Ce travail a été rendu possible par des subventions à JK des Centres d&#39;excellence de l&#39;Ontario et le Fonds de la recherche en Ontario. Nous tenons à remercier Siddika Pardhan et le Dr Peter Ferguson pour l&#39;assistance technique pendant le tournage.

REMARQUE: Le protocole suivant a été conçu pour une utilisation avec des cellules adhérentes. Modifications sont nécessaires pour appliquer la méthode à des cellules non-adhérentes cultivées en suspension. Les expériences CAM décrites dans le protocole sont conçus pour une utilisation avec des cellules qui expriment un marqueur fluorescent (par exemple, la GFP, RFP, etc.). Neuf jours embryons de poulet sont tenus le jour 2 du protocole expérimental pour les expériences de CAM. 1. Préparation et transfection de cellules tumorales avec oligonucléotides antisens (OLS) <ol><li> Aspirer milieu du flacon T75 (s) contenant des cellules d&#39;intérêt, laver avec 1XPBS, et ajouter 2 ml de trypsine à 0,25% / EDTA. Ajouter 10 ml de milieu de croissance complet à chaque flacon et transférer les cellules dans une solution dans un tube de 50 ml. Compter les cellules et ajuster le volume de sorte que la concentration finale est 1,0x10 5 cellules par ml. </li><li> Étiquette deux groupes de flacons T25: un groupe contiendront huit flacons étiquetés, 1-8, et seront used pour l&#39;expérience de mesure du métabolisme en temps réel; et le second groupe contient également huit flacons et sera utilisé pour l&#39;expérience de CAM d&#39;embryon de poulet. Ajouter 2 ml de solution de cellules dans chaque flacon et le placer dans l&#39;incubateur (37 ° C, 5% CO 2 O / N). </li><li> Le lendemain matin (jour 0, Temps 0), l&#39;étiquette de trois 5 ml tubes comme suit: le contrôle (non-ciblage ASO ou siRNA), «cible d&#39;intérêt» (ce est à dire, en ciblant ASO ou siRNA) et Lipofectamine 2000 (ou similaire réactif de transfection). Diluer les solutions disponibles ASO à la concentration appropriée du milieu sans sérum dans le tube approprié. <ol><li> Ajouter la quantité nécessaire de réactif de transfection au tube approprié et incuber dans un milieu exempt de sérum pendant 5 min. Ajouter la solution de réactif de transfection pour les tubes ASO et incuber pendant 20 min. </li></ol></li><li> Ajouter 250 ul de solution de réactif ASO de transfection de commande pour chacun des flacons de 1 à 4 dans chaque groupe, et 250pi de «cible d&#39;intérêt &#39;ASO solution de réactif de transfection à chacun des flacons 5-8 dans chaque groupe. Incuber pendant 4 heures (37 ᵒC, 5% CO 2). <ol><li> Pendant l&#39;incubation, effectuer les étapes décrites à la section 2.1. Après l&#39;incubation, ajouter 3 ml de milieu complet à chaque flacon dans le groupe d&#39;essai de CAM et revenir à l&#39;incubateur O / N (37 ᵒC, 5% CO 2). Traiter le groupe de l&#39;expérience du métabolisme selon la description à la section 2.2. Traiter l&#39;expérience de cames selon la description à la section 4. </li></ol></li></ol> 2. Biocapteur Chip Préparation et ensemencement cellulaire <ol><li> Dans un environnement stérile, laver soigneusement six puces de biocapteurs avec 400 pi de PBS. Stériliser les puces avec 400 ul d&#39;éthanol à 70% pendant 20 min. Laver trois fois avec 400 ul de PBS. <ol><li> Placez les puces à l&#39;intérieur de tissus stériles culture plats pour éviter la contamination. Placez trois puces dans un plat étiqueté «contrôle», et trois dans un plat étiqueté «cible d&#39;intérêt &#39;. </li></ol></li><li> Étiqueter deux tubes de 50 ml que «contrôle» et «cible d&#39;intérêt &#39;. Laver les cellules avec du PBS et ajouter un volume approprié de 0,25% de trypsine / EDTA. Attendez jusqu&#39;à ce que les détache de