Les auteurs tiennent à remercier Branden Moriarity, David Largaespada, et Vincent Keng à l&#39;Université du Minnesota, et Adam Dupuy à l&#39;Université de l&#39;Iowa pour leur aide dans l&#39;élaboration du protocole décrit ci-dessus.

1. L&#39;élevage et le vieillissement des animaux transgéniques <ol><li> Sélectionnez les souches de souris transgéniques appropriés pour votre expérience. Une expérience typique utilisera trois lignées transgéniques; une souris transposase conditionnelle, une souris hébergeant un concatémère de transposons, et une souris exprimant la recombinase Cre dans les cellules considérées comme les cellules d&#39;origine pour le cancer désiré. Si le cancer est modélisé a une mutation connue dans un grand pourcentage des patients, il peut être souhaitable d&#39;inclure cette mutation au début. Des exemples de ces «prédisposants» comprennent des mutations Kras activés, TP53 dominantes négatives ou un allèle Pten floxé. En ajoutant une mutation prédisposant le modèle peut mieux représenter le cancer chez l&#39;homme (voir 1.3). Plusieurs transposase Sleeping Beauty et souris transposons sont disponibles auprès de l&#39;Institut national du cancer du référentiel de la souris ( <a href="http://mouse.ncifcrf.gov/" target="_blank">http://mouse.ncifcrf.gov/</a> ). </li><li> Souris Race transposase conditionnelles avec des souris hébergeant les transposons pour finalement obtenir des souris homozygotes pour les deux allèles si possible. Race descendance homozygote chez la souris exprimant la recombinase Cre pour générer vos triples souris transgéniques expérimentales (Figure 2). Remarque: Pour obtenir des souris homozygotes sont pas toujours possibles ou idéal. Par exemple, homozygotes p53 dominantes souris négatifs sont beaucoup plus difficiles à élever que les souris hétérozygotes. En outre, il est utile de veiller à ce que les portées suivre la génétique mendélienne pour confirmer que le schéma de sélection est réussie. </li><li> Si vous utilisez un prédisposait, les souris se reproduisent abord avec la transposase à des souris avec l&#39;allèle prédisposant. Dans le même temps, les souris exprimant la recombinase Cre race à des souris portant les transposons. Créer des souris homozygotes pour chaque allèle si possible. Enfin, élever la descendance homozygote des deux précédents programmes de sélection afin de générer quadruple anim transgénique expérimentaleals. </li><li> En plus des animaux de laboratoire, de générer des cohortes de contrôle de la souris. Le groupe témoin se compose normalement de même portée de l&#39;élevage expérimental qui héritent seulement deux des trois allèles (figure 2). Dans le cas d&#39;un prédisposait, les souris, y compris trois des quatre allèles sera également nécessaire. </li><li> Surveiller les souris expérimentales et le contrôle quotidiens pour le développement de la tumeur et / ou un état moribond. Suivez votre soins aux animaux et utilisation comité (IACUC) les exigences pour l&#39;élevage. En outre, il est courant de déterminer un âge dans lequel vous allez sacrifier un animal si elle n&#39;est pas encore devenue moribonde. Dix-huit mois est un âge typique à laquelle les souris sont euthanasiées. </li></ol> 2. L&#39;autopsie des animaux transgéniques <table border="1"><tbody><tr><td> Nom du réactif </td><td> Entreprise </td><td> Numéro de catalogue </td></tr><tr><td> Sure-Seal InducChambre tion </td><td> Arbre Scientific Brain </td><td> EZ-177 </td></tr><tr><td> Cryovial </td><td> Bioexpress </td><td> C-3355-2 </td></tr><tr><td> 10% tamponnée de formaldéhyde </td><td> Sigma Aldrich </td><td> HT501128-4L </td></tr></tbody></table> Réactifs Tableau 1. Nécessaire. <ol><li> Lorsqu&#39;une souris est moribond ou a atteint la fin de la durée de vie déterminée, euthanasier des animaux en utilisant une chambre de CO 2 suivant vos directives IACUC. En général, placer l&#39;animal dans une chambre à gaz propre, ouvrir le réservoir de gaz et régler le régulateur de lire pas plus de 5 livres par pouce carré. Remplissez lentement pour minimiser l&#39;irritation nasale et oculaire et l&#39;aversion pour le CO 2. Assurez-vous que le cœur de l&#39;animal est ne bat plus et ne répond pas quand on les touche dans les yeux. </li><li> Extérieur pulvérisation de souris sacrifiées à l&#39;éthanol 70%. </li><li> Placer la souris sur une planche à l&#39;autopsie et sécuriser avec des épingles à dissection. Utilisez des ciseaux uned une pince pour ouvrir la souris et le prélèvement d&#39;organes. Déterminer quels sont les organes doivent être prélevés est un projet dépend. Toutefois, il est recommandé de toujours recueillir la rate et le foie que ces organes donnent souvent des indications importantes sur lesquelles la souris était moribond. Également recueillir le sternum de l&#39;analyse du potentiel de moelle osseuse. En outre, il est toujours bénéfique pour collecter n&#39;importe quel organe ou tissu qui semble anormale. </li><li> Les tissus et les tumeurs qui sont collectées devraient être divisé en quatre sections. Une section est fixé à 10% du formol tamponné pendant 18 heures suivie d&#39;éthanol à 70%. Cette section peut être utilisée pour la coloration H &amp; E et / ou IHC. Les trois dernières sections, qui sont généralement de 50 à 100 mg de taille, pression sont congelés dans l&#39;azote liquide. Ceux-ci peuvent être utilisés pour l&#39;ADN, de l&#39;ARN et de l&#39;isolement des protéines. </li><li> Jetez les mouchoirs carcasse restante et selon les directives du IACUC. </li></ol> 3. Isolement de l&#39;ADN génomique de tumeurs <table border="1"><tbody><tr><td> &lt;Nom strong&gt; du réactif </td><td> Entreprise </td><td> Numéro de catalogue </td></tr><tr><td> Solution de précipitation des protéines </td><td> Qiagen </td><td> 158910 </td></tr><tr><td> Tampon de lyse cellulaire </td><td> Qiagen </td><td> 158906 </td></tr><tr><td> Protéinase K </td><td> Qiagen </td><td> 158920 </td></tr><tr><td> RNase A </td><td> Qiagen </td><td> 158924 </td></tr><tr><td> TE Buffer </td><td> Promega </td><td> V6232 </td></tr></tbody></table> Réactifs Tableau 2. Nécessaire. <ol><li> Hacher finement l&#39;échantillon de tumeur congelée (50 à 100 mg) en utilisant une lame de rasoir propre. </li><li> Lieu hachée tissu dans un tube de 1,5 ml et ajouter 1 ml de tampon de lyse cellulaire contenant 5 pi protéinase K solution (20 mg / ml). </li><li> Vortex fond. </li><li> Incuber dans un shaker 55 ° C fixé à 250 tours par minute pendant au moins 4 heures, de préférence pendant la nuit. </li><li> Ajouter 1 RNase Une solution (10 mg / ml) et inverser tubes 25 fois. </li><li> Incuber à 37 ° C pendant 30 min. </li><li> Laisser refroidir à température ambiante en plaçant sur de la glace pendant 3 min. </li><li> Ajouter 333 ul de solution de précipitation des protéines et homogénéiser vigoureusement au vortex. </li><li> Centrifuger à 14000 rpm 10 min. Les protéines doivent granulés. Si pellet est très faible, vortex encore, incuber sur de la glace pendant 5 min, puis re-centrifugeuse. </li><li> Décanter le surnageant contenant l&#39;ADN dans un récipient propre tube de 15 ml centrifugeuse. </li><li> Ajouter un volume égal à 100% d&#39;isopropanol et mélanger doucement par inversion 50 fois. </li><li> Centrifuger à 3500 rpm pendant 3 min. </li><li> Rejeter le surnageant. </li><li> Ajouter 1 ml d&#39;éthanol à 70% et inverser tube à plusieurs reprises à laver le culot. </li><li> Transférer le culot lavé avec de l&#39;éthanol à un tube de 1,5 ml. </li><li> Centrifuger à 14000 rpm pendant 5 min à 4 ° C. </li><li> Verser l&#39;éthanol et inverser le tube à air sec (environ 5 à 30 minutes). </li><li> Resuspendre l&#39;ADN pEllet dans 50 à 500 ul de TE en fonction de la taille du culot d&#39;ADN. </li><li> D&#39;incubation en option à 37 ° C pour remettre en suspension l&#39;ADN. </li><li> Conserver à 4 ° C ou -20 ° C pour le stockage à long terme. </li></ol> 4. Linker médiation-PCR utilisant l&#39;ADN génomique à partir de tumeurs <table border="1"><tbody><tr><td> Nom du réactif </td><td> Entreprise </td><td> Numéro de catalogue </td></tr><tr><td> Bfai </td><td> New England Biolabs </td><td> R0568S </td></tr><tr><td> NlalII </td><td> New England Biolabs </td><td> R0125S </td></tr><tr><td> MinElute plaques de 96 puits </td><td> Qiagen </td><td> 28051 </td></tr><tr><td> QIAvac collecteur sous vide 96 </td><td> Qiagen </td><td> 19504 </td></tr><tr><td> Multi-MicroPlate Genie, 120V </td><td> Scientific Industries, Inc </td><td> SI-4000 </td></tr><tr><td> ADN ligase T4 avec du tampon de ligation 5x </td><td> Invitrogen </td><html><td> 15224-041 </td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td></tr><tr><td> 25 mM de dNTP </td><td> Bioexpress </td><td> C-5014-200 </td></tr><tr><td> Taq Platinum </td><td> Invitrogen </td><td> 10966-034 </td></tr><tr><td> FastStart polymérase Taq ADN </td><td> Roche </td><td> 12032929001 </td></tr><tr><td> Agarose </td><td> Promega </td><td> V3121 </td></tr><tr><td> TAE Buffer </td><td> Promega </td><td> V4271 </td></tr><tr><td> TE Buffer </td><td> Promega </td><td> V6232 </td></tr><tr><td> Le bromure d&#39;éthidium </td><td> Promega </td><td> H5041 </td></tr></tbody></table> Réactifs Tableau 3. Nécessaire. Séquences de liaison Bfai linker + 5 &#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3&#39; Bfai linker-5 &#39;Phos-TAGTCCCTTAAGCGGAG 3&#39;NH2 &quot;&gt; Linker NlalII + 5&#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 &#39; NlalII linker-5 &#39;Phos-GTCCCTTAAGCGGAGCC 3&#39; Les séquences des amorces PCR primaire avant droite (NlalII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC PCR primaire avant côté gauche (bfai): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC Primaire PCR inverse pour le côté droite et à gauche: Spl Link1 1 GTAATACGACTCACTATAGGGC Côté secondaire PCR avant droite: Exemple d&#39;une amorce secondaire Illumina code-barres 5 &#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (les N représente le code à barres de 12 pb, la séquence en majuscules sont requises pour la plateforme Illumina, et la séquence en minuscules se lie à l&#39;transposon.) PCR secondaire avant côté gauche: Exemple d&#39;une seconde Illumina code à barresapprêt dary 5&#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (les N représentent le code à barres de 12 pb, la séquence en majuscules sont nécessaires pour la plate-forme Illumina, et la séquence en minuscules se lie à l&#39;transposon.) Secondaire PCR inverse pour le côté droite et à gauche: linker amorces emboîtées inverse 5 &#39;CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC <ol><li> Recuire le + et le - linkers pour linkers bfai deux linkers et NlaII en mélangeant 50 pi de linker + (100 uM) avec 50 ul de lieur-(100 M) et ajouter 2 pi de NaCl (5 M) dans un tube de 1,5 ml. Lieu à 95 ° C pour un autre 5 minutes. Éteignez bloc de chauffage et laisser refroidir lentement à température ambiante (cela prend une heure ou plus). Après refroidissement, linkers recuits peuvent être stockés dans un congélateur à -20 ° C jusqu&#39;à ce que nécessaire. </li><li> Préparer deux aliquotes de l&#39;ADN tumoral, chaque aliquote contenant 1 ug d&#39;ADN. Un aliquot sera digéré espritenzyme de restriction qui coupe ha à proximité de la &quot;bonne&quot; fin du transposon. La seconde partie aliquote sera digéré par une enzyme de restriction qui coupe à proximité de la &quot;gauche&quot; fin du transposon. Ceci est fait pour maximiser les chances de amplifiant chaque site d&#39;insertion du transposon. </li><li> Digérer l&#39;ADN tumoral dans une partie aliquote en utilisant le &quot;droit&quot; NlaII enzyme côté, et de digérer l&#39;ADN tumoral dans la partie aliquote autre en utilisant la &quot;gauche&quot; enzyme côté bfai: mélanger 1 ul d&#39;enzyme, 5 pl de tampon NEB 10x n ° 4, l&#39;ADN ( 1 pg) et ddH 2 O pour un volume total de 50 ul. Digest ADN nuit à 37 ° C au bain-marie ou un incubateur. </li><li> Chauffer inactiver les enzymes (bfai = 80 ° C pendant 20 min, NlalII = 65 ° C pendant 20 minutes). </li><li> Nettoyez les échantillons digérés en plaçant des échantillons dans MinElute plaque de 96 puits, plaque lieu dans le collecteur sous vide et le vide pendant environ 15 min jusqu&#39;à ce que les puits air sec. </li><li> Retirer la plaque du collecteur à vide et en bas blot de plaque de 96 puits avec une serviette en papier pour enlever tout liquidationd </li><li> Ajouter 30 ul ddH 2 O dans chaque puits et agiter sur un ensemble agitateur orbital à température élevée pendant 2 min, ou pipeter le haut et le bas 20 à 40 fois. </li><li> Transfert volume entier dans les puits (30 pi) de MinElute plaque de 96 puits dans des plaques 96 puits propre. </li><li> Effectuer des réactions de ligature linker avec l&#39;ADN digéré de l&#39;étape 4.8 et linkers de l&#39;étape 4.1. Mélanger 10 ul d&#39;ADN digéré, 4 pi de tampon de ligature 5x, 5,5 pl linkers recuit (950 pg / pl), 0,5 ul de ligase T4 (5 U / pl). </li><li> Incuber pendant 4 heures ou toute la nuit à 16 ° C. </li><li> Une inactivation de l&#39;ADN ligase T4 à 65 ° C pendant 10 min. </li><li> Nettoyer ligature en utilisant MinElute plaques de 96 puits et un collecteur à vide comme décrit dans les étapes de 4,5 à 4,6. </li><li> Remettre en suspension dans 30 ul de H 2 O et transférer dans un propre plaque de 96 puits. </li><li> Effectuer une digestion de l&#39;ADN seconde afin de détruire restant concatémère transposons. Ce résultat est obtenu en coupant l&#39;ADN une deuxième fois avec une enzyme qui coupe le plasmide vADN ecteur qui a été utilisé pour créer des souris transgéniques contenant le transposon concatémère. </li><li> Digest ADN en utilisant BamHI (côté gauche et droit): Mélanger 25 ul de lieur-ligaturé l&#39;ADN de l&#39;étape 4.13, 5 pl de tampon NEB 10x n ° 3, 0,5 pi BamHI (20 U / pl), 0,5 ul de BSA (10 mg / ml ), et 19 ul ddH 2 O. </li><li> Digest 3-6 heures ou toute la nuit à 37 ° C. </li><li> Effectuer primaire PCR en utilisant une amorce spécifique du transposon et une amorce spécifique de la liaison. Ceux-ci varient en fonction de ce transposon et l&#39;éditeur de liens que vous utilisez. Les amorces énumérées dans le tableau ci-dessus apprêt de travail pour la T2/Onc et T2/Onc2 transposons. </li><li> PCR primaire: 5 pi de tampon 10x, 2,0 ul de MgCl2 (50 mM), 4 pl dNTP (2,5 nM), 1 pl Primer 1 (20 uM), 1 pl Primer 2 (20 uM), 0,25 Platinum Taq ul (5 U / pl), 3 pl ADN digéré avec des linkers (le montant peut varier), jusqu&#39;à 50 pi ddH 2 O. </li><li> PCR programme: 94 ° C pendant 5 min, 30 cycles de 94 ° C pendant 30 sec, 60 &amp; dpar exemple, C pendant 30 sec, 72 ° C pendant 90 sec. Extension finale à 72 ° C pendant 5 min. </li><li> Nettoyer produit de PCR utilisant MinElute plaques de 96 puits et un collecteur à vide comme décrit ci-dessus. </li><li> Remettre en suspension dans 30 ul de H 2 O et transférer dans un propre plaque de 96 puits. </li><li> Faire une dilution 1:75 du 1 ° PCR en diluant 2 pl d&#39;ADN de l&#39;étape 4.21 dans 148 ul O ddH 2 </li><li> Effectuer secondaire PCR en utilisant des versions imbriquées des amorces qui ont également la séquence requise pour la machine Illumina GAIIx ainsi que d&#39;un code à barres de base 12 paire qui est unique pour chaque échantillon de la tumeur traitée (voir le tableau ci-dessus apprêt pour des exemples de ces amorces). </li><li> PCR secondaire: 10 ul de tampon 10x avec MgCl2, 8 pi de dNTP (2,5 mM), 1 pl Illumina code à barres amorce secondaire (20 uM), 1 pl Nest Illumina 1 couche secondaire (20 uM), 0,25 ul FastStart Taq (5 U / pl ), 2 pl de l&#39;ADN 1:75 PCR primaires dilués jusqu&#39;à 100 pi ddH 2 O. </li><li> PCR programme: 94 °; C pendant 2 min, 30 cycles de 94 ° C pendant 30 s, 53 ° C pendant 45 sec, 72 ° C pour 90 sec. Extension finale à 72 ° C pendant 5 min. </li><li> Exécuter 45 ul de cette réaction de PCR sur un gel d&#39;agarose 1% contenant du bromure d&#39;éthidium (0,5 pg / ml). Il devrait y avoir un «frottis» des produits de PCR représentant des amplicons de nombreuses insertions de transposons les différentes dans la tumeur (figure 3). </li><li> Nettoyer restante de 50 ul du produit de PCR utilisant MinElute plaques de 96 puits et un collecteur à vide comme décrit ci-dessus. Laver une fois en plaçant 50 pl ddH 2 O dans les puits et aspirer à nouveau. </li><li> Remettre en suspension dans 30 pl de TE et transférer dans un propre plaque de 96 puits. </li><li> Déterminer la concentration d&#39;ADN dans chaque échantillon. Mélanger des quantités égales d&#39;ADN dans un seul tube de 1,5 ml de centrifugeuse. Ce sera la bibliothèque qui est séquencé en une seule voie d&#39;une Illumina HiSeq 2000 de la machine. Il est possible de séquencer plusieurs centaines de tumeurs sur une seule voie d&#39;une course d&#39;Illumina. </li><li> Soumettrele tube unique contenant des quantités égales de l&#39;ADN à partir de toutes les tumeurs pour le séquençage. Cela peut être fait par votre institution ou dans le commerce. </li></ol> 5. Analyse des insertions de transposons <ol><li> Logiciel d&#39;analyse de données insertion d&#39;un transposon est disponible en téléchargement gratuit via SourceForge ( <a href="http://sourceforge.net/projects/tapdancebio/" target="_blank">http://sourceforge.net/projects/tapdancebio/</a> ). Le programme, appelé claquettes, nécessite le fichier de séquence à partir de la plate-forme Illumina et un code à barres fichier de bibliothèque texte de la carte. </li></ol>

