The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.

1. Préparation modèle NOTE: Toute matrice d&#39;ADN génomique soupçonné de contenir de l&#39;ADN dérivé de l&#39;un des sept espèces d&#39;Eimeria qui infectent les poulets peut être utilisé comme matrice à base de LAMP-identification de l&#39;espèce Eimeria. Des échantillons de tissus intestinaux pour l&#39;analyse de diagnostic sur le terrain doivent être recueillies pendant post-mortem de routine comme décrit ici. <ol><li> Choisir l&#39;article (ou les articles) de l&#39;intestin à tester. Voir le tableau 1 pour un guide à la sélection du site de l&#39;échantillon et les espèces Eimeria les plus susceptibles d&#39;être présents 18 et Figure 1 pour l&#39;aire de répartition et l&#39;emplacement des sites d&#39;échantillonnage spécifiques à l&#39;espèce. NOTE: Ce est d&#39;une importance capitale depuis Eimeria sont notamment site hôte spécifique. Chaque espèce qui infecte des poulets est défini par la région intestinale qu&#39;il cible 19. La décision peut être influencée par l&#39;expérience précédente de la ferme, l&#39;intérêt pour un ou more espèces Eimeria spécifiques ou d&#39;autres indicateurs de diagnostic 6. </li><li> Accise 5 cm ou plus grandes longueurs de la section intestinal (s) sélectionné pour tester Eimeria l&#39;aide de ciseaux ou d&#39;un scalpel stérile. Eventuellement, stocker les échantillons pour une analyse ultérieure dans un fixateur tel que par exemple dans le RNAlater 18 ou 95% d&#39;éthanol. NOTE: Si le stockage dans de l&#39;éthanol, l&#39;échantillon doit être soigneusement lavés à l&#39;acide tris-éthylènediaminetétraacétique stérile (TE) tampon avant de les utiliser. </li><li> Couper l&#39;échantillon ouverte longitudinalement, retirer contenus les plus intestinales (si présente) et gratter les cellules de la couche de muqueuse gratuitement en utilisant soit le bord d&#39;une lame de microscope en verre stérile ou une lame de ciseaux éthanol / flamme stérilisé. Eventuellement pour un échantillon groupé inclure les cellules de tous les quatre des sites intestinales spécifiques à l&#39;espèce dans un seul tube. </li><li> Mettez le matériau raclé dans un tube de centrifugation de 1,5 ml vis-top stérile contenant tampon TE stérile 100 pi y compris une0% (p / v) de résine Chelex 100. </li><li> Agiter chaque échantillon vigoureusement pendant 1 min. Assurez-vous que le haut de la vis est bien fermé, puis incuber dans un bain d&#39;eau bouillante pendant 10 min. </li><li> Après avoir fait bouillir permettre à chaque échantillon à refroidir à la température ambiante pendant 1 à 2 min. </li><li> Centrifugeuse chaque échantillon en utilisant une microcentrifugeuse à vitesse de pointe (par exemple, ~ 10 000 xg) pendant 1 min. </li><li> Recueillir 2 pi du surnageant résultant d&#39;être modèle dans chaque test LAMP à entreprendre. Eventuellement, en commun plus d&#39;un site intestinale dans un seul tube pour fournir un dosage multi-site. </li></ol> 2. Eimeria LAMP Primer Préparation (pré-test) <ol><li> Préparer Eimeria LAMP stocks amorces adéquates pour 100 dosages: <ol><li> Reconstituer chaque amorce Eimeria LAMP lyophilisée par addition d&#39;eau moléculaire de qualité à une concentration de 100 uM (comme spécifié par le fabricant). Si non spécifié, calculer le volume d&#39;eau nécessaire pour la biologie moléculaire using les Les poids physiques et moléculaires de chaque amorce. </li><li> Pipette 60 pi d&#39;eau de la biologie moléculaire dans un 0,5 ml flip-top microtube distinct pour chaque espèce Eimeria à doser. </li><li> Ajouter amorces FIP, BIP, F3, B3, LF et LB spécifique de l&#39;espèce Eimeria cibles à l&#39;eau en utilisant les volumes indiqués dans le tableau 2, la création d&#39;une série de mélanges d&#39;amorces spécifiques sept espèces. </li><li> Brièvement vortex mélanger la solution d&#39;apprêt, puis impulsion microcentrifugeuse et congeler jusqu&#39;à utilisation. </li></ol></li><li> Préparer un mélange maître de réaction de LAMP pour chaque espèce Eimeria à tester. Multipliez les volumes sont indiqués dans le tableau 3 par le nombre d&#39;échantillons et ajouter trois à un contrôle positif, le contrôle négatif et pipetage rechange. Pipette, dans un 0,5 ou 1,5 ml flip-top microtube. </li></ol> 3. Eimeria LAMP Assay <ol><li> Espèces spécifiques ADN polymérase Bst / LAMP pipette 23 ul Eimeria Mastermix dans un 0.5 ml de tube à centrifuger. </li><li> Ajouter matrice d&#39;ADN de 2 pi (préparé à l&#39;article 1), soit un volume de réaction final de 25 ul. </li><li> Ajouter ADN génomique 2 pl Eimeria espèces spécifiques à une réaction (contrôle positif). Ajouter de l&#39;eau pour la biologie moléculaire 2 pi à la réaction (contrôle négatif). NOTE: Si l&#39;ADN génomique spécifique de l&#39;espèce ne est pas disponible LAMP précédente positif ou un produit PCR standard peuvent être utilisés à la place. </li><li> Incuber dans un bain d&#39;eau ou d&#39;un bloc thermique à 62 ° C pendant 30 min. Eventuellement, de réactiver la polymérase Bst ADN par chauffage à 80 ° C pendant 10 min si la réaction ne est pas va être lu immédiatement. </li></ol> 4. LAMP Lire test-out <ol><li> À la fin de l&#39;incubation d&#39;évaluer la couleur de chaque réaction à l&#39;œil sous la lumière intérieure. Les résultats négatifs sont en rose au violet en couleurs, des résultats positifs apparaissent ciel bleu 20. </li><li> Eventuellement, confirmer le résultat d&#39;analyse de LAMP dans un laboratory en mélangeant le produit réactionnel d&#39;LAMP 5 ul avec une pi de tampon de gel de l&#39;ADN de chargement pour l&#39;électrophorèse sur gel d&#39;agarose en utilisant un gel d&#39;agarose à 2% dans 1 x Tris / Borate / EDTA (TBE), pré-colorées en utilisant un colorant d&#39;acide nucléique (5 ul par 50 ml d&#39;agarose). Ajouter 5 ul d&#39;une moléculaire échelle d&#39;ADN de taille 1Kb à la piste 1 du gel pour permettre le calcul de la taille des fragments. </li></ol>