monocouches et de recueillir les cellules dans chaque flacon. Déposer la solution dans le tube approprié. <ol><li> Compter les cellules et ajuster le volume de sorte que la concentration finale est 6.0x10 5 cellules / ml. Centrifuger les cellules et remettre en suspension si la concentration initiale est trop faible. </li></ol></li><li> Ajouter 250 pi de la solution cellulaire pour chaque puce de biocapteur dans le groupe approprié (pour un total de 1.25x10 5 cellules par puce). Effectuez cette tâche un groupe à la fois pour minimiser le risque de confondre les puces. Placez les plats stériles contenant les puces dans une chambre d&#39;humidité pour éviter l&#39;évaporation, et placer les cha d&#39;humiditémbre dans l&#39;incubateur O / N (37 ᵒC, 5% CO 2). </li><li> Le matin suivant (jour 1), aspirer soigneusement le milieu de chaque puce et le remplacer par 250 ul de milieu de croissance supplémenté avec 0,2% de sérum bovin fœtal (FBS) et 1 x pénicilline et de streptomycine (P / S). Incuber pendant 4 heures (37 ᵒC, 5% CO 2). </li></ol> De préparation du système de mesure et de métabolisme 3. Préparation de la solution <ol><li> Durant l&#39;incubation, préparer les solutions de médicament requises et le système de mesure du métabolisme pour le dosage à venir. NOTE: Le système de mesure du métabolisme contient un total de six modules. Chaque module peut accueillir une puce par expérience. <ol><li> Subdiviser le dosage dans les groupes expérimentaux suivants: une puce de chacun des «contrôle» et «cible d&#39;intérêt&quot; groupes à recevoir véhicule pendant toute la durée de l&#39;essai; deux puces de chaque groupe pour recevoir le traitement médicamenteux pendant une période de temps définie pendant la uneéssayé, suivie de véhicule au cours de la période de lavage. </li><li> Pour les études drogues de sensibilisation, de modifier la longueur, le calendrier, et la concentration de traitement de la toxicomanie pour répondre à la drogue en question. NOTE: Pour le cisplatine, les étapes suivantes ont été déterminées empiriquement avec des cellules A549, et peut varier en fonction de la lignée cellulaire. Effectuez toutes les étapes avec le débit par défaut de 4 pi / min. 6 h de croissance à moyen + 0,2% de FBS et 1x P / S 24 h de 6 uM cisplatine en milieu + 0,2% de FBS 1x P / S 24 h de croissance à moyen + 0,2% de FBS et 1x P / S 18 h de croissance à moyen + 0,2% de FBS et 1x P / S 4 h de 0,1% de Triton X- REMARQUE: Des dérogations à ces étapes, il faudra calcul pour déterminer le volume requis de solutions à moyen et médicaments basés sur le débit souhaité et la durée de l&#39;expérience. Les sections suivantes sont basées sur les étapes décrites ci-dessus. </li></ol></li><li> Étiquette et remplir quatorze tubes de 50 ml avec 50 ml de croissance à moyen + 0,2% de FBS uned 1x P / S. Placez dans une six portoir de tubes du système de mesure du métabolisme, six dans l&#39;autre, et les deux autres dans un troisième porte-tube qui contient également des tubes avec le cisplatine. Sceller les deux premières grilles d&#39;une membrane perméable à l&#39;air pour empêcher l&#39;évaporation. </li><li> Préparer une solution de 6 uM de cisplatine (du volume approprié) dans un milieu FBS + 0,2% avec 1 x P / S. Distribuer le volume requis de solution de cisplatine marqués en quatre tubes de 50 ml. <ol><li> Placer les tubes dans les quatre places restantes dans le rack de tube de mesure troisième métabolisme. Se assurer que les tubes sont placés dans les fentes appropriées qui correspondent aux Biomodules souhaités. Sceller les tubes avec une membrane perméable à l&#39;air. </li></ol></li><li> Préparer et étiqueter six tubes de 50 ml et les remplir avec 