Yazarlar protokolü yukarıda açıklanan geliştirme konusundaki yardım için Iowa Üniversitesi Minnesota Üniversitesi&#39;nde Branden Moriarty, David Largaespada ve Vincent Keng teşekkür, ve Adam Dupuy olurdu.

1. Yetiştirme ve Transgenik Hayvan Yaşlanma <ol><li> Denemeniz için uygun transgenik farelerin suşları seçin. İstenen kanser için kökenli hücreler olduğu düşünülmektedir hücrelerde Cre rekombinaz eksprese eden bir koşullu transposase fare, transpozonlar bir concatamer barındıran, bir fare, bir fare, bir Tipik bir deneyde üç transjenik çizgileri kullanırlar. Modellenen kanser hastalarının büyük bir kısmı bilinen bir mutasyon olması halinde, başlangıcında bu mutasyon dahil etmek tercih edilebilir. Bu &quot;hazırlayıcı&quot; mutasyon örnekleri aktive Kras, dominant negatif TP53 veya floxed PTEN allel içerir. Predispozan bir mutasyon ekleyerek model daha iyi (1.3) insan kanser temsil edebilir. Çeşitli Sleeping Beauty transposase ve transpozonlar fareler Ulusal Kanser Enstitüsü Fare Deposu (edinilebilir <a href="http://mouse.ncifcrf.gov/" target="_blank">http://mouse.ncifcrf.gov/</a> ). </li><li> Sonunda eğer mümkünse her iki allel için homozigot fareler elde etmek transpozonlar yataklık farelerle Breed koşullu transposase fareler. Sizin üçlü transgenik deney farelerinin (Şekil 2) oluşturmak için Cre Rekombinaz ifade farelere Breed homozigot yavrular. Not: Elde homozigot fareler her zaman mümkün veya ideal değildir. Örneğin, homozigot p53 dominant negatif farelerde çok daha zor heterozigot farelerde daha doğurmak için vardır. Buna ek olarak, ibrelerin ıslahı başarılı olduğunu onaylamak için Mendel genetiği izleyin emin olmanıza yardımcı olur. </li><li> Bir yatkınlık arka kullanıyorsanız, predispozan alleli ile farelere transposase ile ilk cins fareler. Aynı zamanda, ırkı fareler transpozonlar taşıyan farelere Cre Rekombinaz ifade. Her allel mümkünse için homozigot fareler oluşturun. Son olarak, dörtlü transgenik deneysel anim oluşturmak için önceki iki yetiştirme düzenleri homozigot yavrular doğurmakals. </li><li> Deney hayvanları ek olarak, fareler kontrol Kusaklara oluşturur. Kontrol grubuna normal olarak sadece üç allel (Şekil 2) arasında iki devralan deneysel ıslah littermates oluşur. Bir arka plan yatkın olması durumunda, dört allel üçü de dahil olmak üzere fareler de gerekli olacaktır. </li><li> Tümör gelişimi ve / veya can çekişme için günlük deney ve kontrol farelerde izleyin. Sizin kurumsal hayvan bakımı ve hayvancılık için kullanımı komitesi (IACUC) gereksinimleri izleyin. Ayrıca, henüz can çekişmekte olmamıştır eğer bir hayvan kurban edeceği bir yaş belirlemek için tipiktir. Onsekiz ay fareler ötenazi hangi tipik bir yaştır. </li></ol> 2. Transgenik Hayvanlar nekropsi <table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td></tr><tr><td> Sure-Seal induction Odası </td><td> Beyin Ağacı Bilimsel </td><td> EZ-177 </td></tr><tr><td> Cryovial </td><td> Bioexpress </td><td> C-3355-2 </td></tr><tr><td> % 10 tamponlu formalin </td><td> Sigma Aldrich </td><td> HT501128-4L </td></tr></tbody></table> Tablo 1. Reaktifler gereklidir. <ol><li> Bir fare can çekişen veya belirlenen ömrünün sonuna geldiğinde, sizin IACUC yönergeleri izleyerek bir CO 2 odalarını kullanarak hayvan ötenazi. Genellikle, temiz bir gaz odasında hayvan yerleştirin gaz tankı açmak ve inç kare başına en yüksek 5 daha kilo okumak için regülatörü ayarlayın. CO 2 nazal ve oküler irritasyon ve kaçınma en aza indirmek için yavaş doldurun. Hayvan kalbi artık atıyor ve göz dokunduğu zaman yanıt vermiyor emin olun. </li><li> % 70 etanol ile kurban fare Sprey dış. </li><li> Sıra bir otopsi gemide fare ve diseksiyon iğne ile sabitleyin. Makas bir kullanınd cımbız fare açın ve organları kaldırmak. Toplanan hangi organların belirlenmesi proje bağlıdır. Ancak, bu organlar genellikle fare işlemez hale gelmişti neden çok önemli ipuçları verir her zaman olduğu gibi dalak ve karaciğer toplamak için tavsiye edilir. Ayrıca kemik iliği potansiyeli analizi için sternum toplamak. Buna ek olarak, her zaman anormal görünür herhangi bir organ ya da doku toplamak için faydalıdır. </li><li> Toplanan Dokular ve tümörler dört bölüme ayrılmıştır olmalıdır. % 10% 70 etanol, ardından 18 saat süreyle tamponlu formalin içinde bir kısım düzeltilmiştir. Bu bölüm, H &amp; E boyama ve / veya IHC için de kullanılabilir. Genellikle boyut olarak 50 ila 100 mg olup geri kalan üç bölüm, sıvı nitrojen içinde dondurulur ek bulunmaktadır. Bu DNA, RNA ve protein izolasyonu için de kullanılabilir. </li><li> IACUC kurallarına göre karkas ve kalan dokuların atın. </li></ol> 3. Tümörler genomik DNA İzolasyon <table border="1"><tbody><tr><td> &lt;reaktif strong&gt; adı </td><td> Şirket </td><td> Katalog numarası </td></tr><tr><td> Protein Yağış çözümü </td><td> Qiagen </td><td> 158910 </td></tr><tr><td> Hücre lizis tamponu </td><td> Qiagen </td><td> 158906 </td></tr><tr><td> Proteinaz K </td><td> Qiagen </td><td> 158920 </td></tr><tr><td> RNaz A </td><td> Qiagen </td><td> 158924 </td></tr><tr><td> TE Tampon </td><td> Promega </td><td> V6232 </td></tr></tbody></table> Tablo 2. Reaktifler gereklidir. <ol><li> İnce temiz bir jilet ile dondurulmuş tümör numunesi (50 ila 100 mg) kıyma. </li><li> Sıra bir 1.5 ml mikrosantrifüj tüpü içinde kıyılmış ve doku 5 ul Proteinaz K çözeltisi (20 mg / ml) içeren bir hücre parçalama tamponu 1 ml ekleyin. </li><li> Iyice vorteksleyin. </li><li> ° C çalkalayıcı tercihen gecede en az 4 saat, 250 rpm olarak ayarlanan bir 55 inkübe edin. </li><li> 1 ul RNaz bir çözeltisi (10 mg / ml) eklenir ve boru 25 kez ters. </li><li> 30 dakika süre ile 37 ° C&#39;de inkübe edin. </li><li> 3 dakika için buz üzerine yerleştirilmesi ile oda sıcaklığına soğutun. </li><li> 333 ul Protein yağış çözüm ve şiddetle vorteks ekleyin. </li><li> 14.000 rpm 10 dakika santrifüjleyin. Proteinler pelet gerekir. Pelet tekrar çok küçük, girdap ise, daha sonra 5 dakika, ve yeniden santrifüj boyunca buz üzerinde inkübe edilir. </li><li> Temiz bir 15 ml santrifüj tüp içine supernatant DNA içeren kapalı dökün. </li><li> 100% izopropanol eşit hacmi ekleyin ve yavaşça tersine 50 kat karıştırın. </li><li> 3 dk süreyle 3500 rpm&#39;de santrifüj. </li><li> Süpernatantı atın. </li><li> % 70 etanol 1 ml ekleyin ve pelet yıkamak için tüp birkaç kez ters. </li><li> Bir 1.5 ml mikrosantrifüj tüpüne etanol ile yıkanmış topak aktarın. </li><li> 4 ° C&#39;de 5 dakika boyunca 14,000 rpm&#39;de santrifüje </li><li> Etanol kapalı dökün ve hava kuru (yaklaşık 5 ila 30 dakika) için tüp ters. </li><li> Süspanse DNA pellet TE 50 ila 500 ul DNA pelet boyutuna bağlı olarak. </li><li> 37 İsteğe inkübasyon ° C DNA süspansiyonu. </li><li> Uzun süreli depolama boyunca 4 ° C veya -20 ° C&#39;de depolayın. </li></ol> 4. Tümörler dan Linker Aracılı-PCR kullanarak genomik DNA <table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td></tr><tr><td> BfaI </td><td> New England Biolabs </td><td> R0568S </td></tr><tr><td> NlaIII </td><td> New England Biolabs </td><td> R0125S </td></tr><tr><td> 96 oyuklu plakalar MinElute </td><td> Qiagen </td><td> 28051 </td></tr><tr><td> QIAvac 96 Vakum manifoldu </td><td> Qiagen </td><td> 19504 </td></tr><tr><td> Multi-mikroplak Genie, 120V </td><td> Scientific Industries, Inc </td><td> SI-4000 </td></tr><tr><td> 5x ligasyon tampon ile T4 DNA ligaz </td><td> Invitrogen </td><html><td> 15224-041 </td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td></tr><tr><td> 25 mM dNTP </td><td> Bioexpress </td><td> C-5014-200 </td></tr><tr><td> Platinum Taq </td><td> Invitrogen </td><td> 10966-034 </td></tr><tr><td> FastStart Taq DNA Polimeraz </td><td> Roche </td><td> 12032929001 </td></tr><tr><td> Agaroz </td><td> Promega </td><td> V3121 </td></tr><tr><td> TAE Tampon </td><td> Promega </td><td> V4271 </td></tr><tr><td> TE Tampon </td><td> Promega </td><td> V6232 </td></tr><tr><td> Etidyum bromür </td><td> Promega </td><td> H5041 </td></tr></tbody></table> Tablo 3. Reaktifler gereklidir. Linker Diziler BfaI bağlayıcının + 5 &#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3&#39; BfaI linker-5 &#39;Phos-TAGTCCCTTAAGCGGAG 3&#39;NH2 &quot;&gt; NlaIII bağlayıcı + 5&#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 &#39; NlaIII linker-5 &#39;-Phos GTCCCTTAAGCGGAGCC 3&#39; Astar Diziler İleri Primer PCR sağ tarafında (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC: Primer PCR ön taraftır (BfaI) sol Sağ ve sol her iki taraf için Birincil PCR ters: Spl Link1 1 GTAATACGACTCACTATAGGGC İkincil PCR sağ ön tarafa: Bir Illumina barkodlu ikincil astar 5 &#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa Örneği (N adlı 12 bp barkod temsil, büyük harf sırası Illumina platformu için gereklidir, ve küçük harf sırası transpozon bağlanacaktır.) Bir Illumina barkodlu secon Örnek: İkincil PCR ileri sol tarafdary astar 5&#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (N adlı 12 bp barkod temsil, büyük harf sırası Illumina platformu için gereklidir, ve küçük harf sırası transpozon bağlanacaktır.) Sağ ve sol her iki taraf için İkincil PCR ters: bağlayıcının iç içe ters primerler 5 &#39;CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC <ol><li> + Tavlama ve - BfaI bağlayıcılara ve NlaII bağlayıcılar her ikisi için bağlayıcı bir ilintileyici (100 uM), 50 ul bağlayıcı ile 50 ul + (100 uM) karıştırılarak ve bir 1.5 ml mikrosantrifüj tüpü içinde 2 ul NaCl (5 M) ilave edilir. 95 5 dak ° C ısıya blok yerleştirin. Isıtma bloğu kapatın ve (bu bir saat veya daha fazla sürer) yavaş yavaş oda sıcaklığına soğumaya bırakın. Gerekinceye kadar soğutulduktan sonra, tavlanmış linkerler bir dondurucuda -20 ° C&#39;de muhafaza edilebilir. </li><li> DNA tümör iki kısım, 1 ug DNA ihtiva eden her bir tablet hazırlanır. Bir kısım zekâ sindirilir olacaktransposonun &quot;doğru&quot; sonuna yakın kesecek ha restriksiyon enzim. İkinci kısım transposonun &quot;sol&quot; sonuna yakın kesen bir kısıtlama enzimi ile sindirilmiş olacaktır. Bu her transpozon insersiyon yükselterek şansını maksimize etmek için yapılır. </li><li> &quot;Sağ&quot; tarafında enzim NlaII kullanarak bir kısım ise tümör DNA sindirimi ve &quot;sol&quot; tarafında enzim BfaI kullanarak diğer kısım ise tümör DNA sindirimi: enzim 1 ul, 5 ul 10x NEB Tampon 4. DNA (birleştir 1 ug) ve 50 ul toplam hacim için GKD 2 O. 37 gecede Digest DNA ° su banyosu veya kuvöz C. </li><li> Enzimleri inaktive ısıtın (BfaI = 80 ° C 20 dakika, NlaIII = 65 ° C, 20 dakika). </li><li> MinElute 96 plaka örnekleri koyarak sindirilmiş örnekler temizleyin, kuyular kadar yaklaşık 15 dakika süreyle vakum manifoldu ve vakum yer plaka kuru gözükmelidir. </li><li> Tüm Liqui çıkarmak için vakum manifoldu ve kağıt havlu ile 96 plaka blot alt plakasını çıkarınd </li><li> Her bir kuyunun 30 ul GKD 2 O ekleyin ve 2 dakika boyunca yüksek orbital çalkalayıcı seti sallamak veya 20 ila 40 kez aşağı yukarı pipetle ve. </li><li> Temiz 96 kuyucuğu içine MinElute 96 plaka kuyularda tüm hacmi (30 ul) aktarın. </li><li> Adım 4.8 ve adım 4,1 linkers gelen sindirilmiş DNA bağlayıcı ligasyon reaksiyonları gerçekleştirin. 10 ul sindirilmiş DNA, 4 ul 5x ligasyon tamponu, 5.5 ul tavlanmış bağlayıcı (950 ug / ul), 0.5 mikrolitre T4 ligaz (5 U / ul) karıştırılır. </li><li> 16 gece boyunca ile 4 saat için inkübe ° C. </li><li> 10 dakika boyunca 65 ° C&#39;de T4 DNA ligaz inaktive ısıtın. </li><li> 4.6 - MinElute 96 kuyucuğu ve gibi adımlar 4,5 açıklandığı bir vakum manifoldu kullanılarak ligasyonu temizleyin. </li><li> 30 ul H 2 O süspanse edin ve temiz bir 96 plaka transfer. </li><li> Concatamer transpozonlar kalan yok etmek için ikinci bir DNA sindirimi gerçekleştirin. Bu plazmid v kesen bir enzimi kullanılarak DNA bir ikinci kesme işlemi ile elde edilirtranspozon concatamer ihtiva eden transjenik farelerin oluşturmak için kullanılan Ector DNA. </li><li> Digest DNA BamHI (hem sağ hem sol tarafında) kullanarak: Mix adım 4.13, 5 ul 10x NEB tampon # 3, 0.5 ul BamHI (20 U / ul), 0.5 ul BSA (den ilintileyiciniz bağlanan DNA 25 ul 10 mg / ml ) ve 19 ul GKD 2 O. </li><li> 37 Digest 3-6 saat veya gece boyunca ° C. </li><li> Linker için transpozon ve astar özel için özel bir astar kullanılarak primer PCR gerçekleştirin. Bunlar kullandığınız ne transpozon ve linker bağlı olarak değişiklik gösterecektir. Primerler T2/Onc ve T2/Onc2 transpozonlar çalışma yukarıdaki astar tabloda listelenmiştir. </li><li> Birincil PCR: 5 ul 10x tampon, 2.0 ul MgCl2 (50 mM), 4 ul dNTP (2.5 nM), 1 ul Primer 1 (20 uM), 1 ul Primer 2 (20 uM), 0.25 ul Taq Platin (5 U / ) ul, linkers 3 ul Sindirilmiş DNA (miktarı değişebilir), en fazla 50 ul GKD 2 O. </li><li> PCR Programı: 94 ° C de 5 dakika, 94 30 döngüleri ° C için 30 sn, 60 ve dörneğin, 30 saniye için C, 90 sn için 72 ° C&#39;dir. 72 Final uzantısı ° C de 5 dakika. </li><li> MinElute 96 oyuklu plakalar ve yukarıda tarif edildiği gibi bir vakum manifoldu kullanılarak PCR ürünü temizleyin. </li><li> 30 ul H 2 O süspanse edin ve temiz bir 96 plaka transfer. </li><li> 148 ul GKD 2 O içine adım 4.21 DNA 2 ul seyreltilmesi ile 1 bir 1:75 seyreltme ° PCR Yap </li><li> Ayrıca Illumina GAIIx makine hem de (bu primerler ile ilgili örnekler için yukarıda astar tabloya bakınız) işlenmiş her bir tümör numune için eşsiz olan bir 12 baz çifti barkod için gerekli dizisine sahip primerlerin iç içe versiyonları ile ikincil PCR gerçekleştirin. </li><li> İkincil PCR: MgCl2 10 ul 10x Tampon, 8 ul dNTP (2.5 mM), 1 ul Illumina ikincil astar (20 uM), 1 ul Illumina Nest 1 ikincil astar (20 uM), 0.25 ul FastStart Taq (barkodlu 5 U / ul ), primer PCR seyreltilmiş 1:75 2 ul DNA, 100 ul GKD 2 O. </li><li> PCR Programı: 94 °, 2 dakika için C, 90 sn için 45 saniye, 72 ° C&#39;de 30 saniye, 53 ° C de 94 ° C arasında 30 devir. 72 Final uzantısı ° C de 5 dakika. </li><li> Etidiyum bromid (0.5 ug / ml) ihtiva eden bir% 1 agaroz jeli üzerinde Bu PCR reaksiyonu 45 ul çalıştırın. Tümör içinde birçok farklı transpozon ekleme (Şekil 3) arasında amplikonlar temsil eden PCR ürünleri bir &quot;smear&quot; olmalıdır. </li><li> MinElute 96 oyuklu plakalar ve yukarıda tarif edildiği gibi bir vakum manifoldu kullanılarak PCR ürünü kalan 50 ul temizleyin. Kuyularda 50 ul GKD 2 O yerleştirerek tekrar vakumlama tarafından bir kez yıkayın. </li><li> 30 ul TE süspanse edin ve temiz bir 96 plaka transfer. </li><li> Her örnek DNA&#39;nın konsantrasyonu tayin edilir. Tek bir 1.5 ml mikrofuge&#39;de tüp DNA eşit miktarda karıştırın. Bu, bir Illumina HiSeq 2000 makine, tek bir şerit halinde sıralı kütüphane olacaktır. Bir Illumina çalışma tek bir şeritte sıra birkaç yüz tümörlerin mümkündür. </li><li> Sunmaksıralama için tüm tümörlerin DNA eşit miktarlarda içeren tek tüp. Bu, kurum ya da ticari olarak yapılabilir. </li></ol> 5. Eklemeler Transposon analizi <ol><li> Transpozon ekleme verileri analiz etmek için yazılım SourceForge (üzerinden ücretsiz indirmek için kullanılabilir <a href="http://sourceforge.net/projects/tapdancebio/" target="_blank">http://sourceforge.net/projects/tapdancebio/</a> ). TapDance adlandırılan program, Illumina platformu ve kütüphane haritası metin dosyasına bir barkod gelen sıra dosyası gerektirir. </li></ol>