<ol>
	<li>Fearon, E. R., Vogelstein, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+model+for+colorectal+tumorigenesis.">A genetic model for colorectal tumorigenesis.</a> Cell. 61, 759-767 (1990).</li><li>Wood, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genomic+Landscapes+of+Human+Breast+and+Colorectal+Cancers.">The Genomic Landscapes of Human Breast and Colorectal Cancers.</a> Science. 318, 1108-1113 (2007).</li><li>Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsv&#225;k, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Reconstruction+of+Sleeping+Beauty,+a+Tc1-like+Transposon+from+Fish,+and+Its+Transposition+in+Human+Cells.">Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells.</a> Cell. 91, 501-510 (1997).</li><li>Starr, T. K., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+using+the+Sleeping+Beauty+transposon.">Cancer gene discovery using the Sleeping Beauty transposon.</a> Cell Cycle. 4, 1744-1748 (2005).</li><li>Mueller, P. R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Footprinting+of+a+Muscle+Specific+Enhancer+by+Ligation+Mediated+PCR.">In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR.</a> Science. 246, 780-786 (1989).</li><li>Bergemann, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+methods+for+finding+common+insertion+sites+and+co-occurring+common+insertion+sites+in+transposon-+and+virus-based+genetic+screens.">New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens.</a> Nucleic acids research. 40, 3822-3833 (2012).</li><li>Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Harnessing+transposons+for+cancer+gene+discovery.">Harnessing transposons for cancer gene discovery.</a> Nature Reviews Cancer. 10, 696-706 (2010).</li><li>Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+in+solid+tumours+using+transposon-based+somatic+mutagenesis+in+the+mouse.">Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse.</a> Nature. 436, 272-276 (2005).</li><li>Starr, T. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transposon-based+genetic+screen+in+mice+identifies+genes+altered+in+colorectal+cancer.">A transposon-based genetic screen in mice identifies genes altered in colorectal cancer.</a> Science. 323, 1747-1750 (2009).</li><li>Keng, V. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+transposon-based+insertional+mutagenesis+screen+for+genes+associated+with+mouse+hepatocellular+carcinoma.">A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma.</a> Nature. 27, 264-274 (2009).</li><li>Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+mutagenesis+using+a+highly+mobile+somatic+Sleeping+Beauty+transposon+system.">Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system.</a> Nature. 436, 221-226 (2005).</li></ol>