<ol>
	<li>Chapman, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+selective+review+of+advances+in+coccidiosis+research.">A selective review of advances in coccidiosis research.</a> Adv Parasitol. 83, 93-171 (2013).</li><li>Shirley, M. W., Smith, A. L., Tomley, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+avian+Eimeria+with+an+emphasis+on+their+control+by+vaccination.">The biology of avian Eimeria with an emphasis on their control by vaccination.</a> Adv Parasitol. 60, 285-330 (2005).</li><li>Fornace, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Occurrence+of+Eimeria+species+parasites+on+small-scale+commercial+chicken+farms+in+Africa+and+indication+of+economic+profitability.">Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability.</a> PLoS ONE. 8 (12), e84254 (2013).</li><li>Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+analysis+of+Eimeria+spp.+populations+in+relation+to+performance+levels+of+broiler+chicken+farms+in+Arkansas+and+North+Carolina.">Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina.</a> J Parasitol. 95 (4), 871-880 (2009).</li><li>Peek, H. W., Landman, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coccidiosis+in+poultry:+anticoccidial+products,+vaccines+and+other+prevention+strategies.">Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies.</a> Vet Q. 31 (3), 143-161 (2011).</li><li>Johnson, J., Reid, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anticoccidial+drugs:+lesion+scoring+techniques+in+battery+and+floor-pen+experiments+with+chickens.">Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens.</a> Exp Parasitol. 28 (1), 30-36 (1970).</li><li>Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+survey+of+the+economic+impact+of+subclinical+Eimeria+infections+in+broiler+chickens+in+Norway.">A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway.</a> Avian Pathol. 37 (3), 333-341 (2008).</li><li>Procunier, J., Fernando, M., Barta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+and+strain+differentiation+of+Eimeria+spp.+of+the+domestic+fowl+using+DNA+polymorphisms+amplified+by+arbitrary+primers.">Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers.</a> Parasitology Research. 79 (2), 98-102 (1993).</li><li>Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+diagnostic+PCR+assay+for+the+detection+and+discrimination+of+four+pathogenic+Eimeria+species+of+the+chicken.">Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken.</a> Avian Pathol. 27 (5), 490-497 (1998).</li><li>Vrba, V., Blake, D. P., Poplstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+real-time+PCR+assays+for+detection+and+quantification+of+all+seven+Eimeria+species+that+infect+the+chicken.">Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken.</a> Vet Parasitol. 174 (3-4), 183-190 (2010).</li><li>Morris, G. M., Gasser, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotechnological+advances+in+the+diagnosis+of+avian+coccidiosis+and+the+analysis+of+genetic+variation+in+Eimeria.">Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria.</a> Biotechnol Adv. 24 (6), 590-603 (2006).</li><li>Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Investing in animal health research to alleviate poverty. , (2002).</li><li>Nagamine, K., Hase, T., Notomi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accelerated+reaction+by+loop-mediated+isothermal+amplification+using+loop+primers).">Accelerated reaction by loop-mediated isothermal amplification using loop primers).</a> Mol Cell Probes. 16 (3), 223-229 (2002).</li><li>Notomi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+of+DNA.">Loop-mediated isothermal amplification of DNA.</a> Nucleic Acids Res. 28 (12), E63 (2000).</li><li>Kaneko, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+enterotoxigenic+Clostridium+perfringens+in+meat+samples+by+using+molecular+methods.">Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.</a> Appl Environ Microbiol. 77 (21), 7526-7532 (2011).</li><li>Karanis, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+preliminary+evaluation+of+a+loop-mediated+isothermal+amplification+procedure+for+sensitive+detection+of+cryptosporidium+oocysts+in+fecal+and+water+samples.">Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples.</a> Appl Environ Microbiol. 73 (17), 5660-5662 (2007).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+Infectious+bursal+disease+virus+by+reverse+transcription+loop-mediated+isothermal+amplification+assay.">Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay.</a> J Vet Diagn Invest. 21 (6), 841-843 (2009).</li><li>Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+(LAMP)+assays+for+the+species-specific+detection+of+Eimeria+that+infect+chickens.">Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.</a> BMC Vet Res. 7 (1), 67 (2011).</li><li>Long, P., Joyner, L., Millard, B., Norton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+laboratory+techniques+used+in+the+study+and+diagnosis+of+avian+coccidiosis.">A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis.</a> Folia Veterinaria Latina. 6 (3), 201-217 (1976).</li><li>Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colorimetric+detection+of+loop-mediated+isothermal+amplification+reaction+by+using+hydroxy+naphthol+blue.">Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.</a> BioTechniques. 46 (3), 167-172 (2009).</li><li>Arakawa, A., Baba, E., Fukata, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+tenella+infection+enhances+Salmonella+typhimurium+infection+in+chickens.">Eimeria tenella infection enhances Salmonella typhimurium infection in chickens.</a> Poult Sci. 60 (10), 2203-2209 (1981).</li><li>Blake, D. P., Smith, A. L., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplified+fragment+length+polymorphism+analyses+of+Eimeria+spp.:+an+improved+process+for+genetic+studies+of+recombinant+parasites.">Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites.</a> Parasitol Res. 90 (6), 473-475 (2003).</li><li>Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Campylobacter+spp.+in+chicken+fecal+samples+by+real-time+PCR.">Detection of Campylobacter spp. in chicken fecal samples by real-time PCR.</a> J Clin Microbiol. 42 (11), 5125-5132 (2004).</li><li>Raj, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR-based+quantification+of+Eimeria+genomes:+a+method+to+outweigh+underestimation+of+genome+numbers+due+to+PCR+inhibition.">Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition.</a> Avian Pathol. 42 (4), 304-308 (2013).</li><li>Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+maxima:+the+influence+of+host+genotype+on+parasite+reproduction+as+revealed+by+quantitative+real-time+PCR.">Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR.</a> Int J Parasitol. 36 (1), 97-105 (2006).</li><li>Beck, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+approaches+to+diversity+of+populations+of+apicomplexan+parasites.">Molecular approaches to diversity of populations of apicomplexan parasites.</a> Int J Parasitol. 39 (2), 175-189 (2009).</li></ol>