<ol>
	<li>Fearon, E. R., Vogelstein, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+model+for+colorectal+tumorigenesis.">A genetic model for colorectal tumorigenesis.</a> Cell. 61, 759-767 (1990).</li><li>Wood, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genomic+Landscapes+of+Human+Breast+and+Colorectal+Cancers.">The Genomic Landscapes of Human Breast and Colorectal Cancers.</a> Science. 318, 1108-1113 (2007).</li><li>Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsv&#225;k, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Reconstruction+of+Sleeping+Beauty,+a+Tc1-like+Transposon+from+Fish,+and+Its+Transposition+in+Human+Cells.">Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells.</a> Cell. 91, 501-510 (1997).</li><li>Starr, T. K., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+using+the+Sleeping+Beauty+transposon.">Cancer gene discovery using the Sleeping Beauty transposon.</a> Cell Cycle. 4, 1744-1748 (2005).</li><li>Mueller, P. R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Footprinting+of+a+Muscle+Specific+Enhancer+by+Ligation+Mediated+PCR.">In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR.</a> Science. 246, 780-786 (1989).</li><li>Bergemann, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+methods+for+finding+common+insertion+sites+and+co-occurring+common+insertion+sites+in+transposon-+and+virus-based+genetic+screens.">New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens.</a> Nucleic acids research. 40, 3822-3833 (2012).</li><li>Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Harnessing+transposons+for+cancer+gene+discovery.">Harnessing transposons for cancer gene discovery.</a> Nature Reviews Cancer. 10, 696-706 (2010).</li><li>Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+in+solid+tumours+using+transposon-based+somatic+mutagenesis+in+the+mouse.">Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse.</a> Nature. 436, 272-276 (2005).</li><li>Starr, T. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transposon-based+genetic+screen+in+mice+identifies+genes+altered+in+colorectal+cancer.">A transposon-based genetic screen in mice identifies genes altered in colorectal cancer.</a> Science. 323, 1747-1750 (2009).</li><li>Keng, V. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+transposon-based+insertional+mutagenesis+screen+for+genes+associated+with+mouse+hepatocellular+carcinoma.">A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma.</a> Nature. 27, 264-274 (2009).</li><li>Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+mutagenesis+using+a+highly+mobile+somatic+Sleeping+Beauty+transposon+system.">Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system.</a> Nature. 436, 221-226 (2005).</li></ol>

