. The approach relies on microscopic imaging and image analysis. 
	Here we describe an alternative protocol for a high-throughput genome-wide screen, based on robotic handling of bacterial RNAi clones, quantitative analysis using the COPAS Biosort (Union Biometrica (UBI)), and an integrated software: the MBioLIMS (Laboratory Information Management System from Modul-Bio) a technology that provides increased throughput for data management and sample tracking. The method allows screens to be conducted on solid medium plates. This is particularly important for some studies, such as those addressing host-pathogen interactions in C. elegans, since certain microbes do not efficiently infect worms in liquid culture.
	We show how the method can be used to quantify the importance of genes in anti-fungal innate immunity in C. elegans. In this case, the approach relies on the use of a transgenic strain carrying an epidermal infection-inducible fluorescent reporter gene, with GFP under the control of the promoter of the antimicrobial peptide gene nlp 29 and a red fluorescent reporter that is expressed constitutively in the epidermis. The latter provides an internal control for the functional integrity of the epidermis and nonspecific transgene silencing9. When control worms are infected by the fungus they fluoresce green. Knocking down by RNAi a gene required for nlp 29 expression results in diminished fluorescence after infection. Currently, this protocol allows more than 3,000 RNAi clones to be tested and analyzed per week, opening the possibility of screening the entire genome in less than 2 months.

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

We describe a protocol using C. elegans and RNAi feeding libraries that allows automated measurement of multiple parameters such as fluorescence, size and opacity of individual worms in a population. We give one example of a screen to identify genes involved in anti-fungal innate immunity in C. elegans.

Quantitatifs et automatisé à haut débit du génome à l&#39;échelle écrans ARNi dans C. elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

Le processus de monstre vert pour la génération de souches de levure portant la délétion de gènes multiples

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Profilage individuel embryonnaires humaines Cellules souches par RT-PCR quantitative

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often depend on its interactions with other proteins. Here, we describe a protocol for the yeast protein-fragment complementation assay (PCA), a powerful method to detect direct and proximal associations between proteins in living cells. The interaction between two proteins, each fused to a dihydrofolate reductase (DHFR) protein fragment, translates into growth of yeast strains in presence of the drug methotrexate (MTX). Differential fitness, resulting from different amounts of reconstituted DHFR enzyme, can be quantified on high-density colony arrays, allowing to differentiate interacting from non-interacting bait-prey pairs. The high-throughput protocol presented here is performed using a robotic platform that parallelizes mating of bait and prey strains carrying complementary DHFR-fragment fusion proteins and the survival assay on MTX. This protocol allows to systematically test for thousands of protein-protein interactions (PPIs) involving bait proteins of interest and offers several advantages over other PPI detection assays, including the study of proteins expressed from their endogenous promoters without the need for modifying protein localization and for the assembly of complex reporter constructs.

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Proteins interact with each other and these interactions determine in a large part their functions. Protein interaction partners can be identified at high-throughput in vivo using a yeast fitness assay based on the dihydrofolate reductase protein-fragment complementation assay (DHFR-PCA).

L&#39;échelle du génome interaction protéine-protéine Le dépistage par Protein-fragment complémentation Assay (PCA) dans les cellules vivantes

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Haut-débit criblage de modulateurs chimique des gènes post-transcriptionnelle réglementées

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

Analyse qPCRTag - un débit élevé, PCR temps réel pour Sc2.0 Génotypage

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

La cartographie du génome à l&#39;échelle du médicament-ADN interactions dans les cellules avec COSMIC (réticulation de petites molécules pour isoler la chromatine)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID-seq: L&#39;échelle du génome Cartographie des protéine-ADN Interactions par séquençage à haut débit de fragments d&#39;ADN adénine-méthylé

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...