The authors declare that they have no competing financial interests.

The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~&#163;0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment. 
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25. 
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.

La production de poulet mondial a été multiplié par dix au cours des dernières 50 années avec le monde en développement qui accueillent près de quatre fois l&#39;expansion assisté dans le monde développé <a href="http://www.faostat.org">(www.faostat.org)</a> . Comme la pertinence de la production de poulet à la sécurité alimentaire mondiale a augmenté de façon trop a le profil d&#39;agents pathogènes qui peuvent causer une maladie grave chez les poulets. Un excellent exemple est l&#39;espèce Eimeria, protozoaires parasites omniprésents qui peuvent causer la maladie entérique une coccidiose. Partout où les poulets sont élevés une ou plusieurs espèces d&#39;Eimeria sont susceptibles d&#39;être commune 2-4. Dans le monde développé Eimeria sont principalement contrôlée par la chimioprophylaxie, employant programmes de navette ou de rotation pour minimiser l&#39;impact de la résistance 5. Les vaccins vivants sont également utilisés dans les systèmes où la valeur des oiseaux est suffisant pour justifier le coût (par exemple, les animaux reproducteurs, des couches et des poulets de chair 5). En resull de ces mesures coccidiose clinique est souvent bien contrôlé, bien que l&#39;infection sous-clinique est commune 5. Dans le monde en développement de la vaccination est rare et la demande de drogues souvent moins bien informé. En conséquence coccidiose sous-clinique et clinique est plus fréquente et exerce un impact économique significatif 3. Diagnostic de l&#39;infection eimerian a toujours compté sur lésion totalisant post-mortem, bien que même les auteurs de le système de notation plus largement utilisé remarquer que pour certaines espèces &quot;il semble douteux qu&#39;une telle procédure devrait être tentée dans tout mais modérément sévères infections&quot; 6. Preuve supplémentaire peut être recueillie grâce à la détection au microscope au stade résistant à l&#39;environnement du cycle de vie des oocystes dans des échantillons fécaux ou litière, bien que se chevauchant morphologie peut confondre tous, mais l&#39;expert 6,7. Alternatives moléculaires utilisant la réaction en chaîne par polymérase (PCR), amplificatio aléatoiren de l&#39;ADN polymorphe PCR (RAPD-PCR) et des technologies de PCR quantitative ont été disponibles pour un maximum de 20 années 8-10, mais à ce jour ils ne ont pas réussi à devenir populaire. Coût relatif et l&#39;exigence de l&#39;équipement de laboratoire spécialiste ou traitement ont limité leur adoption, en dépit de la nature souvent subjective et techniquement exigeante de la pathology- plus âgés et les approches basées sur la microscopie-10,11. Ces limitations peuvent être exagérées dans la plupart des régions les plus pauvres du monde comme l&#39;Asie du Sud-Est, où l&#39;impact de la coccidiose sur la pauvreté peut être proportionnellement plus 12. En réponse il ya une demande claire pour des tests de diagnostic, nouvelle Eimeria espèces spécifiques simple et sensible, mais rentable. Boucle amplification isotherme facilitée (LAMP) est une technique facile à préparer entraînée par polymérase-ADN qui est capable d&#39;amplifier de grandes quantités d&#39;ADN. Plus important encore, LAMP utilise un polymera Bst ADNSE au lieu de l&#39;ADN polymerase Taq utilisée dans la PCR, ce qui facilite l&#39;amplification d&#39;ADN à une température constante sans la seule exigence pour le cyclage thermique 13,14. LAMP peut se prêter à l&#39;application même dans le laboratoire le plus rudimentaires ou dans le domaine. Caractérisée par la résistance par rapport à de nombreux inhibiteurs de la PCR, haute sensibilité et spécificité, des tests de LAMP ont été élaborés pour un large éventail d&#39;agents pathogènes y compris le virus de la maladie de Gumboro, Clostridium perfringens et Cryptosporidium 15-17. En réponse à la demande pour de nouveaux diagnostics Eimeria rentables espèces spécifiques d&#39;un panel de tests LAMP spécifiques à chacune des sept espèces d&#39;Eimeria qui infectent les poulets a été développé 18. Applications pour les nouveaux tests comprennent la surveillance parasite occurrence, d&#39;une valeur particulière donnée l&#39;association d&#39;espèces telles que Eimeria maxima ou Eimeria necatrix avec une mauvaise pe économiquerformance 3,4. D&#39;autres applications comprennent l&#39;évaluation de l&#39;efficacité de la stratégie anticoccidienne d&#39;une ferme, le diagnostic de l&#39;infection sous-clinique ou clinique de la maladie et l&#39;évaluation des risques posés par Eimeria à une ferme.