20 ml chacune de solution à 0,1% de Triton-X dans le milieu. La solution Triton-X lyser toutes les cellules restantes et de fournir une valeur «zéro» pour chaque puce. Placer les tubes dans un rack tube quatrième unité de mesure du métabolisme et sceller l&#39;esprith une membrane permable de l&#39;air pour éviter l&#39;évaporation excessive. </li><li> Chargez les jetons dans les Biomodules et initier l&#39;expérience. </li></ol> Traitement et de drogues injectables 4. CAM Expérience REMARQUE: Les étapes et la procédure pour la préparation des embryons de poulet pour une expérience de CAM sont décrits ailleurs 19 <ol><li> Commencer le traitement de la heures après la transfection CAM expérience 48 (Jour 2). Sous-diviser le «contrôle» et «cible d&#39;intérêt&quot; des groupes en deux flacons pour véhicule, et deux pour cisplatine. Aspirer le milieu des flacons et reconstituer avec soit 3 ml de milieu frais, ou 6 uM de cisplatine. Incuber pendant 6 h (37 ᵒC, 5% de CO 2). </li><li> Aspirer le milieu, puis lavez et trypsiniser les cellules; recueillir les cellules trypsinisées en solution en quatre correctement étiquetés tubes de 15 ml. <ol><li> Centrifuger les cellules et laver trois fois avec du PBS. Remettre en suspension le culot cellulaire dans 5 ml de PBS uneD compter les cellules. </li><li> Ajuster le volume de sorte que la concentration cellulaire finale est 1,0x10 6 cellules / ml. Transférer la solution cellulaire dans étiquetés tubes de 5 ml pour l&#39;injection, et le placer sur la glace. Retourner doucement les tubes avant l&#39;injection afin de se assurer que les cellules sont bien mélangés. </li></ol></li><li> Mettez de côté un total de 24 embryons de poulet (vieilles 9 jours) pour injection (6 par groupe). Effectuer l&#39;injection en utilisant une aiguille de verre fixé à un tube flexible relié à une seringue de 1 ml. La personne effectuant l&#39;injection doit être aveugle au groupe de traitement. <ol><li> En utilisant un microscope stéréo, injecter 1,0x10 5 cellules dans un volume de 100 ul dans la circulation veineuse de la came. Utilisez, une technique de pulsation lente pour injecter la totalité du volume de cellules. Tamponnez délicatement le site d&#39;injection avec un chiffon doux lingette pour endiguer le flux de sang et d&#39;absorber tout déversement. Étiqueter chaque récipient embryonnaire suivante appropriée chaque injection. </li></ol></li><li> Confirmer la présence et Distrition de cellules fluorescentes dans le système vasculaire de la CAM après l&#39;injection par les visualiser à l&#39;aide d&#39;un microscope à fluorescence. Prenez note de tous les embryons dans lequel le nombre de cellules tumorales semble faible, ou la distribution est médiocre. </li><li> Placez les embryons de poulet dans une chambre d&#39;humidité et de les stocker dans un incubateur (37 ° C, 60% d&#39;humidité). Attendre 7-9 jours avant d&#39;énumérer foyers métastatiques. </li></ol> 5. métastatique point Enumeration <ol><li> Au cours de la période d&#39;incubation de 7-9 jours, surveiller les embryons et jetez les morts. Se assurer que la chambre d&#39;humidité reste humide pendant toute la durée de la période d&#39;incubation. </li><li> En utilisant un microscope stéréo fluorescent à grossissement 20X, balayer la totalité de la surface supérieure de la CAM d&#39;embryons dans un motif régulier, analogue à une grille. </li><li> Comptez le nombre de foyers métastatiques dans chaque champ de vision, alors comptabiliser le nombre pour un total final par embryon. Cela pour les six embryons dans chaque groupe fournira un nombre o moyennef foyers métastatiques par traitement. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