Yazarlar ifşa etmek başka bir şey var.

Uyuyan güzel transpozon sistemi kullanan bir ileri genetik ekran neden olan kanser mutasyonları tanımlamak için bir yöntem sağlar. Herhangi hazırlayıcı mutasyon ek olarak Cre rekombinaz kontrol etmek için uygun bir promotörün seçerek, SB ekran bilinen belirlemek ve yeni aday genleri kanser olacaktır. Bir SB ekranının başarısı ekranı yaratmak için seçilen fareler üzerinde büyük ölçüde bağlıdır. Transpozon için, farklı kromozomlar 7...

<table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td><td> Yorumlar (isteğe bağlı) </td></tr><tr><td> Sure-Seal İndüksiyon Odası </td><td> Beyin Ağacı Bilimsel </td><td> EZ-177 </td><td></td></tr><tr><td> Cryovial </td><td> Bioexpress </td><td> C-3355-2 </td><td></td></tr><tr><td> % 10 tamponlu formalin </td><td> Sigma Aldrich </td><td> HT501128-4L </td><td></td></tr><tr><td> Protein Yağış çözümü </td><td> Qiagen </td><td> 158910 </td><td></td></tr><tr><td> Hücre lizis tamponu </td><td> Qiagen </td><td> 158906 </td><td></td></tr><tr><td> Proteinaz K </td><td> Qiagen </td><td> 158920 </td><td></td></tr><tr><td> RNaz A </td><td> Qiagen </td><td> 158924 </td><td></td></tr><tr><td> TE Tampon </td> &lt;td&gt; Promega </td><td> V6232 </td><td></td></tr><tr><td> BfaI </td><td> New England Biolabs </td><td> R0568S </td><td></td></tr><tr><td> NlaIII </td><td> New England Biolabs </td><td> R0125S </td><td></td></tr><tr><td> 96 oyuklu plakalar MinElute </td><td> Qiagen </td><td> 28051 </td><td></td></tr><tr><td> QIAvac 96 Vakum manifoldu </td><td> Qiagen </td><td> 19504 </td><td></td></tr><tr><td> Multi-mikroplak Genie, 120V </td><td> Scientific Industries, Inc </td><td> SI-4000 </td><td></td></tr><tr><td> 5x ligasyon tampon ile T4 DNA ligaz </td><td> Invitrogen </td><td> 15224-041 </td><td></td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td><td></td></tr><tr><td> 25mM dNTP </td><td> Bioexpress </td><td> C-5014-200 </td><td></td></tr><tr><td> Platinum Taq </td><td> Invitrogen </td><td&gt; 10966-034 </td><td></td></tr><tr><td> FastStart Taq DNA Polimeraz </td><td> Roche </td><td> 12032929001 </td><td></td></tr><tr><td> Agaroz </td><td> Promega </td><td> V3121 </td><td></td></tr><tr><td> TAE Tampon </td><td> Promega </td><td> V4271 </td><td></td></tr><tr><td> TE Tampon </td><td> Promega </td><td> V6232 </td><td></td></tr><tr><td> Etidyum bromür </td><td> Promega </td><td> H5041 </td><td></td></tr></tbody></table>

identification of sleeping beauty transposon insertions in solid tumors using linker-mediated pcr

