Os autores gostariam de agradecer Branden Moriarity, David Largaespada, e Vincent Keng da Universidade de Minnesota, e Adam Dupuy da Universidade de Iowa para a sua assistência no desenvolvimento do protocolo descrito acima.

1. Reprodução e Envelhecimento de Animais Transgênicos <ol><li> Selecione as linhagens de camundongos transgênicos adequadas para a sua experiência. Uma experiência típica vai usar três linhas transgénicas, um rato transposase condicional, um rato portador de um dos transposões concatamer, e um rato expressando recombinase Cre nas células crê serem as células de origem para o cancro desejado. Se o cancro a ser modelada tem uma mutação conhecida num grande percentagem dos pacientes, pode ser desejável incluir essa mutação no início. Exemplos desses &quot;predisponentes&quot; mutações incluem Kras ativados, dominantes TP53 negativas ou um alelo Pten floxed. Ao adicionar em uma mutação predisponente o modelo pode representar melhor o câncer humano (ver 1.3). Transposase Beleza vários ratos de dormir e de transposons estão disponíveis no Instituto Nacional de Câncer Rato Repository ( <a href="http://mouse.ncifcrf.gov/" target="_blank">http://mouse.ncifcrf.gov/</a> ). </li><li> Camundongos da raça condicionais transposase com ratos, contendo os transposons para, eventualmente, obter camundongos homozigotos para ambos os alelos se possível. Breed descendência homozigótica para ratinhos que expressam Cre recombinase para gerar os seus triplos transgénicos ratinhos experimentais (figura 2). Nota: Obtenção de camundongos homozigotos nem sempre é possível ou ideal. Por exemplo, p53 homozigotos dominantes negativos ratos são muito mais difíceis de produzir do que os ratos heterozigotos. Além disso, é útil para assegurar que ninhadas seguir genética mendeliana para confirmar que o sistema de criação de animais é bem sucedido. </li><li> Se usar um fundo predispostos, os ratos da raça primeiro com a transposase de camundongos com o alelo de predisposição. Simultaneamente, os ratos da raça expressando a recombinase Cre ratinhos que transportam os transposons. Criar ratos homozigotos para cada alelo, se possível. Finalmente, produzir a prole homozigótica dos últimos dois esquemas de melhoramento para gerar quadruplicar anim experimental transgênicoals. </li><li> Além dos animais experimentais, gerar coortes de controlo de ratos. O grupo de controlo é normalmente constituída por ninhada do que apenas a reprodução experimental herdam dois dos três alelos (Figura 2). No caso de um fundo predispostos, incluindo ratos, três dos quatro alelos será também necessário. </li><li> Monitorar ratinhos experimentais e de controlo por dia durante o desenvolvimento do tumor e / ou moribundity. Siga o seu cuidado com os animais institucional e de uso da comissão (IACUC) requisitos para a criação de animais. Além disso, é típico para determinar uma idade em que você vai sacrificar um animal, se ele ainda não se tornou moribundo. Dezoito meses é uma idade típica em que os ratos são sacrificados. </li></ol> 2. Necropsia de Animais Transgênicos <table border="1"><tbody><tr><td> Nome do reagente </td><td> Companhia </td><td> Número de catálogo </td></tr><tr><td> Sure-Seal InducCâmara ção </td><td> Cérebro Árvore Científico </td><td> EZ-177 </td></tr><tr><td> Criotubo </td><td> Bioexpress </td><td> C-3355-2 </td></tr><tr><td> Formol tamponado 10% </td><td> Sigma Aldrich </td><td> HT501128-4L </td></tr></tbody></table> Reagentes Tabela 1. Necessário. <ol><li> Quando um rato está moribundo ou atingiu o fim da vida útil determinado, eutanásia animal, usando uma câmara de 2 CO seguindo suas diretrizes IACUC. Geralmente, colocar o animal em uma câmara de gás limpo, abrir o tanque de gás e ajustar o regulador de ler não superior a 5 libras por polegada quadrada. Encher lentamente para minimizar a irritação nasal e ocular e aversão ao CO 2. Certifique-se de que o coração do animal já não é bater e não responde quando tocado no olho. </li><li> Pulverização exterior de rato sacrificados com etanol a 70%. </li><li> Lugar do mouse em uma placa de necropsia e prenda com alfinetes de dissecação. Use a tesoura umd pinças para abrir o mouse e remover órgãos. Determinar que os órgãos devem ser coletados é o projeto dependente. No entanto, recomenda-se sempre coletar o baço e do fígado, como esses órgãos muitas vezes, dar uma visão importante porque o mouse estava moribunda. Também recolher o esterno para a análise de potencial de medula óssea. Além disso, é sempre vantajoso para recolher qualquer órgão ou tecido que aparece anormal. </li><li> Tecidos e tumores que são coletados deve ser dividido em quatro seções. Uma secção é fixado em formalina tamponada a 10% durante 18 horas seguido de 70% de etanol. Esta secção pode ser usada para coloração de H &amp; E e / ou IHC. Os restantes três secções, as quais são geralmente 50 a 100 mg de tamanho, são de encaixe congelados em azoto líquido. Estes podem ser usados ​​para DNA, RNA e isolada de proteínas. </li><li> Dispor de tecidos da carcaça e restante de acordo com as diretrizes IACUC. </li></ol> 3. Isolar o ADN genómico a partir de tumores <table border="1"><tbody><tr><td> &lt;&gt; Nome forte do reagente </td><td> Companhia </td><td> Número de catálogo </td></tr><tr><td> Solução Protein Precipitation </td><td> Qiagen </td><td> 158910 </td></tr><tr><td> Tampão de lise celular </td><td> Qiagen </td><td> 158906 </td></tr><tr><td> Proteinase K </td><td> Qiagen </td><td> 158920 </td></tr><tr><td> RNase A </td><td> Qiagen </td><td> 158924 </td></tr><tr><td> Tampão TE </td><td> Promega </td><td> V6232 </td></tr></tbody></table> Reagentes Tabela 2. Necessário. <ol><li> Finamente tritura a amostra de tumor congeladas (50 a 100 mg), utilizando uma lâmina de barbear limpa. </li><li> Colocar o tecido triturado em um tubo de microcentrífuga de 1,5 ml e adicionar 1 ml de tampão de lise de células, contendo 5 ul de solução de proteinase K (20 mg / ml). </li><li> Vortex completamente. </li><li> Incubar em 55 ° C Agitador ajustado a 250 rpm durante pelo menos 4 horas, de preferência durante a noite. </li><li> Adicionar 1 ml de RNase A solução (10 mg / ml) e inverter o tubo 25 vezes. </li><li> Incubar a 37 ° C durante 30 min. </li><li> Arrefecer até à temperatura ambiente, colocando em gelo durante 3 min. </li><li> Adicionar 333 ul solução de precipitação de proteínas e vortex vigorosamente. </li><li> Centrifugar a 14.000 rpm 10 min. As proteínas devem pellet. Se é muito pequeno pellet de vórtice, de novo, incubadas em gelo durante 5 min, e em seguida, re-centrífuga. </li><li> Decantar o sobrenadante contendo ADN num tubo limpo de centrífuga de 15 ml. </li><li> Adicionar um volume igual de isopropanol a 100% e misturar suavemente por inversão 50 vezes. </li><li> Centrifugar a 3500 rpm durante 3 min. </li><li> Elimine o sobrenadante. </li><li> Adicionar 1 ml de etanol a 70% e inverter tubo várias vezes para lavar o sedimento. </li><li> Transferir o sedimento lavado juntamente com o etanol, para um tubo de microcentrífuga de 1,5 ml. </li><li> Centrifugar a 14.000 rpm durante 5 min a 4 ° C. </li><li> Verter o etanol e inverter o tubo de ar seco (cerca de 5 a 30 min). </li><li> Ressuspender DNA pEllet em 50 a 500 ul de TE, dependendo do tamanho do DNA de ressuspensão. </li><li> Incubação opcional a 37 ° C para voltar a suspender o DNA. </li><li> Armazenar a 4 ° C, ou -20 ° C para armazenamento a longo prazo. </li></ol> 4. Linker Mediada por PCR usando DNA genômico de Tumores <table border="1"><tbody><tr><td> Nome do reagente </td><td> Companhia </td><td> Número de catálogo </td></tr><tr><td> BfaI </td><td> New England Biolabs </td><td> R0568S </td></tr><tr><td> NlaIII </td><td> New England Biolabs </td><td> R0125S </td></tr><tr><td> MinElute placas de 96 poços </td><td> Qiagen </td><td> 28051 </td></tr><tr><td> QIAvac colector de vácuo 96 </td><td> Qiagen </td><td> 19504 </td></tr><tr><td> Multi-microplaca Genie, 120V </td><td> Scientific Industries, Inc. </td><td> SI-4000 </td></tr><tr><td> DNA-ligase de T4 com tampão de ligação 5x </td><td> Invitrogen </td><html><td> 15224-041 </td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td></tr><tr><td> 25 mM de dNTPs </td><td> Bioexpress </td><td> C-5014-200 </td></tr><tr><td> Taq Platinum </td><td> Invitrogen </td><td> 10966-034 </td></tr><tr><td> FastStart DNA