Les auteurs n&#39;ont rien à révéler.

Un écran vers l&#39;avant génétique à l&#39;aide de la Belle au Bois Dormant système transposon fournit une méthode pour identifier les mutations qui causent le cancer. En sélectionnant le promoteur adéquat pour contrôler la recombinase Cre en plus des mutations prédisposant, l&#39;écran SB permettra d&#39;identifier de nouveaux gènes connus et candidats cancer. Le succès d&#39;un écran SB est largement tributaire des souris sélectionnées pour créer l&#39;?...

<table border="1"><tbody><tr><td> Nom du réactif </td><td> Entreprise </td><td> Numéro de catalogue </td><td> Commentaires (optionnel) </td></tr><tr><td> Chambre à induction Sure-Seal </td><td> Arbre Scientific Brain </td><td> EZ-177 </td><td></td></tr><tr><td> Cryovial </td><td> Bioexpress </td><td> C-3355-2 </td><td></td></tr><tr><td> 10% tamponnée de formaldéhyde </td><td> Sigma Aldrich </td><td> HT501128-4L </td><td></td></tr><tr><td> Solution de précipitation des protéines </td><td> Qiagen </td><td> 158910 </td><td></td></tr><tr><td> Tampon de lyse cellulaire </td><td> Qiagen </td><td> 158906 </td><td></td></tr><tr><td> Protéinase K </td><td> Qiagen </td><td> 158920 </td><td></td></tr><tr><td> RNase A </td><td> Qiagen </td><td> 158924 </td><td></td></tr><tr><td> TE Buffer </td> &lt;td&gt; Promega </td><td> V6232 </td><td></td></tr><tr><td> Bfai </td><td> New England Biolabs </td><td> R0568S </td><td></td></tr><tr><td> NlalII </td><td> New England Biolabs </td><td> R0125S </td><td></td></tr><tr><td> MinElute plaques de 96 puits </td><td> Qiagen </td><td> 28051 </td><td></td></tr><tr><td> QIAvac collecteur sous vide 96 </td><td> Qiagen </td><td> 19504 </td><td></td></tr><tr><td> Multi-MicroPlate Genie, 120V </td><td> Scientific Industries, Inc </td><td> SI-4000 </td><td></td></tr><tr><td> ADN ligase T4 avec du tampon de ligation 5x </td><td> Invitrogen </td><td> 15224-041 </td><td></td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td><td></td></tr><tr><td> DNTP 25 mM </td><td> Bioexpress </td><td> C-5014-200 </td><td></td></tr><tr><td> Taq Platinum </td><td> Invitrogen </td><td&gt; 10966-034 </td><td></td></tr><tr><td> FastStart polymérase Taq ADN </td><td> Roche </td><td> 12032929001 </td><td></td></tr><tr><td> Agarose </td><td> Promega </td><td> V3121 </td><td></td></tr><tr><td> TAE Buffer </td><td> Promega </td><td> V4271 </td><td></td></tr><tr><td> TE Buffer </td><td> Promega </td><td> V6232 </td><td></td></tr><tr><td> Le bromure d&#39;éthidium </td><td> Promega </td><td> H5041 </td><td></td></tr></tbody></table>

identification of sleeping beauty transposon insertions in solid tumors using linker-mediated pcr