<table border="0" cellpadding="0" cellspacing="0" width="889">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Name</td>
			<td style="width:161px;">Company</td>
			<td style="width:139px;">Catalogue number</td>
			<td style="width:295px;">Comments</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNAlater</td>
			<td style="width:161px;">Ambion</td>
			<td style="width:139px;">AM7024</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ethanol</td>
			<td style="width:161px;">VWR Chemicals</td>
			<td style="width:139px;">20821.321</td>
			<td style="width:295px;">Caution, highly flammable</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">100 x Tris-EDTA (TE) buffer concentrate</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">T9285</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Chelex 100 resin</td>
			<td style="width:161px;">Bio-Rad</td>
			<td style="width:139px;">142-1253</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Molecular grade water</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">10977035</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTAACATTTCGCTTCACGGAC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATGAGCAAGTGGAACACCTTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TAAGGTTACACCCGTGGAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCATGCACAAAGCGACTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GGCCATCAAGTTCCATGAGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCAACCTCCTGAGTGTGGTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAACGCTCGAACATGGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CTTCTCCACAGACCCAGAGGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACTACGGAAAAGTGCGTAGCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTTCCTCCCTTCTGAAAACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAGTCACTGCTGATGTACCAAA 
			AG-GAACTATGCCGCTTTCCCCTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CAAGCCTACGCGGACATC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TTATGCAGCTGGGTCAACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACGATAGCCAAGACACGTAAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCCCGTGATAAGAGTAGGAACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCGGGTCGTGAGATTTAAATT 
			AT-GGAAGATCAGGACGGGCACT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTCAGTTGATGAACAAGCGA 
			GA-TGCGCCTCTAGAATCAAGACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCCATGCATCCCCTTGTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGTGGGCACAGATTGATTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TGGCTTTCCCGCGTACC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGGCCCAACACAAAGACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCTTGAGTTTTAAGCTATGCA 
			CA-GACCCAAGCAGCTCACCAA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCTGTAACTTGGGACGTTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAACAGCCGGAGCCTCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCCTTGTATGTTGCTGTTTCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCGCACGAATCTGAATCACAC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATCTCCTCAAAGACTTTCGCGT 
			A-GCGCTTGGCTATATCCATAGG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAATAGCATTGCCAGGTGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCCACTGTCATTAATATTGC 
			TGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTTGTGAAGGTCAGCGTG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTGAGTCCATACGTACTTCCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCACTGCTATGGAAAGTCAC 
			AC-CATAACTGGCATGCAGGGGT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTGGCCCGAAAGTTGTGAA 
			GA-CGTCAGAAATTGCTGCCCAAT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCATGTGCAGTTGAAGACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCAAATGTATCTGCTAGTTATA 
			TTAACAAG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x ThermoPol reaction buffer</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">B9004S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:295px;">MgSO4</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">M7506</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">dNTPs</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">U1330</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Betaine solution (5 M)</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">B0300</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Bst polymerase</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">M0275S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Hydroxynaphthol blue</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">33936</td>
			<td style="width:295px;">Dissolved in molecular grade water.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">UltraPure agarose</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">16500-500</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x Tris/Borate/EDTA (TBE) buffer</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">AM9863</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Blue/Orange DNA loading dye (x6)</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">G1881</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">GeneRuler 1Kb DNA ladder</td>
			<td style="width:161px;">Thermo Scientific</td>
			<td style="width:139px;">SM0313</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SafeView nucleic acid stain</td>
			<td style="width:161px;">NBS Biologicals</td>
			<td style="width:139px;">NBS-SV</td>
			<td style="width:295px;"></td>
		</tr>
	</tbody>
</table>

loop-mediated isothermal amplification (lamp) assays for the species-specific detection of eimeria that infect chickens

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm&#8217;s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