polimerase Taq </td><td> Roche </td><td> 12032929001 </td></tr><tr><td> Agarose </td><td> Promega </td><td> V3121 </td></tr><tr><td> Tampão TAE </td><td> Promega </td><td> V4271 </td></tr><tr><td> Tampão TE </td><td> Promega </td><td> V6232 </td></tr><tr><td> O brometo de etídio </td><td> Promega </td><td> H5041 </td></tr></tbody></table> Reagentes Tabela 3. Necessário. Seqüências Linker BfaI linker + 5 &#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3&#39; BfaI vinculador-5 &#39;Phos-TAGTCCCTTAAGCGGAG 3&#39;NH2 &quot;&gt; Linker NlaIII + 5&#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 &#39; NlaIII linker-5 &#39;-Phos GTCCCTTAAGCGGAGCC 3&#39; Seqüências de primers Primária PCR frente lado direito (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC Primária PCR frente do lado esquerdo (BfaI): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC Reversa PCR primário para o lado direita e esquerda: SPL Link1 um GTAATACGACTCACTATAGGGC PCR secundário lateral direito para a frente: Exemplo de um iniciador de código de barras Illumina secundário 5 &#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (A de N representa o código de barras 12 bp, a sequência em letras maiúsculas são necessários para a plataforma Illumina, e a sequência em letras minúsculas se ligará ao transposão.) PCR secundário frente do lado esquerdo: Exemplo de um código de barras secon Illuminainiciador dary 5&#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (A de N representa o código de barras 12 bp, a sequência em letras maiúsculas são necessários para a plataforma Illumina, e a sequência em letras minúsculas se ligará ao transposão.) Reversa PCR secundário para o lado direita e esquerda: primer aninhada vinculador reverso 5 &#39;CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC <ol><li> Hibridar a + e - ligantes para ambos os ligantes e linkers BfaI NlaII pela mistura de 50 ul de linker + (100 uM) com 50 ul de linker (100 uM) e adicionar 2 ul de NaCl (5 M), num tubo de microcentrífuga de 1,5 ml. Lugar no bloco de aquecimento de 95 ° C durante 5 min. Desligue o bloco de aquecimento e deixar arrefecer lentamente até à temperatura ambiente (isto demora uma hora ou mais). Após o arrefecimento, os ligantes recozido pode ser armazenado num congelador a -20 ° C até ser necessário. </li><li> Preparar duas alíquotas do ADN do tumor, cada um contendo alíquotas de 1 ug de DNA. Uma alíquota será digerido witha enzima de restrição que vai cortar perto do fim &quot;direito&quot; do transposon. A segunda alíquota será digerido com uma enzima de restrição que corta perto da extremidade &quot;esquerda&quot; do transposão. Isto é feito para maximizar as chances de ampliar cada local de inserção do transposon. </li><li> Digerir o ADN do tumor em uma alíquota usando o &quot;direito&quot; NlaII enzima lado, e digerir o ADN do tumor no outro alíquota usando o &quot;lado esquerdo&quot; do lado enzima BfaI: combinar 1 ul de enzima, 5 ul de tampão NEB 10x # 4, DNA ( 1 ug) e DDQ 2 O para um volume total de 50 ul. Digest de ADN durante a noite a 37 ° C em banho-maria ou incubadora. </li><li> Aquecer inactivar enzimas (BfaI = 80 ° C, durante 20 min, NlaIII = 65 ° C durante 20 min). </li><li> Limpar as amostras digeridas colocando as amostras em placas de 96 poços MinElute, colocar a placa no distribuidor de vácuo e de vácuo durante cerca de 15 min até poços aparência seca. </li><li> Retire a placa do colector de vácuo e inferior blot de placa de 96 poços com uma toalha de papel para remover todo o liquid </li><li> Adicionar 30 ul de DDH 2 O a cada poço e agitar num agitador orbital em conjunto elevado durante 2 minutos, ou pipetar para cima e para baixo, 20 a 40 vezes. </li><li> Transferir volume total em poços (30 ul) de MinElute placa de 96 poços em placas de 96 poços limpos. </li><li> Realizar reacções de ligação com ligantes de ADN digerido a partir do passo 4.8 e ligantes a partir do passo 4.1. Misturar 10 uL de ADN digerido, 4 uL de tampão de ligação 5x, 5,5 ul de linkers recozido (950 ug / ul), 0,5 ul de ligase de T4 (5 U / uL). </li><li> Incubar durante 4 horas a durante a noite a 16 ° C. </li><li> Aquecer inactivar a ligase de ADN de T4 a 65 ° C durante 10 min. </li><li> Limpar ligadura MinElute usando placas de 96 poços e um colector de vácuo, tal como descrito nos passos 4,5-4,6. </li><li> Ressuspender em 30 ul de H2O e transferir para uma placa de 96 limpa bem. </li><li> Realizar uma digestão do DNA segundo para destruir restante transposons concatamer. Isto é conseguido cortando o DNA de uma segunda vez usando uma enzima que corta o plasmídeo vector de ADN que foi usado para criar os ratinhos transgénicos que contêm o concatamer transposon. </li><li> Digest de DNA usando BamHI (lado esquerdo e direito): Mistura de 25 ul de DNA linker-ligado a partir do passo 4.13, 5 uL de tampão NEB 10x # 3, 0,5 ul BamHI (20 U / ul), 0,5 ul de BSA (10 mg / ml ), e 19 ul de DDH 2 O. </li><li> Digest 3-6 horas ou durante a noite a 37 ° C. </li><li> Realizar PCR primário, utilizando um iniciador específico para o transposão específico e um iniciador para o linker. Estes irão variar dependendo do que transposon e vinculador você está usando. Os iniciadores indicados na tabela acima iniciador de trabalho para o T2/Onc e T2/Onc2 transposons. </li><li> Primário PCR: 5 ul de tampão 10x, 2,0 ul de MgCl2 (50 mM), 4 uL dNTPs (2,5 nM), 1 ul de iniciador 1 (20 uM), 1 ul de iniciador 2 (20 mM), 0,25 ul de Platinum Taq (5 U / ul), 3 uL de ADN digerido com ligantes (quantidade pode variar), até 50 ul DDH 2 O. </li><li> Programa de PCR: 94 ° C por 5 min, 30 ciclos de 94 ° C durante 30 seg, 60 &amp; dpor exemplo, C durante 30 seg, 72 ° C durante 90 seg. Extensão final a 72 ° C durante 5 min. </li><li> Limpar PCR MinElute produto utilizando placas de 96 poços e um colector de vácuo, tal como descrito acima. </li><li> Ressuspender em 30 ul de H2O e transferir para uma placa de 96 limpa bem. </li><li> Fazer uma diluição 1:75 do 1 ° PCR por diluição de 2 ul de DNA a partir do passo 4,21 em 148 uL DDH 2 O </li><li> Realizar PCR secundária utilizando versões aninhados dos iniciadores que têm também a sequência necessária para a máquina GAIIx Illumina, bem como um código de barras 12 pares de bases que é único para cada amostra de tumor transformadas (ver tabela de primer acima para exemplos desses iniciadores). </li><li> Secundário PCR: 10 ul de tampão 10x com MgCl2, 8 uL dNTP (2,5 mM), 1 ul de código de barras Illumina iniciador secundário (20 uM), 1 ul Nest Illumina um iniciador secundário (20 uM), 0,25 ul FastStart Taq (5 U / uL ), 2 uL de ADN a partir de 1:75 primários de PCR diluído, até 100 ul DDH 2 O. </li><li> Programa de PCR: 94 °; C durante 2 min, 30 ciclos de 94 ° C durante 30 segundos, 53 ° C durante 45 seg, 72 ° C durante 90 seg. Extensão final a 72 ° C durante 5 min. </li><li> 45 ul de executar esta reacção de PCR num gel de agarose a 1% contendo brometo de etídio (0,5 ug / ml). Deve haver uma &quot;mancha&quot; de produtos de PCR que representam amplicons das inserções de transposões muitos diferentes no tumor (Figura 3). </li><li> Limpar restante 50 ul de produto de PCR MinElute usando placas de 96 poços e um colector de vácuo, tal como descrito acima. Lavar uma vez colocando 50 ul DDH 2 O nos poços e aspirar de novo. </li><li> Ressuspender em 30 ul de TE e transferido para uma placa de 96 limpa bem. </li><li> Determinar a concentração de ADN em cada amostra. Combinar iguais quantidades de DNA de um único tubo de microcentrífuga de 1,5 ml. Este será o da biblioteca que é sequenciado em uma única pista de um Illumina HiSeq 2000 máquina. É possível sequência de várias centenas de tumores em uma única pista de uma execução de Illumina. </li><li> Submetero único tubo que contém quantidades iguais de DNA de todos os tumores de sequenciação. Isto pode ser feito pela sua instituição ou comercialmente. </li></ol> 5. Análise de inserções de transposões <ol><li> Software para análise de transposon inserção de dados está disponível para download gratuito através do SourceForge ( <a href="http://sourceforge.net/projects/tapdancebio/" target="_blank">http://sourceforge.net/projects/tapdancebio/</a> ). O programa, chamado TapDance, requer o arquivo de seqüência a partir da plataforma Illumina e um código de barras para biblioteca de arquivo de texto mapa. </li></ol>