Génomiques, les analyses protéomiques, transcriptomiques, et épigénomiques de tumeurs humaines indiquent qu&#39;il ya des milliers d&#39;anomalies au sein de chaque génome du cancer par rapport aux tissus normaux appariés. Sur la base de ces analyses, il est évident qu&#39;il ya beaucoup d&#39;inconnues pilotes génétiques du cancer 1. Malheureusement, ces pilotes sont cachés dans un plus grand nombre d&#39;anomalies particulières dans le génome qui ne contribuent pas directement à la formation de tumeurs. Un autre aspect du génome du cancer, c&#39;est qu&#39;il ya grande hétérogénéité génétique au sein des mêmes types de tumeurs. Chaque tumeur peut héberger des mutations différentes qui offrent un avantage sélectif pour la formation de tumeurs 2. Exécution d&#39;une impartiale écran vers l&#39;avant génétique chez la souris fournit les outils pour générer des tumeurs et d&#39;analyser leur composition génétique, tout en réduisant le contexte de mutations particulières. La Belle au bois dormant (SB) transposon système est une de ces méthodes 3. Le système utilise SB portable vecteurs (transposons) qui peuvent être insérés dans le génome par l&#39;enzyme transposase. Mutations sont limités à un type de cellule spécifique grâce à l&#39;utilisation d&#39;un allèle conditionnel transposase qui est activé par la recombinase Cre. Il existe de nombreuses lignées de souris qui expriment la recombinase Cre dans des tissus spécifiques. En croisant l&#39;une de ces lignes à l&#39;allèle transposase conditionnelle (par exemple Lox-stop-Lox-SB11), le système ASR est activé uniquement dans les cellules qui expriment la recombinase Cre. La recombinase Cre sera une cassette d&#39;accise arrêt qui bloque l&#39;expression de l&#39;allèle transposase, activant ainsi mutagenèse par transposon dans le type de cellule désignée. Un écran SB est initiée par l&#39;élevage de trois souches de souris transgéniques afin que les souris expérimentales porteurs d&#39;un allèle conditionnel transposase, un concatémère de transposons, et un allèle spécifique du tissu recombinase Cre. Ces souris sont autorisés à l&#39;âge jusqu&#39;à la formation de tumeurs et ils deviennent moribonds. Les souris sont ensuiteADN autopsiés et génomique est isolé à partir des tumeurs. Ensuite, l&#39;ADN génomique est soumis à une liaison médiée par PCR (LM-PCR) qui entraîne une amplification du locus génomiques contenant un transposon SB. LM-PCR réalisée sur une seule tumeur se traduira par des centaines de amplicons distincts représentant les centaines de loci génomiques contenant insertions de transposons dans un 4 seule tumeur. Les insertions de transposons dans toutes les tumeurs sont analysées et sites d&#39;insertion communs (Ciss) sont identifiés à l&#39;aide d&#39;une méthode statistique appropriée 5. Gènes au sein de la CEI sont très susceptibles d&#39;être des oncogènes ou des gènes suppresseurs de tumeurs, et sont considérés comme les gènes du cancer candidats. Les avantages de l&#39;utilisation du système SB pour identifier les gènes responsables du cancer candidats sont les suivants: 1) le transposon peut être facilement localisé dans le génome parce que sa séquence est connue, 2) la transposition peuvent être adressées à presque n&#39;importe quel type de cellule et 3) le transposon est capable de introduire à la fois le gain et la perte-de-fonction-6 mutations. Le following protocole décrit comment concevoir et d&#39;exécuter un écran vers l&#39;avant génétique à l&#39;aide du système SB transposon pour identifier les gènes responsables du cancer candidats (Figure 1).

Après le schéma de sélection a été mis en place, les éleveurs doivent produire une portée tous les 19-21 jours. La taille des portées varie entre 5 et 12 chiots, en fonction de l&#39;âge des éleveurs et l&#39;arrière-plan génétique. En outre, assurez-vous que le génotype de la litière suit la génétique mendélienne comme un moyen de confirmer que le schéma de sélection est à la fois correcte et réussie. Pour que l&#39;expérience soit un succès, l&#39;incidence des tume...

Watch this Scientific Journal Video about Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR at JoVE.com

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Procédé d&#39;identification de la cancérogenèse conducteurs inconnus en utilisant une approche impartiale est décrit. La méthode utilise l&#39;<em&gt; Belle au Bois Dormant</em&gt; Transposon comme un agent mutagène aléatoire dirigé vers des tissus spécifiques. Cartographie génomique des insertions de transposons qui sous-tendent la formation de tumeurs identifie nouveaux oncogènes et gènes suppresseurs de tumeurs

Identification des<em&gt; Belle au Bois Dormant</em&gt; Insertions de transposons dans les tumeurs solides en utilisant l&#39;éditeur de liens médiée par PCR

Genomic, proteomic, transcriptomic, and epigenomic analyses of human tumors indicate that there are thousands of anomalies within each cancer genome ...

identification-sleeping-beauty-transposon-insertions-solid-tumors

Research

JoVE Journal

Medicine

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

14.0K vues.  University of Minnesota, Minneapolis. Procédé d'identification de la cancérogenèse conducteurs inconnus en utilisant une approche impartiale est décrit. La méthode utilise l' Belle au Bois Dormant Transposon comme un agent mutagène aléatoire dirigé vers des tissus spécifiques. Cartographie génomique des insertions de transposons qui sous-tendent la formation de tumeurs identifie nouveaux oncogènes et gènes suppresseurs de tumeurs