Insan tümörlerinin genomik, proteomik Transkriptomik ve epigenomic analizler eşleştirilmiş normal dokuya göre her kanser genom içerisindeki anomalilerin binlerce olduğunu göstermektedir. Bu analizlere dayanarak kansere 1 keşfedilmeyen birçok genetik sürücü olmadığını açıktır. Ne yazık ki bu sürücüler doğrudan tümör oluşumuna katkıda bulunmayan genomundaki yolcu anomalilerin çok daha fazla sayıda içinde gizlidir. Kanser genomun bir başka yönü de benzer tümör tipleri içinde hatırı sayılır genetik heterojenlik olmasıdır. Her tümör tümör oluşumu 2 bir selektif avantaj sağlayan farklı mutasyon barındırabilir. Yolcu mutasyonlar arka azaltırken farelerde tarafsız bir ileri genetik ekran Sahne, tümörler oluşturmak ve kendi genetik kompozisyon analiz etmek için araçlar sağlar. Sleeping Beauty (SB) transpozon sistemi böyle bir yöntem 3&#39;tür. SB sistemi mobil v kullanırtransposase enzim tarafından genomu boyunca yerleştirilebilir ectors (transpozonlar). Mutasyonlar, Cre rekombinaz tarafından aktive olan bir koşullu transposase alelinin kullanımı ile belirli bir hücre tipi ile sınırlıdır. Birçok fare hatları belli dokularda bulunduğunu ifade Cre Rekombinaz var. Koşullu transposase alleli (örn. Lox-stop-Lox-SB11) şu satırları birini geçerek, SB sistem sadece ifade Cre Rekombinaz hücreleri aktive edilir. Cre Rekombinaz ÖTV durak kaset olacak ki böylece belirlenmiş hücre tipi olan transpozon mutajenez aktive transposase allel blok ifadesi. Deneysel fareler bir şartlı transposase alel, transpozonlar bir concatamer, ve bir doku-spesifik Cre rekombinaz alleli böylece bir SB ekran transgenik farelerde üç cins üreme ile başlatılır. Bu fareler tümörler şeklinde yaşına kadar izin ve can çekişen hale gelir. Daha sonra fareler bulunmaktadırnekropsi ve genomik DNA tümör izole edilmiştir. Daha sonra, genomik DNA bağlayıcı aracılı-PCR ile yapılmıştır (LM-PCR) bir SB transpozon içeren genomik bir lokus amplifikasyon olarak sonuçlanır. LM-PCR, tek bir tümör 4 transpozon eklemeler içeren genomik lokus yüzlerce temsil farklı amplikonlarının yüzlerce neden olacaktır tek bir tümör üzerinde gerçekleştirildi. Tüm tümörlerde transpozon eklemeleri analiz edilir ve ortak ekleme siteleri (CISs) uygun istatistiksel metodun 5 kullanılarak tanımlanır. BDT içindeki genler onkogenler ve tümör baskılayıcı genler olması kuvvetle muhtemeldir, ve aday kanser genleri kabul edilir. Kanser aday genlerin tanımlanması için SB sistemini kullanmanın avantajları şunlardır: kendi dizisi, 2 bilindiğinden, 1) transpozon kolaylıkla aktarılması hemen hemen herhangi bir hücre tipi yönlendirilir ve 3) transpozon yeteneğine sahip olabilir) genomuna yerleştirilebilir tanıtan hem kazanç ve kayıp fonksiyon-mutasyonlar 6. Following protokolü aday kanser genleri (Şekil 1) tanımlamak için SB transpozon sistemini kullanan bir ileri genetik ekran hazırlamak ve yürütmek açıklamaktadır.

Yetiştirme programı kurulduktan sonra, yetiştiriciler her 19-21 günde bir çöp üretmek gerekir. Çöp boyutu yetiştiriciler ve genetik arka plan yaşına bağlı olarak, 5 ila 12 yavru değişecektir. Ayrıca, çöp genotip ıslahı doğru ve başarılı olduğunu teyit etmek için bir yol olarak Mendel genetiği aşağıda olduğundan emin olun. Deney başarılı olması için, deney hayvanlarında tümör oluşumunda kontrol hayvanlarında tümör oluşumunda önemli ölçüde daha ...

Watch this Scientific Journal Video about Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR at JoVE.com

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Tarafsız bir yaklaşım kullanarak karsinogenez bilinmeyen sürücüsü tespit için bir yöntem tarif edilmektedir. Yöntem kullanır<em&gt; Sleeping Beauty</emBelirli dokulara yönelik rastgele bir mutajen olarak&gt; transpozon. Tümör oluşumunu tahrik transpozon insersiyon Genomik haritalama roman onkogenler ve tümör baskılayıcı genler belirler

Tanımlanması<em&gt; Sleeping Beauty</emLinker-aracılı PCR kullanarak Solid Tümörlerde&gt; Transposon Eklemeler

Genomic, proteomic, transcriptomic, and epigenomic analyses of human tumors indicate that there are thousands of anomalies within each cancer genome ...

identification-sleeping-beauty-transposon-insertions-solid-tumors

Research

JoVE Journal

Medicine

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

14.0K Görüntüleme.  University of Minnesota, Minneapolis. Tarafsız bir yaklaşım kullanarak karsinogenez bilinmeyen sürücüsü tespit için bir yöntem tarif edilmektedir. Yöntem kullanır Sleeping Beauty transpozon. Tümör oluşumunu tahrik transpozon insersiyon Genomik haritalama roman onkogenler ve tümör baskılayıcı genler belirler

Video: Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so by a process called retrotransposition wherein they transcribe to form an mRNA intermediate which is then consequently inserted into the genome by reverse transcription. Despite being silent in normal cells, LINE-1s are highly active in different epithelial tumors. De novo LINE-1 insertions can potentially drive tumorigenesis, and hence it is important to systematically study LINE-1 retrotransposition in cancer. Out of ~150 retrotransposition-competent LINE-1s present in the human genome, only a handful of LINE-1 loci, also referred to as &#34;hot&#34; LINE-1s, account for the majority of de novo LINE-1 insertion in different cancer types. We have developed a simple polymerase chain reaction (PCR)-based method to monitor retrotransposition activity of these hot LINE-1s. This method, based on long-distance inverse (LDI)-PCR, takes advantage of 3&#180; transduction, a mechanism by which a LINE-1 mobilizes its flanking non-repetitive region, which can subsequently be used to identify de novo LINE-1 3&#180; transduction events stemming from a particular hot LINE-1.