<ol>
	<li>Fearon, E. R., Vogelstein, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+model+for+colorectal+tumorigenesis.">A genetic model for colorectal tumorigenesis.</a> Cell. 61, 759-767 (1990).</li><li>Wood, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genomic+Landscapes+of+Human+Breast+and+Colorectal+Cancers.">The Genomic Landscapes of Human Breast and Colorectal Cancers.</a> Science. 318, 1108-1113 (2007).</li><li>Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsv&#225;k, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Reconstruction+of+Sleeping+Beauty,+a+Tc1-like+Transposon+from+Fish,+and+Its+Transposition+in+Human+Cells.">Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells.</a> Cell. 91, 501-510 (1997).</li><li>Starr, T. K., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+using+the+Sleeping+Beauty+transposon.">Cancer gene discovery using the Sleeping Beauty transposon.</a> Cell Cycle. 4, 1744-1748 (2005).</li><li>Mueller, P. R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Footprinting+of+a+Muscle+Specific+Enhancer+by+Ligation+Mediated+PCR.">In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR.</a> Science. 246, 780-786 (1989).</li><li>Bergemann, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+methods+for+finding+common+insertion+sites+and+co-occurring+common+insertion+sites+in+transposon-+and+virus-based+genetic+screens.">New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens.</a> Nucleic acids research. 40, 3822-3833 (2012).</li><li>Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Harnessing+transposons+for+cancer+gene+discovery.">Harnessing transposons for cancer gene discovery.</a> Nature Reviews Cancer. 10, 696-706 (2010).</li><li>Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+in+solid+tumours+using+transposon-based+somatic+mutagenesis+in+the+mouse.">Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse.</a> Nature. 436, 272-276 (2005).</li><li>Starr, T. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transposon-based+genetic+screen+in+mice+identifies+genes+altered+in+colorectal+cancer.">A transposon-based genetic screen in mice identifies genes altered in colorectal cancer.</a> Science. 323, 1747-1750 (2009).</li><li>Keng, V. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+transposon-based+insertional+mutagenesis+screen+for+genes+associated+with+mouse+hepatocellular+carcinoma.">A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma.</a> Nature. 27, 264-274 (2009).</li><li>Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+mutagenesis+using+a+highly+mobile+somatic+Sleeping+Beauty+transposon+system.">Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system.</a> Nature. 436, 221-226 (2005).</li></ol>