Vidéo: Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Establishment and Propagation of Human Retinoblastoma Tumors in Immune Deficient Mice

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited time. These cultured tumorspheres may exhibit markedly different cellular phenotypes when compared to the original tumors. Demonstration that cultured cells have the capability of forming new tumors is important to ensure that cultured cells model the biology of the original tumor. 
Here we present a protocol for propagating human retinoblastoma tumors in vivo using Rag2-/- immune deficient mice. Cultured human retinoblastoma tumorspheres of low passage or cells obtained from freshly harvested human retinoblastoma tumors injected directly into the vitreous cavity of murine eyes form tumors within 2-4 weeks. These tumors can be harvested and either further passaged into murine eyes in vivo or grown as tumorspheres in vitro. Propagation has been successfully carried out for at least three passages thus establishing a continuing source of human retinoblastoma tissue for further experimentation. 
Wesley S. Bond and Lalita Wadhwa are co-first authors.

A method is described to propagate human retinoblastoma tumors in mice. Tumor cells are directly injected into the eyes of immune deficient mice. Secondary tumors have been successfully established using both cells directly harvested from human tumors and cultured tumorspheres.

Création et propagation des tumeurs de l&#39;homme en rétinoblastome immunitaire chez les souris déficientes

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited ...

Recherche

Médecine

Evaluation of Nanoparticle Uptake in Tumors in Real Time Using Intravital Imaging

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle uptake in tumors at the microscopic level1,2,3, highlighting the utility of a suitable xenograft model in which to perform detailed uptake analyses. Here, we use high-resolution intravital imaging to evaluate nanoparticle uptake in human tumor xenografts in a modified, shell-less chicken embryo model. The chicken embryo model is particularly well-suited for these in vivo analyses because it supports the growth of human tumors, is relatively inexpensive and does not require anesthetization or surgery 4,5. Tumor cells form fully vascularized xenografts within 7 days when implanted into the chorioallantoic membrane (CAM) 6. The resulting tumors are visualized by non-invasive real-time, high-resolution imaging that can be maintained for up to 72 hours with little impact on either the host or tumor systems. Nanoparticles with a wide range of sizes and formulations administered distal to the tumor can be visualized and quantified as they flow through the bloodstream, extravasate from leaky tumor vasculature, and accumulate at the tumor site. We describe here the analysis of nanoparticles derived from Cowpea mosaic virus (CPMV) decorated with near-infrared fluorescent dyes and/or polyethylene glycol polymers (PEG) 7, 8, 9,10,11. Upon intravenous administration, these viral nanoparticles are rapidly internalized by endothelial cells, resulting in global labeling of the vasculature both outside and within the tumor7,12. PEGylation of the viral nanoparticles increases their plasma half-life, extends their time in the circulation, and ultimately enhances their accumulation in tumors via the enhanced permeability and retention (EPR) effect 7, 10,11. The rate and extent of accumulation of nanoparticles in a tumor is measured over time using image analysis software. This technique provides a method to both visualize and quantify nanoparticle dynamics in human tumors.

We present a novel approach to quantify nanoparticle localization in the vasculature of human xenografted tumors using dynamic, real-time intravital imaging in an avian embryo model.

Evaluation de la fixation des nanoparticules dans les tumeurs en temps réel par imagerie intravitale

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle ...

Heterogeneity Mapping of Protein Expression in Tumors using Quantitative Immunofluorescence

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of areas of distinct differentiation into recognized histological subtypes, or different pathological grade, often there are more subtle differences in phenotype which defy accurate classification (Figure 1). Ultimately, since morphology is dictated by the underlying molecular phenotype, areas with visible differences are likely to be accompanied by differences in the expression of proteins which orchestrate cellular function and behavior, and therefore, appearance. The significance of visible and invisible (molecular) heterogeneity for prognosis is unknown, but recent evidence suggests that, at least at the genetic level, heterogeneity exists in the primary tumor1,2, and some of these sub-clones give rise to metastatic (and therefore lethal) disease. 
Moreover, some proteins are measured as biomarkers because they are the targets of therapy (for instance ER and HER2 for tamoxifen and trastuzumab (Herceptin), respectively). If these proteins show variable expression within a tumor then therapeutic responses may also be variable. The widely used histopathologic scoring schemes for immunohistochemistry either ignore, or numerically homogenize the quantification of protein expression. Similarly, in destructive techniques, where the tumor samples are homogenized (such as gene expression profiling), quantitative information can be elucidated, but spatial information is lost. Genetic heterogeneity mapping approaches in pancreatic cancer have relied either on generation of a single cell suspension3, or on macrodissection4. A recent study has used quantum dots in order to map morphologic and molecular heterogeneity in prostate cancer tissue5, providing proof of principle that morphology and molecular mapping is feasible, but falling short of quantifying the heterogeneity. Since immunohistochemistry is, at best, only semi-quantitative and subject to intra- and inter-observer bias, more sensitive and quantitative methodologies are required in order to accurately map and quantify tissue heterogeneity in situ.
We have developed and applied an experimental and statistical methodology in order to systematically quantify the heterogeneity of protein expression in whole tissue sections of tumors, based on the Automated QUantitative Analysis (AQUA) system6. Tissue sections are labeled with specific antibodies directed against cytokeratins and targets of interest, coupled to fluorophore-labeled secondary antibodies. Slides are imaged using a whole-slide fluorescence scanner. Images are subdivided into hundreds to thousands of tiles, and each tile is then assigned an AQUA score which is a measure of protein concentration within the epithelial (tumor) component of the tissue. Heatmaps are generated to represent tissue expression of the proteins and a heterogeneity score assigned, using a statistical measure of heterogeneity originally used in ecology, based on the Simpson's biodiversity index7.
To date there have been no attempts to systematically map and quantify this variability in tandem with protein expression, in histological preparations. Here, we illustrate the first use of the method applied to ER and HER2 biomarker expression in ovarian cancer. Using this method paves the way for analyzing heterogeneity as an independent variable in studies of biomarker expression in translational studies, in order to establish the significance of heterogeneity in prognosis and prediction of responses to therapy.