Les auteurs ne ont rien à divulguer.

En raison du coût inhérent et le risque associé à des essais cliniques, il est nécessaire de développer une meilleure et plus rigoureuse méthodologie de test pré-clinique pour évaluer adéquatement les nouveaux schémas thérapeutiques anti-cancéreuses. Techniques couramment utilisées toutes les faiblesses actuelles d&#39;exposition qui peuvent limiter leur capacité de distinguer entre cibles thérapeutiques / agents potentiellement prometteurs, et ceux qui peuvent être moins efficaces. Nous avons élaboré...

Résistance à la cible et / ou le traitement du cancer cytotoxique est un problème clinique important qui peut conduire à l&#39;échec du traitement, de la rechute acquise, et l&#39;augmentation de la mortalité des patients 1. Compte tenu du degré élevé d&#39;hétérogénéité dans la plupart des tumeurs, ce est une certitude mathématique qu&#39;une tumeur du nombre suffisamment élevé de cellules contient un sous-ensemble de cellules résistantes à des traitements simples ou combinés ciblant les voies moléculaires à laquelle ces cellules dépendent de survie de 2,3. Ces cellules tumorales peuvent être sélectionnées positivement pour pendant le traitement, conduisant à la réapparition de la maladie. Le développement de nouvelles thérapies qui ciblent simultanément différents mécanismes de survie des cellules cancéreuses, soit avant, soit après le choix du traitement à médiation, est donc d&#39;importance clinique. Un niveau élevé d&#39;instabilité du génome et la mutation dans le génome de la tumeur est une caractéristique fondamentale qui distingue les cellules cancéreuses à partir de cellules hôtes non tumorales 4. Par conséquent, un useful stratégie pour augmenter l&#39;efficacité de la chimiothérapie endommageant l&#39;ADN et d&#39;empêcher le développement de la résistance est active pour inhiber la réparation de l&#39;ADN dans les cellules tumorales 5. Ce est un champ actif de l&#39;enquête et une variété de cibles de réparation d&#39;ADN nouveaux sont à l&#39;étude dans un cadre pré-clinique. Un certain nombre de petites molécules ou des inhibiteurs à base antisens-de ces objectifs ont été élaborés et sont en cours de test 6-8. L&#39;objectif est d&#39;identifier les candidats pré-cliniques les plus prometteurs et d&#39;évaluer la sécurité et l&#39;efficacité dans les essais cliniques. Le coût élevé des essais cliniques et le risque d&#39;échec (pour une variété de raisons, y compris l&#39;évaluation pré-clinique sous-optimale) sont de formidables obstacles pour progresser dans le développement de nouvelles thérapies neuf. L&#39;utilisation de modèles appropriées et rigoureuses pré-clinique pour évaluer adéquatement nouvelles cibles thérapeutiques et médicaments candidats peut diminuer le taux d&#39;échec élevé de 10 essais cliniques </sup&gt;. Certaines méthodes précliniques couramment utilisés pour évaluer l&#39;efficacité des thérapies anticancéreuses sont les suivantes: a) mesure de la capacité à réduire la prolifération des cellules tumorales in vitro (les essais de prolifération cellulaire), b) la réduction induite par un traitement dans la capacité des cellules tumorales à colonies de culture sous forme de tissu (essais de formation de colonie), c) la réduction induite par un traitement dans des cellules tumorales activité métabolique in vitro (transformation de colorant redox), d) induction induit par le traitement d&#39;vitro la mort dans des cellules tumorales (apoptose, nécrose, autophagique, associé avec la mitose et autres) 11, et e) la réduction in vivo de la croissance ou l&#39;ablation de xénogreffes humaines et de souris induite par un traitement de 12 à 14. Une faiblesse majeure des méthodes énumérées in vitro, ce est qu&#39;aucun d&#39;entre eux fournissent évaluation en temps réel et en continu de l&#39;effet de thérapies candidats. Plutôt, ils fournissent des informations sélectionnées, seulement à des points de temps largement séparésau cours du traitement. Ces mesures ont diminué la capacité de refléter avec précision l&#39;ampleur et le calendrier des réponses des cellules tumorales. In vivo des modèles de xénogreffes de souris sont également limitées par le coût élevé, la longueur de temps pour terminer, et le risque de dosage et de traitement synchronisation sous-optimale (ordonnancement). En outre, il existe des preuves que les modèles rongeurs de xénogreffes sont des prédicteurs limitées d&#39;efficacité clinique chez l&#39;homme, par rapport à l&#39;évaluation in vitro de réponses des cellules primaires de tumeurs humaines et établies des lignées de cellules tumorales humaines à des interventions thérapeutiques candidats 15,16. Nous avons conçu un nouveau protocole de combinaison pour évaluer de nouvelles combinaisons de médicaments pré-clinique, d&#39;une manière qui répond aux faiblesses des procédures plus communs énumérés ci-dessus. A la place de la prolifération, la formation de colonies, ou de colorant redox essais de conversion, nous avons utilisé un appareil de mesure du métabolisme d&#39;analyser l&#39;adhérence cellulaire, la respiration, et l&#39;acidification en temps réelau cours de la période de traitement 17. En même temps, nous avons étudié les effets de la combinaison d&#39;un traitement in vivo par l&#39;utilisation d&#39;un embryon de poulet membrane chorio-allantoïde de modèle (CAM) de l&#39;invasion et de métastase 18,19. Nous avons utilisé ces méthodes pour évaluer la capacité d&#39;un oligonucleotide antisens (ASO) ciblage BRCA2 pour potentialiser l&#39;efficacité du cisplatine médicament chimiothérapeutique couramment utilisé.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