Os autores não têm nada a revelar.

Uma tela para a frente genética utilizando o sistema Sleeping Beauty transposon fornece um método para identificar mutações que causam câncer. Ao seleccionar o promotor adequado para controlar a recombinase Cre para além de quaisquer mutações de predisposição, a tela SB identificará conhecidos e novos genes de cancro candidatas. O sucesso de uma tela de SB é largamente dependente dos ratos seleccionados para criar a tela. Para o transposon, recomendamos o uso de...

<table border="1"><tbody><tr><td> Nome do reagente </td><td> Companhia </td><td> Número de catálogo </td><td> Comentários (opcional) </td></tr><tr><td> Seal-Claro Câmara de Indução </td><td> Cérebro Árvore Científico </td><td> EZ-177 </td><td></td></tr><tr><td> Criotubo </td><td> Bioexpress </td><td> C-3355-2 </td><td></td></tr><tr><td> Formol tamponado 10% </td><td> Sigma Aldrich </td><td> HT501128-4L </td><td></td></tr><tr><td> Solução Protein Precipitation </td><td> Qiagen </td><td> 158910 </td><td></td></tr><tr><td> Tampão de lise celular </td><td> Qiagen </td><td> 158906 </td><td></td></tr><tr><td> Proteinase K </td><td> Qiagen </td><td> 158920 </td><td></td></tr><tr><td> RNase A </td><td> Qiagen </td><td> 158924 </td><td></td></tr><tr><td> Tampão TE </td> &lt;td&gt; Promega </td><td> V6232 </td><td></td></tr><tr><td> BfaI </td><td> New England Biolabs </td><td> R0568S </td><td></td></tr><tr><td> NlaIII </td><td> New England Biolabs </td><td> R0125S </td><td></td></tr><tr><td> MinElute placas de 96 poços </td><td> Qiagen </td><td> 28051 </td><td></td></tr><tr><td> QIAvac colector de vácuo 96 </td><td> Qiagen </td><td> 19504 </td><td></td></tr><tr><td> Multi-microplaca Genie, 120V </td><td> Scientific Industries, Inc. </td><td> SI-4000 </td><td></td></tr><tr><td> DNA-ligase de T4 com tampão de ligação 5x </td><td> Invitrogen </td><td> 15224-041 </td><td></td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td><td></td></tr><tr><td> DNTPs 25mM </td><td> Bioexpress </td><td> C-5014-200 </td><td></td></tr><tr><td> Taq Platinum </td><td> Invitrogen </td><td&gt; 10966-034 </td><td></td></tr><tr><td> FastStart DNA polimerase Taq </td><td> Roche </td><td> 12032929001 </td><td></td></tr><tr><td> Agarose </td><td> Promega </td><td> V3121 </td><td></td></tr><tr><td> Tampão TAE </td><td> Promega </td><td> V4271 </td><td></td></tr><tr><td> Tampão TE </td><td> Promega </td><td> V6232 </td><td></td></tr><tr><td> O brometo de etídio </td><td> Promega </td><td> H5041 </td><td></td></tr></tbody></table>

identification of sleeping beauty transposon insertions in solid tumors using linker-mediated pcr