Here we describe a method to quantify molecular heterogeneity in histological sections of tumor material using quantitative immunofluorescence, image analysis, and a statistical measure of heterogeneity. The method is intended for use in clinical biomarker development and analysis.

Cartographie hétérogénéité d&#39;expression des protéines dans les tumeurs par immunofluorescence quantitative

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of ...

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process including development1, apoptosis2, and cell cycle regulation3. MiRNAs are estimated to regulate the expression of 30% to 90% of human genes4 by binding to their target messenger RNAs (mRNAs)5. Widespread dysregulation of miRNAs has been reported in various diseases and cancer subtypes6. Due to their prevalence and unique structure, these small molecules are likely to be the next generation of biomarkers, therapeutic agents and/or targets.
Methods used to investigate miRNA expression include SYBR green I dye- based as well as Taqman-probe based qPCR. If miRNAs are to be effectively used in the clinical setting, it is imperative that their detection in fresh and/or archived clinical samples be accurate, reproducible, and specific. qPCR has been widely used for validating expression of miRNAs in whole genome analyses such as microarray studies7. The samples used in this protocol were from patients who underwent radical prostatectomy for clinically localized prostate cancer; however other tissues and cell lines can be substituted in. Prostate specimens were snap-frozen in liquid nitrogen after resection. Clinical variables and follow-up information for each patient were collected for subsequent analysis8.
Quantification of miRNA levels in prostate tumor samples. The main steps in qPCR analysis of tumors are: Total RNA extraction, cDNA synthesis, and detection of qPCR products using miRNA-specific primers. Total RNA, which includes mRNA, miRNA, and other small RNAs were extracted from specimens using TRIzol reagent. Qiagen's miScript System was used to synthesize cDNA and perform qPCR (Figure 1). Endogenous miRNAs are not polyadenylated, therefore during the reverse transcription process, a poly(A) polymerase polyadenylates the miRNA. The miRNA is used as a template to synthesize cDNA using oligo-dT and Reverse Transcriptase. A universal tag sequence on the 5' end of oligo-dT primers facilitates the amplification of cDNA in the PCR step. PCR product amplification is detected by the level of fluorescence emitted by SYBR Green, a dye which intercalates into double stranded DNA. Specific miRNA primers, along with a Universal Primer that binds to the universal tag sequence will amplify specific miRNA sequences. 
The miScript Primer Assays are available for over a thousand human-specific miRNAs, and hundreds of murine-specific miRNAs. Relative quantification method was used here to quantify the expression of miRNAs. To correct for variability amongst different samples, expression levels of a target miRNA is normalized to the expression levels of a reference gene. The choice of a gene on which to normalize the expression of targets is critical in relative quantification method of analysis. Examples of reference genes typically used in this capacity are the small RNAs RNU6B, RNU44, and RNU48 as they are considered to be stably expressed across most samples. In this protocol, RNU6B is used as the reference gene.

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR qPCR

Quantitative Real Time polymerase chain reaction (qPCR) is a rapid and sensitive method to investigate the expression levels of various microRNA (miRNA) molecules in tumor samples. Using this method expression of hundreds of different miRNA molecules can be amplified, quantified, and analyzed from the same cDNA template.

Détection MicroRNA dans les tumeurs prostatiques par quantitative PCR en temps réel (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process ...

In vitro Organoid Culture of Primary Mouse Colon Tumors

Several human and murine colon cancer cell lines have been established, physiologic integrity of colon tumors such as multiple cell layers, basal-apical polarity, ability to differentiate, and anoikis are not maintained in colon cancer derived cell lines. The present study demonstrates a method for culturing primary mouse colon tumor organoids adapted from Sato T et al. 1, which retains important physiologic features of colon tumors. This method consists of mouse colon tumor tissue collection, adjacent normal colon epithelium dissociation, colon tumor cells digestion into single cells, embedding colon tumor cells into matrigel, and selective culture based on the principle that tumor cells maintain growth on limiting nutrient conditions compared to normal epithelial cells.
The primary tumor organoids if isolated from genetically modified mice provide a very useful system to assess tumor autonomous function of specific genes. Moreover, the tumor organoids are amenable to genetic manipulation by virus meditated gene delivery; therefore signaling pathways involved in the colon tumorigenesis could also be extensively investigated by overexpression or knockdown. Primary tumor organoids culture provides a physiologic relevant and feasible means to study the mechanisms and therapeutic modalities for colon tumorigenesis.

In vitro Organoid Culture of Primary Mouse Colon Tumors

A simple method to establish primary murine colon tumor organoid is described. This method utilizes the feature that colon tumor cells survive and grow into organoids in media containing limited growth factors, whereas normal colon epithelial do not.

In vitro Organoid Culture des primaires tumeurs du côlon de souris

Several  human and murine colon cancer cell lines have been established, physiologic  integrity of colon tumors such as multiple cell layers, basal-apical ...

Cerebrospinal Fluid MicroRNA Profiling Using Quantitative Real Time PCR

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their translational repression. Changes in miRNA expression have been shown to be involved in the development of all major complex diseases. Furthermore, recent findings showed that miRNAs can be secreted to the extracellular environment and enter the bloodstream and other body fluids where they can circulate with high stability. The function of such circulating miRNAs remains largely elusive, but systematic high throughput approaches, such as miRNA profiling arrays, have lead to the identification of miRNA signatures in several pathological conditions, including neurodegenerative disorders and several types of cancers. In this context, the identification of miRNA expression profile in the cerebrospinal fluid, as reported in our recent study, makes miRNAs attractive candidates for biomarker analysis.
There are several tools available for profiling microRNAs, such as microarrays, quantitative real-time PCR (qPCR), and deep sequencing. Here, we describe a sensitive method to profile microRNAs in cerebrospinal fluids by quantitative real-time PCR. We used the Exiqon microRNA ready-to-use PCR human panels I and II V2.R, which allows detection of 742 unique human microRNAs. We performed the arrays in triplicate runs and we processed and analyzed data using the GenEx Professional 5 software.
Using this protocol, we have successfully profiled microRNAs in various types of cell lines and primary cells, CSF, plasma, and formalin-fixed paraffin-embedded tissues.

We describe a protocol of real time PCR to profile microRNAs in the cerebrospinal fluid (CSF). With the exception of RNA extraction protocols, the procedure can be extended to RNA extracted from other body fluids, cultured cells, or tissue specimens.