la validation de la Assay Lors de la validation de chaque test LAMP spécifique de l&#39;espèce Eimeria été testé en utilisant un panel d&#39;échantillons d&#39;ADN pur représentant les sept espèces d&#39;Eimeria qui infectent le poulet, ainsi que l&#39;ADN génomique de poulet comme un contrôle hôte. Une électrophorèse sur gel d&#39;agarose a été utilisée pour chaque essai et résoudre démontré absolue spécificité d&#39;espèce hôte sans réactivité croisée 18. Ensuite, une fois dix séries de dilution en série préparé en utilisant Eimeria tenella purifié l&#39;ADN génomique a révélé une limite de sensibilité du dosage comprise entre un et dix copies de génome 18. Aucune limite supérieure a été déterminée avec des résultats positifs obtenus jusqu&#39;à et y compris la plus forte concentration (100 000 copies du génome) 18. Application aux échantillons de terrain Les échantillons prélevés pour les tests Eimeria sont susceptibles d&#39;être dérivé de poulets trouvés morts, abattus à la suite de pplancher santé ou abattus pour la surveillance de la santé sentinelle, indiquant une taille de l&#39;échantillon susceptible d&#39;entre un et trois lorsqu&#39;une partie d&#39;une routine. Test de trois oiseaux prélevés dans une ferme de poulets de chair US dans le cadre d&#39;un programme de surveillance a donné trois séries d&#39;échantillons intestinaux. Application des spécifiques aux espèces LAMP essais ciblée, la priorité des sites intestinaux préférés pour chaque espèce Eimeria (tableau 1), a permis l&#39;identification visuelle de l&#39;infection eimerian chez tous les oiseaux testés en utilisant hydroxynaphthol bleu comme un indicateur (figure 2A). La couleur obtenue avec une réaction LAMP négative lors de l&#39;utilisation du bleu de hydroxynaphthol peut varier du violet au rose, mais est toujours distinct du bleu réalisé par un résultat positif. Confirmation par électrophorèse sur gel d&#39;agarose a donné des résultats comparables (figure 2B). Lors de l&#39;application sur le terrain, l&#39;utilisateur peut choisir d&#39;appliquer le plein écran contre tous les sept espèces, ou cibler uniquement les espèces prioritaires queimportante ou connue circulant sur la ferme ou dans les environs. L&#39;échec des approches basées sur la PCR de se établir en tant que diagnostic de l&#39;apparition de Eimeria souligne l&#39;exigence de simplicité dans tout nouveau test. Alors que LAMP propose une préparation simple et le traitement que la PCR, l&#39;obligation de tester plusieurs sites intestinaux par oiseau reste décourageant. La production d&#39;un seul échantillon d&#39;ADN groupé par oiseau, qui peut ensuite être testé avec un ou plusieurs tests de lampe, est susceptible d&#39;être plus attrayant. Traitement d&#39;un échantillon regroupé par oiseau, la matière recueillie à partir de chacun des sites intestinaux spécifiques décrites dans le tableau 1 et regroupées avant la préparation de l&#39;ADN, pour l&#39;essai avec l&#39;ensemble des sept essais de LAMP représentant à condition que le même résultat que lorsque chaque site intestinal a été générée séparément (figure 2 par rapport à la figure 3). <img alt="Figure 1" src=&quot;/files/ftp_upload/52552/52552fig1.jpg&quot; /&gt; Figure 1. intestinaux sites d&#39;échantillonnage pour la détection de LAMP de Eimeria parasites des espèces qui infectent les poulets. Les régions intestinales ciblées par chaque espèce Eimeria est mis en évidence par les lignes colorées, avec les sites préférés d&#39;échantillonnage indiquée par le nombre entre les lignes noires pointillées (E. acervulina: jaune / 1, E. brunetti: rose / 2, E. maxima: bleu / 3, E. mitis: orange / 4, E. necatrix: rouge / 5, E. praecox: vert / 6 et E. tenella: gris / 7). <a href="https://www.jove.com/files/ftp_upload/52552/52552fig1large.jpg" target="_blank">Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <img alt="Figure 2" src="/files/ftp_upload/52552/52552fig2.jpg" /> Figure 2. LAMP diagnostic de l&#39;infection vient eimerianm trois poulets de chair commerciaux. réactions LAMP résolus en utilisant (A) hydroxynaphthol bleu, où une réaction bleu ciel était positif et un violet au rose réaction était négative, et électrophorèse sur gel (B) d&#39;agarose. Les sites de l&#39;intestin de l&#39;échantillon étaient présentés dans le tableau 1 pour chaque espèce de parasite. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. Mitis, N = E. necatrix, E. P = praecox et E. T = tenella. Lane 1 contenait l&#39;échelle GeneRuler ADN 1Kb. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig2large.jpg" target="_blank">Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <img alt="Figure 3" src="/files/ftp_upload/52552/52552fig3.jpg" /> Figure 3. LAMP diagnostic de l&#39;infection en utilisant eimerian réac LAMP rassemblé des échantillons de trois poulets de chair commerciaux distincts.tions résolu en utilisant bleu hydroxynaphthol, où une réaction bleu ciel était positive et violet au rose réaction était négative. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. Mitis, N = E. necatrix, E. P = praecox et E. T = tenella. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig3large.jpg" target="_blank">Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> site de l&#39;échantillon </td><td> Eimeria dosage des espèces (le plus probable) </td></tr><tr><td> Duodénum (D) </td><td> E. acervulina, E. praecox </td></tr><tr><td> Jéjunum / iléon * (J / I) </td><td> E. maxima, E. necatrix </td></tr><tr><td> Caecum (C) </td><td> E. necatrix, E. tenella </td></tr><tr><td> Iléon terminal (TI) </td><td> E. brunetti, E. mitis </td></tr&gt; <tr><td> Échantillon groupé (P) </td><td> E. acervulina, E. brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella </td></tr></tbody></table> Tableau 1. intestinale sélection spécifique à la région du candidat Eimeria essais d&#39;espèces. Le choix de la région à échantillonner varie pour chaque espèce Eimeria comme illustré sur la figure 1. Échantillons communs comprennent matériel recueilli des quatre sites spécifiques qui ont ensuite été combinés pour la préparation d&#39;ADN. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Primer * </td><td> concentration en Stock (M) </td><td> Volume (pi) </td></tr><tr><td> Eau </td><td> - </td><td> 60 </td></tr><tr><td> Amorce interne avancée (FIP) </td><td> 100 </td><td> 40 </td></tr><tr><td> Pri arrière intérieuremer (BIP) </td><td> 100 </td><td> 40 </td></tr><tr><td> Primer externe avancée (F3) </td><td> 100 </td><td> 10 </td></tr><tr><td> Primer extérieur vers l&#39;arrière (B3) </td><td> 100 </td><td> 10 </td></tr><tr><td> Boucle avant (LF) </td><td> 100 </td><td> 20 </td></tr><tr><td> Boucle arrière (LB) </td><td> 100 </td><td> 20 </td></tr><tr><td> Total </td><td></td><td> 200 </td></tr></tbody></table> Tableau 2. Préparation d&#39;un prémélange LAMP primaire. Les composants et les proportions nécessaires pour préparer un prémélange amorce pour LAMP. Les volumes sont présentés pour 100 réactions LAMP. * Identités Primer comme indiqué dans les matériaux et Barkway et al (2011) 18. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> Stock conc n </td><td> Réaction final n conc </td><td> Volume par réaction (ul) </td></tr><tr><td> DDW </td><td> - </td><td> - </td><td> 10,1 </td></tr><tr><td> Tampon Thermopol </td><td> 10 x </td><td> X 1 </td><td> 2,5 </td></tr><tr><td> MgSO 4 </td><td> 100 mM </td><td> 2 mM </td><td> 0,5 </td></tr><tr><td> Mélange Primer * </td><td colspan="2"> Tableau 2 </td><td> 2,5 </td></tr><tr><td> dNTP </td><td> 25 mM </td><td> 400 uM </td><td> 0,4 </td></tr><tr><td> Bétaïne </td><td> 5 M </td><td> M 1 </td><td> 5 </td></tr><tr><td> Hydroxynaphthol bleu </td><td> 3 mM </td><td> 120 pM </td><td> 1 </td></tr><tr><td> L&#39;ADN polymerase de Bst </td><td> 8000 U / ml </td><td> 8 U </td><td> 1 </td></tr><tr><td> Total </td><td></td><td></td><td> 23 </td></tr></tbody></table> Tableau 3. Préparation d&#39;un LAMMastermix P de réaction. * Eimeria spécifique à l&#39;espèce.