Genômica, proteômica análises, transcriptomic, e epigenômico de tumores humanos indicam que existem milhares de anomalias dentro de cada genoma do câncer em comparação com o tecido normal combinado. Com base nessas análises, é evidente que há muitos condutores não descobertas genéticas do câncer 1. Infelizmente esses drivers estão escondidos dentro de um número muito maior de anomalias de passageiros no genoma que não contribuem diretamente para a formação de tumor. Outro aspecto do genoma do cancro é que existe uma grande heterogeneidade genética considerável dentro semelhantes tipos de tumores. Cada tumor pode abrigar mutações diferentes que proporcionam uma vantagem seletiva para a formação do tumor 2. Realizando uma tela para a frente imparcial genética em ratos fornece as ferramentas para gerar tumores e analisar sua composição genética, além de reduzir o fundo de mutações de passageiros. The Sleeping Beauty (SB) sistema transposon é um tal método 3. O sistema utiliza o SB móvel vectors (transposons) que pode ser inserido por todo o genoma da enzima transposase. As mutações são limitados a um tipo de célula específico através da utilização de um alelo de transposase condicional que é activado pela recombinase Cre. Existem muitas linhas de ratinhos que expressa recombinase Cre em tecidos específicos. Ao cruzar uma dessas linhas para o alelo transposase condicional (por exemplo, pára--Lox Lox-SB11), o sistema de SB é activado apenas nas células que expressam Cre recombinase. A recombinase Cre vontade extirpar uma cassete de batente, que bloqueia a expressão do alelo de transposase, activando assim a mutagénese transposon dentro do tipo de célula designada. Uma tela de SB é iniciada por meio de cruzamento três estirpes de ratinhos transgénicos de modo a que os ratinhos experimentais portadores de um alelo transposase condicional, um concatamer de transposões, e um tecido específico de alelo recombinase Cre. Estes ratos são autorizados a idade até se formarem tumores e tornam-se moribundos. Os ratos são entãoDNA genómico necropsiados e é isolado a partir de tumores. Em seguida, o ADN genómico é submetido a linker mediada-PCR (LM-PCR), que resulta em amplificação de loci genómicos contendo um transposon SB. LM-PCR realizada sobre um único tumor vai resultar em centenas de amplicons distintas, representando as centenas de loci genómicos contendo inserções de transposões em um único tumor 4. As inserções de transposões, em todos os tumores são analisados ​​e locais de inserção comuns (CIS) são identificadas usando um método estatístico adequado 5. Genes dentro da CEI são altamente susceptíveis de ser oncogenes ou genes supressores de tumores, e são considerados genes de cancro candidatas. As vantagens de utilizar o sistema de SB para identificar genes candidatos cancerosas são: 1) o transposão pode ser facilmente localizado no genoma, porque a sua sequência é conhecida, 2) a transposição pode ser dirigido para quase qualquer tipo de célula e 3) o transposon seja capaz de introdução simultânea de ganho e perda de função-mutações 6. O following protocolo descreve a forma de conceber e realizar uma tela para a frente utilizando a genética SB sistema transposon para identificar genes candidatos cancro (Figura 1).

Após o regime de reprodução tiver sido estabelecida, os criadores devem produzir uma ninhada a cada 19-21 dias. Tamanho da ninhada pode variar entre 5 e 12 filhotes, dependendo da idade dos reprodutores e a base genética. Além disso, certifique-se de que o genótipo da ninhada segue genética mendeliana como uma forma para confirmar que o sistema de criação de animais é tanto correcta e bem sucedida. Para a experiência de ser bem sucedido, a incidência do tumor nos animais experime...

Watch this Scientific Journal Video about Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR at JoVE.com

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Um método de identificação de condutores desconhecidos da carcinogénese, utilizando uma abordagem imparcial é descrito. O método utiliza o<em&gt; A Bela Adormecida</em&gt; Transposon como um mutagéneo aleatória dirigida a tecidos específicos. Mapeamento genómico de inserções de transposões que conduzem a formação de tumores identifica novos oncogenes e genes supressores tumorais

Identificação de<em&gt; A Bela Adormecida</em&gt; Inserções de transposões em tumores sólidos utilizando Linker mediada por PCR

Genomic, proteomic, transcriptomic, and epigenomic analyses of human tumors indicate that there are thousands of anomalies within each cancer genome ...

identification-sleeping-beauty-transposon-insertions-solid-tumors

Research

JoVE Journal

Medicine

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

14.0K visualizações.  University of Minnesota, Minneapolis. Um método de identificação de condutores desconhecidos da carcinogénese, utilizando uma abordagem imparcial é descrito. O método utiliza o A Bela Adormecida Transposon como um mutagéneo aleatória dirigida a tecidos específicos. Mapeamento genómico de inserções de transposões que conduzem a formação de tumores identifica novos oncogenes e genes supressores tumorais

Vídeo: Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Establishment and Propagation of Human Retinoblastoma Tumors in Immune Deficient Mice

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited time. These cultured tumorspheres may exhibit markedly different cellular phenotypes when compared to the original tumors. Demonstration that cultured cells have the capability of forming new tumors is important to ensure that cultured cells model the biology of the original tumor. 
Here we present a protocol for propagating human retinoblastoma tumors in vivo using Rag2-/- immune deficient mice. Cultured human retinoblastoma tumorspheres of low passage or cells obtained from freshly harvested human retinoblastoma tumors injected directly into the vitreous cavity of murine eyes form tumors within 2-4 weeks. These tumors can be harvested and either further passaged into murine eyes in vivo or grown as tumorspheres in vitro. Propagation has been successfully carried out for at least three passages thus establishing a continuing source of human retinoblastoma tissue for further experimentation. 
Wesley S. Bond and Lalita Wadhwa are co-first authors.