Liquide céphalo-rachidien profilage de microARN Utilisation quantitative PCR en temps réel

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their ...

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent marker. Mouse models (brain tumor and arthritis) were used to evaluate the usefulness of this method. Saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles tagged with CellVue Maroon (CVM) fluorophore were administered intravenously. Animals were then placed in the rotational holder (MARS) of the in vivo imaging system. Images were acquired in 10&#176; steps over 380&#176;. A rectangular&#160;region of interest (ROI) was placed across the full image width at the model disease site. Within the ROI, and for every image, mean fluorescence intensity was computed after background subtraction. In the mouse models studied, the labeled nanovesicles were taken up in both the orthotopic and transgenic brain tumors, and in the arthritic sites (toes and ankles). Curve analysis of the multi angle image ROIs determined the angle with the highest signal. Thus, the optimal angle for imaging each disease site was characterized. The MAROI method applied to imaging of fluorescent compounds is a noninvasive, economical, and precise tool for in vivo quantitative analysis of the disease states in the described mouse models.

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo quantitation of a fluorescent marker delivered by saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles. Employing mouse models of cancer and arthritis, we demonstrate how the MAROI signal curve analysis can be used for the precise mapping and biological characterization of disease processes.

In Vivo L&#39;imagerie optique de tumeurs cérébrales et l&#39;arthrite Utilisation fluorescent SAPC-DOPS nanovésicules

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent ...

Quantitative Mass Spectrometric Profiling of Cancer-cell Proteomes Derived From Liquid and Solid Tumors

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic biomarkers. However, methods for quantitative proteomic characterization of patient-derived tumors and in particular their cellular subpopulations are largely lacking. Here we describe an experimental set-up that allows quantitative analysis of proteomes of cancer cell subpopulations derived from either liquid or solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry followed by bioinformatic data analysis. To enrich specific cellular subsets, liquid tumors are first immunophenotyped by flow cytometry followed by FACS-sorting; for solid tumors, laser-capture microdissection is used to purify specific cellular subpopulations. In a second step, proteins are extracted from the purified cells and subsequently combined with a tumor-specific, SILAC-labeled spike-in standard that enables protein quantification. The resulting protein mixture is subjected to either gel electrophoresis or Filter Aided Sample Preparation (FASP) followed by tryptic digestion. Finally, tryptic peptides are analyzed using a hybrid quadrupole-orbitrap mass spectrometer, and the data obtained are processed with bioinformatic software suites including MaxQuant. By means of the workflow presented here, up to 8,000 proteins can be identified and quantified in patient-derived samples, and the resulting protein expression profiles can be compared among patients to identify diagnostic proteomic signatures or potential drug targets.

In-depth analyses of cancer cell proteomes facilitate identification of novel drug targets and diagnostic biomarkers. We describe an experimental workflow for quantitative analysis of (phospho-)proteomes in cancer cell subpopulations derived from liquid and solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry.

Spectrométrie de masse quantitative de profilage Protéomes Cancer-cellulaires dérivées de liquide et de tumeurs solides

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic ...

Spatial Measurements of Perfusion, Interstitial Fluid Pressure and Liposomes Accumulation in Solid Tumors

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and elevated IFP are linked to the heterogeneous intra-tumoral distribution of nanotechnology-based drug delivery systems such as liposomes. In the present study, the relationship between tumor microcirculation, elevated IFP, and accumulation of nanoparticles was investigated through in vivo experimentation. This was accomplished by evaluation of the tumor microcirculation using dynamic contrast enhanced computed tomography (DCE-CT) and measurement of tumor IFP using a novel image-guided robotic needle placement system connected to the micro-CT scanner. The intra-tumoral accumulation of liposomes was determined by CT image-based assessment of a nanoparticle liposomal formulation that stably encapsulate the contrast agent iohexol (CT-liposomes). CT imaging allowed for co-localization of the spatial distribution of tumor hemodynamics, IFP and CT-liposome accumulation in an individual subcutaneous xenograft mouse model of breast cancer. Measurements led to the discovery that perfusion and plasma volume fraction are strong mediators of the intra-tumoral distribution of liposomes. Furthermore, the results suggest that IFP plays an indirect role in mediating liposome distribution through modulating blood flow.

The heterogeneous intra-tumoral accumulation of liposomes has been linked to an abnormal tumor microenvironment. Herein methods are presented to measure tumor microcirculation by perfusion imaging and elevated interstitial fluid pressure (IFP) using an image-guided robotic system. Measurements are compared to the intra-tumoral accumulation of liposomes, determined using volumetric micro-CT imaging.

Mesures spatiales de Perfusion, la pression du liquide interstitiel et Liposomes Accumulation dans Solid Tumors

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and ...

Multicolor 3D Printing of Complex Intracranial Tumors in Neurosurgery

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. The model can be used for planning and simulating critical steps of a surgical approach. Therefore, it is important that anatomical structures such as blood vessels inside a tumor can be printed to be colored not only on their surface, but throughout their whole volume. During simulation this allows for the removal of certain parts (e.g., with a high-speed drill) and revealing internally located structures of a different color. Thus, diagnostic information from various imaging modalities (e.g., CT, MRI) can be combined in a single compact and tangible object.
However, preparation and printing of such a fully colored anatomical model remains a difficult task. Therefore, a step-by-step guide is provided, demonstrating the fusion of different cross-sectional imaging data sets, segmentation of anatomical structures, and creation of a virtual model. In a second step the virtual model is printed with volumetrically colored anatomical structures using a plaster-based color 3D binder jetting technique. This method allows highly accurate reproduction of patient-specific anatomy as shown in a series of 3D-printed petrous apex chondrosarcomas. Furthermore, the models created can be cut and drilled, revealing internal structures that allow for simulation of surgical procedures.

The protocol describes the fabrication of fully colored three-dimensional prints of patient-specific, anatomical skull models to be used for surgical simulation. The crucial steps of combining different imaging modalities, image segmentation, three-dimensional model extraction, and production of the prints are explained.

Impression 3D multicolore des tumeurs intracrâniennes complexes en neurochirurgie

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. ...