En raison du niveau élevé de l&#39;hétérogénéité et de mutations inhérentes dans les cancers humains, les thérapies d&#39;agents simples ou les traitements d&#39;association qui ciblent la même voie, sont susceptibles d&#39;échouer. L&#39;accent doit être mis sur l&#39;inhibition des voies qui sont responsables de la résistance intrinsèque et / ou d&#39;adaptation à la thérapie. Un champ actif de l&#39;enquête est le développement et les tests d&#39;inhibiteurs de réparation d&#39;ADN qui favorisent l&#39;action de, et empêchent la résistance à, couramment utilisé chimiothérapie et la radiothérapie. Nous avons utilisé un protocole selon l&#39;invention pour évaluer l&#39;efficacité de l&#39;inhibition de BRCA2 en tant que moyen de sensibiliser les cellules tumorales à la cisplatine préjudiciable de médicaments de l&#39;ADN. le métabolisme des cellules de la tumeur (acidification et la respiration) a été surveillé en temps réel pendant une période de 72 h à délimiter l&#39;efficacité du traitement sur une base minute par minute. En combinaison, nous avons effectué une évaluation de la fréquence métastatique utilisant une membrane chorioallantoïque d&#39;embryon de poulet (CAM) de modèle d&#39;extravasation et l&#39;invasion. Cetteprotocole répond à certaines des faiblesses des couramment utilisés in vitro et in vivo de méthodes pour évaluer de nouveaux schémas thérapeutiques du cancer. Il peut être utilisé en plus des méthodes communes telles que des tests de prolifération cellulaire, les tests de la mort cellulaire, et les études in vivo de xénogreffes de souris, de discriminer davantage parmi les cibles et agents candidats, et ne choisissez que les candidats les plus prometteurs pour la poursuite du développement.