This article outlines a simple PCR-based assay to monitor the activity of an active LINE-1 retrotransposon and to map de novo retrotranspositions in a given genome. Using the MCF7 cell line, we demonstrate herein how this method can be applied to detect activity of a LINE-1 located at 22q12.1.

Uzun mesafe ters PCR tarafından sıcak hat-1s Retrotransposition aktivitesinin tespiti

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Kanser Araştırmaları

Clinical Application of Sleeping Beauty and Artificial Antigen Presenting Cells to Genetically Modify T Cells from Peripheral and Umbilical Cord Blood

The potency of clinical-grade T cells can be improved by combining gene therapy with immunotherapy to engineer a biologic product with the potential for superior (i) recognition of tumor-associated antigens (TAAs), (ii) persistence after infusion, (iii) potential for migration to tumor sites, and (iv) ability to recycle effector functions within the tumor microenvironment. Most approaches to genetic manipulation of T cells engineered for human application have used retrovirus and lentivirus for the stable expression of CAR1-3. This approach, although compliant with current good manufacturing practice (GMP), can be expensive as it relies on the manufacture and release of clinical-grade recombinant virus from a limited number of production facilities. The electro-transfer of nonviral plasmids is an appealing alternative to transduction since DNA species can be produced to clinical grade at approximately 1/10th the cost of recombinant GMP-grade virus. To improve the efficiency of integration we adapted Sleeping Beauty (SB) transposon and transposase for human application4-8. Our SB system uses two DNA plasmids that consist of a transposon coding for a gene of interest (e.g. 2nd generation CD19-specific CAR transgene, designated CD19RCD28) and a transposase (e.g. SB11) which inserts the transgene into TA dinucleotide repeats9-11. To generate clinically-sufficient numbers of genetically modified T cells we use K562-derived artificial antigen presenting cells (aAPC) (clone #4) modified to express a TAA (e.g. CD19) as well as the T cell costimulatory molecules CD86, CD137L, a membrane-bound version of interleukin (IL)-15 (peptide fused to modified IgG4 Fc region) and CD64 (Fc-&gamma; receptor 1) for the loading of monoclonal antibodies (mAb)12. In this report, we demonstrate the procedures that can be undertaken in compliance with cGMP to generate CD19-specific CAR+ T cells suitable for human application. This was achieved by the synchronous electro-transfer of two DNA plasmids, a SB transposon (CD19RCD28) and a SB transposase (SB11) followed by retrieval of stable integrants by the every-7-day additions (stimulation cycle) of &gamma;-irradiated aAPC (clone #4) in the presence of soluble recombinant human IL-2 and IL-2113. Typically 4 cycles (28 days of continuous culture) are undertaken to generate clinically-appealing numbers of T cells that stably express the CAR. This methodology to manufacturing clinical-grade CD19-specific T cells can be applied to T cells derived from peripheral blood (PB) or umbilical cord blood (UCB). Furthermore, this approach can be harnessed to generate T cells to diverse tumor types by pairing the specificity of the introduced CAR with expression of the TAA, recognized by the CAR, on the aAPC.

Clinical Application of Sleeping Beauty and Artificial Antigen Presenting Cells to Genetically Modify T Cells from Peripheral and Umbilical Cord Blood

T cells expressing a CD19-specific chimeric antigen receptor (CAR) are infused as investigational treatment of B-cell malignancies in our first-in-human gene therapy trials. We describe genetic modification of T cells using the Sleeping Beauty (SB) system to introduce CD19-specific CAR and selective propagation on designer CD19+ artificial antigen presenting cells.

Klinik Uygulama<em&gt; Sleeping Beauty</emGenetiği Periferik ve Göbek Kordon Kanı alınan T hücreleri Değiştir Sunan Hücreler&gt; ve Yapay Antijen

The potency of clinical-grade T cells can be improved by combining gene therapy with immunotherapy to engineer  a biologic product with the potential for ...

İmmünoloji ve Enfeksiyon

Studying Triple Negative Breast Cancer Using Orthotopic Breast Cancer Model

Triple-negative breast cancer (TNBC) is an aggressive breast cancer subtype with limited therapeutic options. When compared to patients with less aggressive breast tumors, the 5-year survival rate of TNBC patients is 77% due to their characteristic drug-resistant phenotype and metastatic burden. Toward this end, murine models have been established aimed at identifying novel therapeutic strategies limiting TNBC tumor growth and metastatic spread. This work describes a practical guide for the TNBC orthotopic model where MDA-MB-231 breast cancer cells suspended in a basement membrane matrix are implanted in the fourth mammary fat pad, which closely mimics the cancer cell behavior in humans. Measurement of tumors by caliper, lung metastasis assessment via in vivo and ex vivo imaging, and molecular detection are discussed. This model provides an excellent platform to study therapeutic efficacy and is especially suitable for the study of the interaction between the primary tumor and distal metastatic sites.

This work presets an advanced protocol to accurately assess tumor loading by detection of green fluorescent protein and bioluminescence signals as well as the integration of quantitative molecular detection technique.

Ortotopik Meme Kanseri Modeli Kullanarak Üçlü Negatif Meme Kanseri Eğitimi

Triple-negative breast cancer (TNBC) is an aggressive breast cancer subtype with limited therapeutic options. When compared to patients with less ...

In Vivo CRISPR/Cas9 Screening to Simultaneously Evaluate Gene Function in Mouse Skin and Oral Cavity

Genetically modified mouse models (GEMM) have been instrumental in assessing gene function, modeling human diseases, and serving as preclinical model to assess therapeutic avenues. However, their time-, labor- and cost-intensive nature limits their utility for systematic analysis of gene function. Recent advances in genome-editing technologies overcome those limitations and allow for the rapid generation of specific gene perturbations directly within specific mouse organs in a multiplexed and rapid manner. Here, we describe a CRISPR/Cas9-based method (Clustered Regularly Interspaced Short Palindromic Repeats) to generate thousands of gene knock-out clones within the epithelium of the skin and oral cavity of mice, and provide a protocol detailing the steps necessary to perform a direct&#160;in vivo&#160;CRISPR&#160;screen for tumor suppressor genes. This approach can be applied to other organs or other CRISPR/Cas9 technologies such as CRISPR-activation or CRISPR-inactivation to study the biological function of genes during tissue homeostasis or in various disease settings.

Here we describe a rapid and direct in vivo CRISPR/Cas9 screening methodology using ultrasound-guided in utero embryonic lentiviral injections to simultaneously assess functions of several genes in the skin and oral cavity of immunocompetent mice.