Watch this Scientific Journal Video about Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens at JoVE.com

Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

amplification isotherme (LAMP) Essais de boucle médiation pour la détection des espèces spécifiques de<em&gt; Eimeria</em&gt; Qui infectent les poulets

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the ...

loop-mediated-isothermal-amplification-lamp-assays-for-species

Research

JoVE Journal

Immunology and Infection

Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

26.8K vues.  Royal Veterinary College, London. Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Vidéo: Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

Combinaison de adhésif à base de bandes d&#39;échantillonnage et de fluorescence In situ</emHybridation> pour la détection rapide des Salmonella Sur les produits frais

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

Recherche

Immunologie et infection

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART). 
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20. 
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.

Quantifying levels of HIV-1 RNA in plasma and sequencing single HIV-1 genomes from individuals with viral loads below the limit of detection (50-75 copies/ml) is difficult. Here we describe how to extract and quantify plasma viral RNA using a real time PCR assay that reliably measures HIV-1 RNA down to 0.3 copies/ml and how to amplify viral genomes by single genome sequencing, from samples with very low viral loads.

Amplifier et quantifier l&#39;ARN VIH-1 chez les individus infectés par le VIH ayant une charge virale sous le seuil de détection par Standard tests cliniques

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

Les tests pour l&#39;identification de nouveaux antiviraux contre la fièvre catarrhale Virus

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense against gram-negative bacterium Salmonella typhimurium. Salmonella establishes persistent infection in the intestine of C. elegans and results in early death of infected animals. A number of immunity mechanisms have been identified in C. elegans to defend against Salmonella infections. Autophagy, an evolutionarily conserved lysosomal degradation pathway, has been shown to limit the Salmonella replication in C. elegans and in mammals. Here, a protocol is described to infect C. elegans with Salmonella typhimurium, in which the worms are exposed to Salmonella for a limited time, similar to Salmonella infection in humans. Salmonella infection significantly shortens the lifespan of C. elegans. Using the essential autophagy gene bec-1 as an example, we combined this infection method with C. elegans RNAi feeding approach and showed this protocol can be used to examine the function of C. elegans host genes in defense against Salmonella infection. Since C. elegans whole genome RNAi libraries are available, this protocol makes it possible to comprehensively screen for C. elegans genes that protect against Salmonella and other intestinal pathogens using genome-wide RNAi libraries.

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

C. elegans has emerged as a new genetic model to study host-pathogen interactions. Here we describe a protocol to infect C. elegans with Salmonella typhimurium coupled with the double-strand RNAi interference technique to examine the role of host genes in defense against Salmonella infection.

Un protocole d&#39;infecter<em&gt; Caenorhabditis elegans</em&gt; Avec<em&gt; Salmonella typhimurium</em

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

Early Viral entrée dosages pour l&#39;identification et l&#39;évaluation des composés antiviraux

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods to screen for target enzymes prior to investing greater research effort and resources. The goal of this protocol is to demonstrate two complementary assays for conducting these initial evaluations. The microslide diffusion assay provides an initial or simple detection screen to enable the qualitative and rapid assessment of proteolytic activity against an array of both viable and heat-killed bacterial target substrates. As a counterpart, the increased sensitivity and reproducibility of the dye-release assay provides a quantitative platform for evaluating and comparing environmental influences affecting the hydrolytic activity of protein antimicrobials. The ability to label specific heat-killed cell culture substrates with Remazol brilliant blue R dye expands this capability to tailor the dye-release assay to characterize enzymatic activity of interest.

Here, we present protocols to rapidly screen and characterize enzymes for antimicrobial activity. The microslide diffusion assay and the dye-release assay utilize target bacterial substrates for qualitative and quantitative enzymatic activity evaluation.