Résultats et chiffres adaptés avec la permission de travaux publiés 22. BRCA2 inhibition induit une diminution de la respiration dans les cellules tumorales traitées au cisplatine Les cellules humaines de cancer du poumon A549 traitées avec BRCA2 ciblage ASO et le cisplatine exposé une baisse anticipée et irréversible dans la respiration, par rapport aux cellules qui ont reçu commande ASO et cisplatine seul; après 24 h de traitement ...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

Évaluation de l&#39;efficacité des médicaments contre le cancer Sensibilisation<em&gt; In Vitro</em&gt; Et<em&gt; In Vivo</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.2K vues.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Vidéo: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent until many years after removal of the primary tumor and adjuvant therapy. A likely explanation of this phenomenon is that tumor cells have seeded metastatic sites, are resistant to conventional therapies, and remain dormant for long periods of time 1-4.
The existence of dormant cancer cells at secondary sites has been described previously as quiescent solitary cells that neither proliferate nor undergo apoptosis 5-7. Moreover, these solitary cells has been shown to disseminate from the primary tumor at an early stage of disease progression 8-10 and reside growth-arrested in the patients' bone marrow, blood and lymph nodes 1,4,11. Therefore, understanding mechanisms that regulate dormancy or the switch to a proliferative state is critical for discovering novel targets and interventions to prevent disease recurrence. However, unraveling the mechanisms regulating the switch from tumor dormancy to metastatic growth has been hampered by the lack of available model systems.
in vivo and ex vivo model systems to study metastatic progression of tumor cells have been described previously 1,12-14. However these model systems have not provided in real time and in a high throughput manner mechanistic insights into what triggers the emergence of solitary dormant tumor cells to proliferate as metastatic disease. We have recently developed a 3D in vitro system to model the in vivo growth characteristics of cells that exhibit either dormant (D2.OR, MCF7, K7M2-AS.46) or proliferative (D2A1, MDA-MB-231, K7M2) metastatic behavior in vivo . We demonstrated that tumor cells that exhibit dormancy in vivo at a metastatic site remain quiescent when cultured in a 3-dimension (3D) basement membrane extract (BME), whereas cells highly metastatic in vivo readily proliferate in 3D culture after variable, but relatively short periods of quiescence. Importantly by utilizing the 3D in vitro model system we demonstrated for the first time that the ECM composition plays an important role in regulating whether dormant tumor cells will switch to a proliferative state and have confirmed this in in vivo studies15-17. Hence, the model system described in this report provides an in vitro method to model tumor dormancy and study the transition to proliferative growth induced by the microenvironment.

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

A modified 3-D in vitro system is presented in which growth characteristics of several tumor cell lines in reconstituted basement membrane correlate with the dormant or proliferative behavior of the tumor cells at a metastatic secondary site in vivo.

Une In Vitro Système d&#39;étude dormance tumorale et le commutateur à la croissance métastatique

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

Recherche

Médecine

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional co-culture systems are frequently used to explicate tumor-stroma interactions, including their role in drug responses. However, many of the interactions that occur in vivo in the intact microenvironment cannot be completely replicated in these in vitro settings. Thus, direct visualization of these processes in real-time has become an important tool in understanding tumor responses to therapies and identifying the interactions between cancer cells and the stroma that can influence these responses. Here we provide a method for using spinning disk confocal microscopy of live, anesthetized mice to directly observe drug distribution, cancer cell responses and changes in tumor-stroma interactions following administration of systemic therapy in breast cancer models. We describe procedures for labeling different tumor components, treatment of animals for observing therapeutic responses, and the surgical procedure for exposing tumor tissues for imaging up to 40 hours. The results obtained from this protocol are time-lapse movies, in which such processes as drug infiltration, cancer cell death and stromal cell migration can be evaluated using image analysis software.

We describe a method for imaging response to anti-cancer treatment in vivo and at single cell resolution.