Fare Derisi ve Ağız Boşluğundaki Gen İşlevlerini Aynı Anda Değerlendirmek için Vivo CRISPR/Cas9 Taraması

Genetically modified mouse models (GEMM) have been instrumental in assessing gene function, modeling human diseases, and serving as preclinical model to ...

Genetik

Comparative Lesions Analysis Through a Targeted Sequencing Approach

Assessing intra-tumoral heterogeneity (ITH) is of paramount importance to anticipate failure of targeted therapies and design accordingly effective anti-tumor strategies. Although concerns are frequently raised due to differences in sample processing and depth of coverage, next-generation sequencing of solid tumors have unraveled a highly variable degree of ITH across tumor types. Capturing the genetic relatedness between primary and metastatic lesions through the identification of clonal and subclonal populations is critical to the design of therapies for advance-stage diseases. Here, we report a method for comparative lesions analysis that allows for the identification of clonal and subclonal populations among different specimens from the same patient. The experimental approach described here integrates three well-established approaches: histological analysis, high-coverage multi-lesion sequencing, and immunophenotypic analyses. In order to minimize the effects on the detection of subclonal events by inappropriate sample processing, we subjected tissues to careful pathological examination and neoplastic cell enrichment. Quality controlled DNA from neoplastic lesions and normal tissues was then subjected to high coverage sequencing, targeting the coding regions of 409 relevant cancer genes. While only looking at a limited genomic space, our approach enables evaluating the extent of heterogeneity among somatic alterations (single-nucleotide mutations and copy-number variations) in distinct lesions from a given patient. Through comparative analysis of sequencing data, we were able to distinguish clonal vs. subclonal alterations. The majority of ITH is often ascribed to passenger mutations; therefore, we also used immunohistochemistry to predict functional consequences of mutations. While this protocol has been applied to a specific tumor type, we anticipate that the methodology described here is broadly applicable to other solid tumor types.

This article describes a method to identify clonal and subclonal alterations among different specimens from a given patient. Although the experiments described here focus on a specific tumor type, the approach is broadly applicable to other solid tumors.

Hedefe Yönelik Sıralama Yaklaşımı ile Karşılaştırmalı Lezyonlar Analizi

Assessing intra-tumoral heterogeneity (ITH) is of paramount importance to anticipate failure of targeted therapies and design accordingly effective ...

Davranış

Transposon Mediated Integration of Plasmid DNA into the Subventricular Zone of Neonatal Mice to Generate Novel Models of Glioblastoma

An urgent need exists to test the contribution of new genes to the pathogenesis and progression of human glioblastomas (GBM), the most common primary brain tumor in adults with dismal prognosis. New potential therapies are rapidly emerging from the bench and require systematic testing in experimental models which closely reproduce the salient features of the human disease. Herein we describe in detail a method to induce new models of GBM with transposon-mediated integration of plasmid DNA into cells of the subventricular zone of neonatal mice. We present a simple way to clone new transposons amenable for genomic integration using the Sleeping Beauty transposon system and illustrate how to monitor plasmid uptake and disease progression using bioluminescence, histology and immuno-histochemistry. We also describe a method to create new primary GBM cell lines. Ideally, this report will allow further dissemination of the Sleeping Beauty transposon system among brain tumor researchers, leading to an in depth understanding of GBM pathogenesis and progression and to the timely design and testing of effective therapies for patients.

Here we describe an efficient and versatile protocol to induce, monitor and analyze novel glioblastomas (GBM) using transposon DNA injected into the ventricles of neonatal mice. Cells of the subventricular zone, which take up the plasmid, transform, proliferate and generate tumors with histo-pathological characteristics of human GBM.

Yenidoğan Fareler subventricular Bölgesi içine Plazmid DNA Transpozon Aracılı Entegrasyon Glioblastoma&#39;nın Roman modelleri oluşturmak için

An urgent need exists to test the contribution of new genes to the pathogenesis and progression of human glioblastomas (GBM), the most common primary ...

Tıp

Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing

Efforts to detect and investigate key oncogenic mutations have proven valuable to facilitate the appropriate treatment for cancer patients. The establishment of high-throughput, massively parallel "next-generation" sequencing has aided the discovery of many such mutations. To enhance the clinical and translational utility of this technology, platforms must be high-throughput, cost-effective, and compatible with formalin-fixed paraffin embedded (FFPE) tissue samples that may yield small amounts of degraded or damaged DNA. Here, we describe the preparation of barcoded and multiplexed DNA libraries followed by hybridization-based capture of targeted exons for the detection of cancer-associated mutations in fresh frozen and FFPE tumors by massively parallel sequencing. This method enables the identification of sequence mutations, copy number alterations, and select structural rearrangements involving all targeted genes. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus conferring high sensitivity for detecting low frequency mutations.

We describe the preparation of barcoded DNA libraries and subsequent hybridization-based exon capture for detection of key cancer-associated mutations in clinical tumor specimens by massively parallel "next generation" sequencing. Targeted exon sequencing offers the benefits of high throughput, low cost, and deep sequence coverage, thus yielding high sensitivity for detecting low frequency mutations.

Ekson yakalama ve Devasa Paralel Dizilimine tarafından Tümör Örneklerinin somatik genetik değişiklikler tespit

Efforts  to detect and investigate key oncogenic mutations have proven valuable to  facilitate the appropriate treatment for cancer patients. The ...

Biyoloji

Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, Oncostreams, and Invasion

Gliomas are primary brain tumors characterized by their invasiveness and heterogeneity. Specific histological patterns such as pseudopalisades, microvascular proliferation, mesenchymal transformation and necrosis characterize the histological heterogeneity of high-grade gliomas. Our laboratory has demonstrated that the presence of high densities of mesenchymal cells, named oncostreams, correlate with tumor malignancy. We have developed a unique approach to understand the mechanisms that underlie glioma&#39;s growth and invasion. Here, we describe a comprehensive protocol that utilizes laser capture microdissection (LMD) and RNA sequencing to analyze differential mRNA expression of intra-tumoral heterogeneous multicellular structures (i.e., mesenchymal areas or areas of tumor invasion). This method maintains good tissue histology and RNA integrity. Perfusion, freezing, embedding, sectioning, and staining were optimized to preserve morphology and obtain high-quality laser microdissection samples. The results indicate that perfusion of glioma bearing mice using 30% sucrose provides good morphology and RNA quality. In addition, staining tumor sections with 4% Cresyl violet and 0.5% eosin results in good nuclear and cellular staining, while preserving RNA integrity. The method described is sensitive and highly reproducible and it can be utilized to study tumor morphology in various tumor models. In summary, we describe a complete method to perform LMD that preserves morphology and RNA quality for sequencing to study the molecular features of heterogeneous multicellular structures within solid tumors.