A method is described to propagate human retinoblastoma tumors in mice. Tumor cells are directly injected into the eyes of immune deficient mice. Secondary tumors have been successfully established using both cells directly harvested from human tumors and cultured tumorspheres.

Estabelecimento e propagação de Tumores Humanos em Retinoblastoma Imune camundongos deficientes

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited ...

Medicina

Evaluation of Nanoparticle Uptake in Tumors in Real Time Using Intravital Imaging

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle uptake in tumors at the microscopic level1,2,3, highlighting the utility of a suitable xenograft model in which to perform detailed uptake analyses. Here, we use high-resolution intravital imaging to evaluate nanoparticle uptake in human tumor xenografts in a modified, shell-less chicken embryo model. The chicken embryo model is particularly well-suited for these in vivo analyses because it supports the growth of human tumors, is relatively inexpensive and does not require anesthetization or surgery 4,5. Tumor cells form fully vascularized xenografts within 7 days when implanted into the chorioallantoic membrane (CAM) 6. The resulting tumors are visualized by non-invasive real-time, high-resolution imaging that can be maintained for up to 72 hours with little impact on either the host or tumor systems. Nanoparticles with a wide range of sizes and formulations administered distal to the tumor can be visualized and quantified as they flow through the bloodstream, extravasate from leaky tumor vasculature, and accumulate at the tumor site. We describe here the analysis of nanoparticles derived from Cowpea mosaic virus (CPMV) decorated with near-infrared fluorescent dyes and/or polyethylene glycol polymers (PEG) 7, 8, 9,10,11. Upon intravenous administration, these viral nanoparticles are rapidly internalized by endothelial cells, resulting in global labeling of the vasculature both outside and within the tumor7,12. PEGylation of the viral nanoparticles increases their plasma half-life, extends their time in the circulation, and ultimately enhances their accumulation in tumors via the enhanced permeability and retention (EPR) effect 7, 10,11. The rate and extent of accumulation of nanoparticles in a tumor is measured over time using image analysis software. This technique provides a method to both visualize and quantify nanoparticle dynamics in human tumors.

We present a novel approach to quantify nanoparticle localization in the vasculature of human xenografted tumors using dynamic, real-time intravital imaging in an avian embryo model.

Avaliação de Captação de nanopartículas em tumores em tempo real usando imagens intravital

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle ...

Heterogeneity Mapping of Protein Expression in Tumors using Quantitative Immunofluorescence

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of areas of distinct differentiation into recognized histological subtypes, or different pathological grade, often there are more subtle differences in phenotype which defy accurate classification (Figure 1). Ultimately, since morphology is dictated by the underlying molecular phenotype, areas with visible differences are likely to be accompanied by differences in the expression of proteins which orchestrate cellular function and behavior, and therefore, appearance. The significance of visible and invisible (molecular) heterogeneity for prognosis is unknown, but recent evidence suggests that, at least at the genetic level, heterogeneity exists in the primary tumor1,2, and some of these sub-clones give rise to metastatic (and therefore lethal) disease. 
Moreover, some proteins are measured as biomarkers because they are the targets of therapy (for instance ER and HER2 for tamoxifen and trastuzumab (Herceptin), respectively). If these proteins show variable expression within a tumor then therapeutic responses may also be variable. The widely used histopathologic scoring schemes for immunohistochemistry either ignore, or numerically homogenize the quantification of protein expression. Similarly, in destructive techniques, where the tumor samples are homogenized (such as gene expression profiling), quantitative information can be elucidated, but spatial information is lost. Genetic heterogeneity mapping approaches in pancreatic cancer have relied either on generation of a single cell suspension3, or on macrodissection4. A recent study has used quantum dots in order to map morphologic and molecular heterogeneity in prostate cancer tissue5, providing proof of principle that morphology and molecular mapping is feasible, but falling short of quantifying the heterogeneity. Since immunohistochemistry is, at best, only semi-quantitative and subject to intra- and inter-observer bias, more sensitive and quantitative methodologies are required in order to accurately map and quantify tissue heterogeneity in situ.
We have developed and applied an experimental and statistical methodology in order to systematically quantify the heterogeneity of protein expression in whole tissue sections of tumors, based on the Automated QUantitative Analysis (AQUA) system6. Tissue sections are labeled with specific antibodies directed against cytokeratins and targets of interest, coupled to fluorophore-labeled secondary antibodies. Slides are imaged using a whole-slide fluorescence scanner. Images are subdivided into hundreds to thousands of tiles, and each tile is then assigned an AQUA score which is a measure of protein concentration within the epithelial (tumor) component of the tissue. Heatmaps are generated to represent tissue expression of the proteins and a heterogeneity score assigned, using a statistical measure of heterogeneity originally used in ecology, based on the Simpson's biodiversity index7.
To date there have been no attempts to systematically map and quantify this variability in tandem with protein expression, in histological preparations. Here, we illustrate the first use of the method applied to ER and HER2 biomarker expression in ovarian cancer. Using this method paves the way for analyzing heterogeneity as an independent variable in studies of biomarker expression in translational studies, in order to establish the significance of heterogeneity in prognosis and prediction of responses to therapy.

Here we describe a method to quantify molecular heterogeneity in histological sections of tumor material using quantitative immunofluorescence, image analysis, and a statistical measure of heterogeneity. The method is intended for use in clinical biomarker development and analysis.

Mapeamento de heterogeneidade de expressão da proteína em tumores usando imunofluorescência Quantitative

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of ...