Vivez l&#39;imagerie des réponses de drogues dans le microenvironnement des tumeurs dans les modèles murins de cancer du sein

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these diseases. Chronic retinal diseases such as retinal oedema or neovascularization usually require multiple intraocular injections to effectively treat the condition. However, the risks associated with these injections increase with repeated delivery of the drug. Therefore, alternative delivery methods need to be established in order to minimize the risks of reinjection. Several other investigations have developed methods to deliver drugs over extended time, through materials capable of releasing chemicals slowly into the eye. In this investigation, we outline the use of Elvax 40W, a copolymer resin, to act as a vehicle for drug delivery to the adult rat retina. The resin is made and loaded with the drug. The drug-resin complex is then implanted into the vitreous cavity, where it will slowly release the drug over time. This method was tested using 2-amino-4-phosphonobutyrate (APB), a glutamate analogue that blocks the light response of the retina. It was demonstrated that the APB was slowly released from the resin, and was able to block the retinal response by 7 days after implantation. This indicates that slow-release drug delivery using this copolymer resin is effective for treating the retina, and could be used therapeutically with further testing.

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

À libération lente Drug Delivery par Elvax 40W pour le Retina Rat: Implications pour le traitement des maladies chroniques

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study model. As the use of mouse models are often a vital step in preclinical drug discovery and drug development1-8, it is necessary to design a system to introduce drugs into mice in a uniform, reproducible manner. Ideally, the system should permit the collection of blood samples at regular intervals over a set time course. The ability to measure drug concentrations by mass-spectrometry, has allowed investigators to follow the changes in plasma drug levels over time in individual mice1, 9, 10. In this study, paclitaxel was introduced into transgenic mice as a continuous arterial infusion over three hours, while blood samples were simultaneously taken by retro-orbital bleeds at set time points. Carotid artery infusions are a potential alternative to jugular vein infusions, when factors such as mammary tumors or other obstructions make jugular infusions impractical. Using this technique, paclitaxel concentrations in plasma and tissue achieved similar levels as compared to jugular infusion. In this tutorial, we will demonstrate how to successfully catheterize the carotid artery by preparing an optimized catheter for the individual mouse model, then show how to insert and secure the catheter into the mouse carotid artery, thread the end of the catheter out through the back of the mouse&#8217;s neck, and hook the mouse to a pump to deliver a controlled rate of drug influx. Multiple low volume retro-orbital bleeds allow for analysis of plasma drug concentrations over time.

This method was developed with the goal of delivering a steady drug solution via the carotid artery, to assess the pharmacokinetics of novel drugs in mouse models.

Infusions de l&#39;artère carotide pour pharmacocinétiques et pharmacodynamiques Analyse des taxanes chez la souris

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of women are alive 5 years after diagnosis. The omentum is a preferred site of HGSC metastasis formation. Despite the clinical importance of this microenvironment, the contribution of omental adipose tissue to ovarian cancer progression remains understudied. Omental adipose is unusual in that it contains structures known as milky spots, which are comprised of B, T, and NK cells, macrophages, and progenitor cells surrounding dense nests of vasculature. Milky spots play a key role in the physiologic functions of the omentum, which are required for peritoneal homeostasis. We have shown that milky spots also promote ovarian cancer metastatic colonization of peritoneal adipose, a key step in the development of peritoneal metastases. Here we describe the approaches we developed to evaluate and quantify milky spots in peritoneal adipose and study their functional contribution to ovarian cancer cell metastatic colonization of omental tissues both in vivo and ex vivo. These approaches are generalizable to additional mouse models and cell lines, thus enabling the study of ovarian cancer metastasis formation from initial localization of cells to milky spot structures to the development of widespread peritoneal metastases.