Les analyses qualitatives et quantitatives pour la détection et la caractérisation des antimicrobiens en protéines

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples. PCR requires specialized equipment and extensive end user training, and therefore, it is not suitable for routine work especially in a resource-constrained area. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of C. burnetii in patient samples. This method is performed at a single temperature around 60 &#176;C in a water bath or heating block. The sensitivity of this LAMP assay is very similar to PCR with a detection limit of about 25 copies per reaction. This report describes the preparation of the reaction using lyophilized reagents and visualization of results using hydroxynaphthol blue (HNB) or a UV lamp with fluorescent intercalating dye in the reaction. The LAMP reagents were lyophilized and stored at room temperature (RT) for one month without loss of detection sensitivity. This LAMP assay is particularly robust because the reaction mixture preparation does not involve complex steps. This method is ideal for use in resource-limited settings where Q fever is endemic.

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

We described here a simple loop-mediated isothermal amplification (LAMP) method using lyophilized reagents for the detection of C. burnetii in patient samples.

Le développement de lyophilisé boucle médiées isothermes Amplification Réactifs pour la détection des<em&gt; Coxiella burnetii</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Assays for Studying the Role of Vitronectin in Bacterial Adhesion and Serum Resistance

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin acquisition at the bacterial cell surface plays in resistance to the host immune system. Flow cytometry experiments identified human plasma vitronectin as a ligand for the bacterial receptor outer membrane protein H of Haemophilus influenzae type f. An enzyme-linked immunosorbent assay was employed to characterize the protein-protein interactions between purified recombinant protein H and vitronectin, and binding affinity was assessed using bio-layer interferometry. The biological importance of the binding of vitronectin to protein H at the bacterial cell surface in evasion of the host immune response was confirmed using a serum resistance assay with normal and vitronectin-depleted human serum. The importance of vitronectin in bacterial adherence was analyzed using glass slides with and without vitronectin coating, followed by Gram staining. Finally, bacterial adhesion to human alveolar epithelial cell monolayers was investigated. The protocols described here can be easily adapted to the study of any bacterial species of interest.

This report describes protocols for characterizing interactions between bacterial outer membrane proteins and the human complement regulator vitronectin. The protocols can be used to study the binding reactions and biological function of vitronectin in any bacterial species.

Dosages pour étudier le rôle de la vitronectine dans adhésion bactérienne et la résistance au sérum

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin ...

Detection of Antibodies That Neutralize the Cellular Uptake of Enzyme Replacement Therapies with a Cell-based Assay

The administration of enzyme replacement therapies (ERTs) and other biologic therapies to patients may elicit an anti-drug immune response. The characterization of these anti-drug antibodies (ADA), especially those that may neutralize the biological activity of the drug, termed neutralizing antibodies (NAbs), is crucial in understanding the effects of these antibodies on the drug&#39;s pharmacological profile. This protocol describes a cell-based flow cytometry method to detect factors that neutralize the cellular uptake of a representative lysosomal ERT in human matrix. The protocol consists of three procedures: screening, a confirmatory step, and titer assays to detect, identify, and establish the relative level of neutralizing antibody titer in subject samples.
In this method, samples are first mixed with the fluorophore-conjugated ERT product, then incubated with cells [e.g., human T lymphocytes (Jurkat cells)] that express a cell-surface cation-independent mannose 6-phosphate receptor (CI-M6PR), and finally, analyzed with a flow cytometer. A sample without NAbs will result in the uptake of the fluorophore-conjugated ERT product via CI-M6PR, whereas, the presence of NAbs will bind to the drug and interfere with the CI-M6PR binding and uptake. The amount of the fluorophore-conjugated ERT internalized by the Jurkat cells is measured by flow cytometry and evaluated as the percentage (%) signal inhibition compared to the response obtained in the presence of a representative drug-na&#239;ve matrix. In the confirmatory step, the samples are pre-incubated with ERT-conjugated magnetic beads to deplete drug-specific factors that bind to the drug (such as NAbs) prior to an incubation with cells. Samples that screen and confirm positive for drug-specific NAbs in the assay are then serially diluted to generate an antibody titer. Semi-quantitative antibody titers may be correlated with measurements of drug safety and efficacy.

Here we present a cell-based flow cytometry method to detect neutralizing antibodies or other factors that interfere with the cellular uptake of enzyme replacement therapies in a human matrix, such as cerebral spinal fluid (CSF) or human serum.

Détection des anticorps qui neutralisent l’assimilation de thérapies de remplacement de Enzyme avec un Cell-based Assay

The administration of enzyme replacement therapies (ERTs) and other biologic therapies to patients may elicit an anti-drug immune response. The ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

Une plate-forme haut débit pour la détection de Salmonella spp /Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...