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process including development1, apoptosis2, and cell cycle regulation3. MiRNAs are estimated to regulate the expression of 30% to 90% of human genes4 by binding to their target messenger RNAs (mRNAs)5. Widespread dysregulation of miRNAs has been reported in various diseases and cancer subtypes6. Due to their prevalence and unique structure, these small molecules are likely to be the next generation of biomarkers, therapeutic agents and/or targets.
Methods used to investigate miRNA expression include SYBR green I dye- based as well as Taqman-probe based qPCR. If miRNAs are to be effectively used in the clinical setting, it is imperative that their detection in fresh and/or archived clinical samples be accurate, reproducible, and specific. qPCR has been widely used for validating expression of miRNAs in whole genome analyses such as microarray studies7. The samples used in this protocol were from patients who underwent radical prostatectomy for clinically localized prostate cancer; however other tissues and cell lines can be substituted in. Prostate specimens were snap-frozen in liquid nitrogen after resection. Clinical variables and follow-up information for each patient were collected for subsequent analysis8.
Quantification of miRNA levels in prostate tumor samples. The main steps in qPCR analysis of tumors are: Total RNA extraction, cDNA synthesis, and detection of qPCR products using miRNA-specific primers. Total RNA, which includes mRNA, miRNA, and other small RNAs were extracted from specimens using TRIzol reagent. Qiagen's miScript System was used to synthesize cDNA and perform qPCR (Figure 1). Endogenous miRNAs are not polyadenylated, therefore during the reverse transcription process, a poly(A) polymerase polyadenylates the miRNA. The miRNA is used as a template to synthesize cDNA using oligo-dT and Reverse Transcriptase. A universal tag sequence on the 5' end of oligo-dT primers facilitates the amplification of cDNA in the PCR step. PCR product amplification is detected by the level of fluorescence emitted by SYBR Green, a dye which intercalates into double stranded DNA. Specific miRNA primers, along with a Universal Primer that binds to the universal tag sequence will amplify specific miRNA sequences. 
The miScript Primer Assays are available for over a thousand human-specific miRNAs, and hundreds of murine-specific miRNAs. Relative quantification method was used here to quantify the expression of miRNAs. To correct for variability amongst different samples, expression levels of a target miRNA is normalized to the expression levels of a reference gene. The choice of a gene on which to normalize the expression of targets is critical in relative quantification method of analysis. Examples of reference genes typically used in this capacity are the small RNAs RNU6B, RNU44, and RNU48 as they are considered to be stably expressed across most samples. In this protocol, RNU6B is used as the reference gene.

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR qPCR

Quantitative Real Time polymerase chain reaction (qPCR) is a rapid and sensitive method to investigate the expression levels of various microRNA (miRNA) molecules in tumor samples. Using this method expression of hundreds of different miRNA molecules can be amplified, quantified, and analyzed from the same cDNA template.

Detecção MicroRNA em tumores de próstata por Quantitative PCR em tempo real (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process ...

In vitro Organoid Culture of Primary Mouse Colon Tumors

Several human and murine colon cancer cell lines have been established, physiologic integrity of colon tumors such as multiple cell layers, basal-apical polarity, ability to differentiate, and anoikis are not maintained in colon cancer derived cell lines. The present study demonstrates a method for culturing primary mouse colon tumor organoids adapted from Sato T et al. 1, which retains important physiologic features of colon tumors. This method consists of mouse colon tumor tissue collection, adjacent normal colon epithelium dissociation, colon tumor cells digestion into single cells, embedding colon tumor cells into matrigel, and selective culture based on the principle that tumor cells maintain growth on limiting nutrient conditions compared to normal epithelial cells.
The primary tumor organoids if isolated from genetically modified mice provide a very useful system to assess tumor autonomous function of specific genes. Moreover, the tumor organoids are amenable to genetic manipulation by virus meditated gene delivery; therefore signaling pathways involved in the colon tumorigenesis could also be extensively investigated by overexpression or knockdown. Primary tumor organoids culture provides a physiologic relevant and feasible means to study the mechanisms and therapeutic modalities for colon tumorigenesis.

In vitro Organoid Culture of Primary Mouse Colon Tumors

A simple method to establish primary murine colon tumor organoid is described. This method utilizes the feature that colon tumor cells survive and grow into organoids in media containing limited growth factors, whereas normal colon epithelial do not.

Em organoide Cultura in vitro de primário do mouse tumores do cólon

Several  human and murine colon cancer cell lines have been established, physiologic  integrity of colon tumors such as multiple cell layers, basal-apical ...

Cerebrospinal Fluid MicroRNA Profiling Using Quantitative Real Time PCR

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their translational repression. Changes in miRNA expression have been shown to be involved in the development of all major complex diseases. Furthermore, recent findings showed that miRNAs can be secreted to the extracellular environment and enter the bloodstream and other body fluids where they can circulate with high stability. The function of such circulating miRNAs remains largely elusive, but systematic high throughput approaches, such as miRNA profiling arrays, have lead to the identification of miRNA signatures in several pathological conditions, including neurodegenerative disorders and several types of cancers. In this context, the identification of miRNA expression profile in the cerebrospinal fluid, as reported in our recent study, makes miRNAs attractive candidates for biomarker analysis.
There are several tools available for profiling microRNAs, such as microarrays, quantitative real-time PCR (qPCR), and deep sequencing. Here, we describe a sensitive method to profile microRNAs in cerebrospinal fluids by quantitative real-time PCR. We used the Exiqon microRNA ready-to-use PCR human panels I and II V2.R, which allows detection of 742 unique human microRNAs. We performed the arrays in triplicate runs and we processed and analyzed data using the GenEx Professional 5 software.
Using this protocol, we have successfully profiled microRNAs in various types of cell lines and primary cells, CSF, plasma, and formalin-fixed paraffin-embedded tissues.

We describe a protocol of real time PCR to profile microRNAs in the cerebrospinal fluid (CSF). With the exception of RNA extraction protocols, the procedure can be extended to RNA extracted from other body fluids, cultured cells, or tissue specimens.

Líquido cefalorraquidiano MicroRNA perfil usando Quantitative PCR em Tempo Real

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their ...