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

We outline a protocol that implements both in vivo and ex vivo approaches to study ovarian cancer colonization of peritoneal adipose tissues, particularly the omentum. Furthermore, we present a protocol to quantitate and analyze immune cell-structures in the omentum known as milky spots, which promote metastases of peritoneal adipose.

Dans vivo et ex vivo approches pour étudier Cancer de l&#39;ovaire métastatique colonisation de Lactée spot Structures en péritonéale adipeux

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Etudier le cancer du pancréas Stem Cell Caractéristiques pour le développement de nouvelles stratégies de traitement

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic patient tumors in different assays1. Human tumor xenografts represent the gold standard with respect to tumor biology, drug discovery, and metastasis research 2-4. Tumor xenografts can be derived from different types of material like tumor cell lines, tumor tissue from primary patient tumors4 or serially transplanted tumors. When propagated in vivo, xenografted tissue is infiltrated and vascularized by cells of mouse origin. Multiple factors such as the tumor entity, the origin of xenografted material, growth rate and region of transplantation influence the composition and the amount of mouse cells present in tumor xenografts. However, even when these factors are kept constant, the degree of mouse cell contamination is highly variable.
Contaminating mouse cells significantly impair downstream analyses of human tumor xenografts. As mouse fibroblasts show high plating efficacies and proliferation rates, they tend to overgrow cultures of human tumor cells, especially slowly proliferating subpopulations. Mouse cell derived DNA, mRNA, and protein components can bias downstream gene expression analysis, next-generation sequencing, as well as proteome analysis 5. To overcome these limitations, we have developed a fast and easy method to isolate untouched human tumor cells from xenografted tumor tissue. This procedure is based on the comprehensive depletion of cells of mouse origin by combining automated tissue dissociation with the benchtop tissue dissociator and magnetic cell sorting. Here, we demonstrate that human target cells can be can be obtained with purities higher than 96% within less than 20 min independent of the tumor type.

Human tumor xenografts are vascularized and infiltrated by cells of mouse origin during the growth phase in vivo. To circumvent the bias caused by these contaminating cells during downstream analysis, we developed a method allowing for comprehensive depletion of all mouse cells by magnetic cell sorting.

Appauvrissement des cellules de souris de xénogreffes de tumeurs humaines améliore de manière significative l&#39;analyse en aval des cellules cibles

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Forskoline induite par Gonflement dans Intestinal organites: Un<em&gt; In vitro</em&gt; Essai pour évaluer la réponse des médicaments dans les patients atteints de fibrose kystique

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

Analyse optimisée des<em&gt; In Vivo</em&gt; et<em&gt; In vitro</em&gt; Stéatose hépatique

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the body, an additional extraction procedure is commonly required to release the active constituents from raw herbs. Water decoction is a classical extraction procedure that is still broadly used in the clinical settings. Here, we propose a detailed protocol for er-xian decoction (EXD) in order to apply herbal decoctions to experimental studies. The calculation of an animal-appropriate dose is described, as well as the four main steps of EXD: soaking, water decoction, filtration, and concentration. In addition, serum-containing EXD is introduced to rats as a means of in vitro validation. Here, rats were orally administered EXD for three days. Blood samples were then collected, inactivated, centrifuged, and filtered. The serum, diluted with the culture medium, can be utilized to treat cells or tissues in vitro. For example, EXD was applied to both in vivo and in vitro studies and demonstrated that EXD enhances osteogenesis. This protocol can be used as a reference for the preparation and application of herbal medicines.

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Here, we present the preparation of an er-xian decoction (EXD) in four steps&#8212;soaking, decoction, filtration, and concentration&#8212;and demonstrate the administration of a prepared EXD-containing serum to rats. These methods are applicable to the in vivo and in vitro study of herbal decoctions such as traditional Chinese medicines.

Préparation de la phytothérapie: la décoction Er-Xian et le sérum contenant de l&#39;er-Xian pour<em&gt; In vivo</em&gt; Et<em&gt; In Vitro</em&gt; Expériences

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the ...