Laser microdissection (LMD) is a sensitive and highly reproducible technique that can be used to uncover pathways that mediate glioma heterogeneity and invasion. Here, we describe an optimized protocol to isolate discrete areas from glioma tissue using laser LMD followed by transcriptomic analysis.

İntratümöral Heterojenite, Oncostreams ve Invasion'ın Mekansal ve Moleküler Karakterizasyonu için Glioma Alt Bölgelerinin Lazer Yakalama Mikrodizması

Gliomas are primary brain tumors characterized by their invasiveness and heterogeneity. Specific histological patterns such as pseudopalisades, ...

Nörobilim

gDNA Enrichment by a Transposase-based Technology for NGS Analysis of the Whole Sequence of BRCA1, BRCA2, and 9 Genes Involved in DNA Damage Repair

The widespread use of Next Generation Sequencing has opened up new avenues for cancer research and diagnosis. NGS will bring huge amounts of new data on cancer, and especially cancer genetics. Current knowledge and future discoveries will make it necessary to study a huge number of genes that could be involved in a genetic predisposition to cancer. In this regard, we developed a Nextera design to study 11 complete genes involved in DNA damage repair. This protocol was developed to safely study 11 genes (ATM, BARD1, BRCA1, BRCA2, BRIP1, CHEK2, PALB2, RAD50, RAD51C, RAD80, and TP53) from promoter to 3&#39;-UTR in 24 patients simultaneously. This protocol, based on transposase technology and gDNA enrichment, gives a great advantage in terms of time for the genetic diagnosis thanks to sample multiplexing. This protocol can be safely used with blood gDNA.

gDNA Enrichment by a Transposase-based Technology for NGS Analysis of the Whole Sequence of BRCA1, BRCA2, and 9 Genes Involved in DNA Damage Repair

gDNA enrichment for NGS sequencing is an easy and powerful tool for the study of constitutional mutations. In this article, we present the procedure to analyse simply the complete sequence of 11 genes involved in DNA damage repair.

Whole Sırasının NGS Analiz için bir transpozaz tabanlı Technology tarafından gDNA Zenginleştirme<em&gt; BRCA1</em&gt;<em&gt; BRCA2</emDNA Hasarı Onarım ilgilendim&gt; ve 9 Genler

The widespread use of Next Generation Sequencing has opened up new avenues for cancer research and diagnosis. NGS will bring huge amounts of new data on ...

Electroporation-Based Genetic Modification of Primary Human Pigment Epithelial Cells Using the Sleeping Beauty Transposon System

Our increasingly aging society leads to a growing incidence of neurodegenerative diseases. So far, the pathological mechanisms are inadequately understood, thus impeding the establishment of defined treatments. Cell-based additive gene therapies for the increased expression of a protective factor are considered as a promising option to medicate neurodegenerative diseases, such as age-related macular degeneration (AMD). We have developed a method for the stable expression of the gene encoding pigment epithelium-derived factor (PEDF), which is characterized as a neuroprotective and anti-angiogenic protein in the nervous system, into the genome of primary human pigment epithelial (PE) cells using the Sleeping Beauty (SB) transposon system. Primary PE cells were isolated from human donor eyes and maintained in culture. After reaching confluence, 1 x 104 cells were suspended in 11 &#181;L of resuspension buffer and combined with 2 &#181;L of a purified solution containing 30 ng of hyperactive SB (SB100X) transposase plasmid and 470 ng of PEDF transposon plasmid. Genetic modification was carried out with a capillary electroporation system using the following parameters: two pulses with a voltage of 1,100 V and a width of 20 ms. Transfected cells were transferred into culture plates containing medium supplemented with fetal bovine serum; antibiotics and antimycotics were added with the first medium exchange. Successful transfection was demonstrated in independently performed experiments. Quantitative polymerase chain reaction (qPCR) showed the increased expression of the PEDF transgene. PEDF secretion was significantly elevated and remained stable, as evaluated by immunoblotting, and quantified by enzyme-linked immunosorbent assay (ELISA). SB100X-mediated transfer allowed for a stable PEDF gene integration into the genome of PE cells and ensured the continuous secretion of PEDF, which is critical for the development of a cell-based gene addition therapy to treat AMD or other retinal degenerative diseases. Moreover, analysis of the integration profile of the PEDF transposon into human PE cells indicated an almost random genomic distribution.

We have developed a protocol to transfect primary human pigment epithelial cells by electroporation with the gene encoding pigment epithelium-derived factor (PEDF) using the Sleeping Beauty (SB) transposon system. Successful transfection was demonstrated by quantitative polymerase chain reaction (qPCR), immunoblotting, and enzyme-linked immunosorbent assay (ELISA).

Tanımlanması

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Uzun mesafe ters PCR tarafından sıcak hat-1s Retrotransposition aktivitesinin tespiti

Klinik Uygulama

Ortotopik Meme Kanseri Modeli Kullanarak Üçlü Negatif Meme Kanseri Eğitimi

Fare Derisi ve Ağız Boşluğundaki Gen İşlevlerini Aynı Anda Değerlendirmek için Vivo CRISPR/Cas9 Taraması

Hedefe Yönelik Sıralama Yaklaşımı ile Karşılaştırmalı Lezyonlar Analizi

Yenidoğan Fareler subventricular Bölgesi içine Plazmid DNA Transpozon Aracılı Entegrasyon Glioblastoma'nın Roman modelleri oluşturmak için

Ekson yakalama ve Devasa Paralel Dizilimine tarafından Tümör Örneklerinin somatik genetik değişiklikler tespit

İntratümöral Heterojenite, Oncostreams ve Invasion'ın Mekansal ve Moleküler Karakterizasyonu için Glioma Alt Bölgelerinin Lazer Yakalama Mikrodizması

Whole Sırasının NGS Analiz için bir transpozaz tabanlı Technology tarafından gDNA Zenginleştirme

Uyuyan Güzel Transpozon Sistemi Kullanılarak Primer İnsan Pigment Epitel Hücrelerinin Elektroporasyon Tabanlı Genetik Modifikasyonu