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent marker. Mouse models (brain tumor and arthritis) were used to evaluate the usefulness of this method. Saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles tagged with CellVue Maroon (CVM) fluorophore were administered intravenously. Animals were then placed in the rotational holder (MARS) of the in vivo imaging system. Images were acquired in 10&#176; steps over 380&#176;. A rectangular&#160;region of interest (ROI) was placed across the full image width at the model disease site. Within the ROI, and for every image, mean fluorescence intensity was computed after background subtraction. In the mouse models studied, the labeled nanovesicles were taken up in both the orthotopic and transgenic brain tumors, and in the arthritic sites (toes and ankles). Curve analysis of the multi angle image ROIs determined the angle with the highest signal. Thus, the optimal angle for imaging each disease site was characterized. The MAROI method applied to imaging of fluorescent compounds is a noninvasive, economical, and precise tool for in vivo quantitative analysis of the disease states in the described mouse models.

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo quantitation of a fluorescent marker delivered by saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles. Employing mouse models of cancer and arthritis, we demonstrate how the MAROI signal curve analysis can be used for the precise mapping and biological characterization of disease processes.

In Vivo Imagem Óptico de tumores cerebrais e artrite Usando fluorescente SAPC-DOPS nanovesículas

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent ...

Quantitative Mass Spectrometric Profiling of Cancer-cell Proteomes Derived From Liquid and Solid Tumors

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic biomarkers. However, methods for quantitative proteomic characterization of patient-derived tumors and in particular their cellular subpopulations are largely lacking. Here we describe an experimental set-up that allows quantitative analysis of proteomes of cancer cell subpopulations derived from either liquid or solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry followed by bioinformatic data analysis. To enrich specific cellular subsets, liquid tumors are first immunophenotyped by flow cytometry followed by FACS-sorting; for solid tumors, laser-capture microdissection is used to purify specific cellular subpopulations. In a second step, proteins are extracted from the purified cells and subsequently combined with a tumor-specific, SILAC-labeled spike-in standard that enables protein quantification. The resulting protein mixture is subjected to either gel electrophoresis or Filter Aided Sample Preparation (FASP) followed by tryptic digestion. Finally, tryptic peptides are analyzed using a hybrid quadrupole-orbitrap mass spectrometer, and the data obtained are processed with bioinformatic software suites including MaxQuant. By means of the workflow presented here, up to 8,000 proteins can be identified and quantified in patient-derived samples, and the resulting protein expression profiles can be compared among patients to identify diagnostic proteomic signatures or potential drug targets.

In-depth analyses of cancer cell proteomes facilitate identification of novel drug targets and diagnostic biomarkers. We describe an experimental workflow for quantitative analysis of (phospho-)proteomes in cancer cell subpopulations derived from liquid and solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry.

Quantitative Mass Spectrometric Profiling de proteomas de células do cancro da derivadas do líquido e tumores sólidos

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic ...

Spatial Measurements of Perfusion, Interstitial Fluid Pressure and Liposomes Accumulation in Solid Tumors

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and elevated IFP are linked to the heterogeneous intra-tumoral distribution of nanotechnology-based drug delivery systems such as liposomes. In the present study, the relationship between tumor microcirculation, elevated IFP, and accumulation of nanoparticles was investigated through in vivo experimentation. This was accomplished by evaluation of the tumor microcirculation using dynamic contrast enhanced computed tomography (DCE-CT) and measurement of tumor IFP using a novel image-guided robotic needle placement system connected to the micro-CT scanner. The intra-tumoral accumulation of liposomes was determined by CT image-based assessment of a nanoparticle liposomal formulation that stably encapsulate the contrast agent iohexol (CT-liposomes). CT imaging allowed for co-localization of the spatial distribution of tumor hemodynamics, IFP and CT-liposome accumulation in an individual subcutaneous xenograft mouse model of breast cancer. Measurements led to the discovery that perfusion and plasma volume fraction are strong mediators of the intra-tumoral distribution of liposomes. Furthermore, the results suggest that IFP plays an indirect role in mediating liposome distribution through modulating blood flow.

The heterogeneous intra-tumoral accumulation of liposomes has been linked to an abnormal tumor microenvironment. Herein methods are presented to measure tumor microcirculation by perfusion imaging and elevated interstitial fluid pressure (IFP) using an image-guided robotic system. Measurements are compared to the intra-tumoral accumulation of liposomes, determined using volumetric micro-CT imaging.

Medidas espaciais de Perfusão, intersticial pressão do produto e lipossomas Acumulação em tumores sólidos

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and ...

Multicolor 3D Printing of Complex Intracranial Tumors in Neurosurgery

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. The model can be used for planning and simulating critical steps of a surgical approach. Therefore, it is important that anatomical structures such as blood vessels inside a tumor can be printed to be colored not only on their surface, but throughout their whole volume. During simulation this allows for the removal of certain parts (e.g., with a high-speed drill) and revealing internally located structures of a different color. Thus, diagnostic information from various imaging modalities (e.g., CT, MRI) can be combined in a single compact and tangible object.
However, preparation and printing of such a fully colored anatomical model remains a difficult task. Therefore, a step-by-step guide is provided, demonstrating the fusion of different cross-sectional imaging data sets, segmentation of anatomical structures, and creation of a virtual model. In a second step the virtual model is printed with volumetrically colored anatomical structures using a plaster-based color 3D binder jetting technique. This method allows highly accurate reproduction of patient-specific anatomy as shown in a series of 3D-printed petrous apex chondrosarcomas. Furthermore, the models created can be cut and drilled, revealing internal structures that allow for simulation of surgical procedures.

The protocol describes the fabrication of fully colored three-dimensional prints of patient-specific, anatomical skull models to be used for surgical simulation. The crucial steps of combining different imaging modalities, image segmentation, three-dimensional model extraction, and production of the prints are explained.

Impressão 3D multicolorida de tumores intracranianos complexos na neurocirurgia

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. ...