Ce travail a été soutenu par les Instituts nationaux de la santé (DP1CA174426 à Carlos F. Barbas) et l&#39;Université ShanghaiTech, Shanghai, Chine (à JL). Graphiques moléculaires ont été générés en utilisant PyMol.

1. Clonage <ol><li> Obtenir deux doigts domaines ZIF substitution alanine qui ont été sous-clonés dans le système de vecteur d&#39;expression pET-28 et sont disponibles sur demande (PET-2F-ZiF). 34 </li><li> Amplifier par PCR à partir du plasmide EmGFP Emerald-pBAD avec les amorces 5 &#39;Xmal-EmGFP (5&#39;-CCCGGG GGAAATTG ATGGTGAGCAAGGGCGAGGAGCTGTTCAC-3&#39;; Xmal place en gras) et 3 &#39;Sacl-EmGFP (5&#39;-CGGATCT TTACTTGTACAGCTCGTCCATGCCGAG GAGCTC-3&#39; ; Sac I site en gras). <ol><li> Utilisez 5 ng d&#39;ADN matrice, 10 ul de tampon 10X de la polymérase, une unités (U) de Taq ADN polymerase, 0,2 mM de chaque dNTP et 0,2 uM de chaque amorce dans une solution de 100 pi avec le volume restant constitué d&#39;eau distillée / désionisée . Utiliser les conditions de cyclisme: 95 ° C pendant 5 min; 30 cycles de 95 ° C pendant 30 sec, 55 ° C pendant 30 sec et 72 ° C pendant 1 min; 72 ° C pendant 10 min. Purifier le produit PCR par gel extractiet à déterminer la concentration d&#39;ADN en utilisant un spectrophotomètre mesurant Abs 260 x 50 ug / ml. </li></ol></li><li> Digest pET-2F-ZiF et l&#39;insert codant EmGFP avec les enzymes de restriction Xmal et Sac I dans le tampon recommandé pendant 3 heures à 37 ° C en utilisant 10 U d&#39;enzyme par 1 ug d&#39;ADN. Visualiser l&#39;ADN par électrophorèse sur gel d&#39;agarose en utilisant un colorant d&#39;intercalation fluorescent, tel que le bromure d&#39;éthidium. </li><li> Purifier l&#39;ADN digéré par le kit d&#39;extraction sur gel et déterminer la concentration d&#39;ADN par un spectrophotomètre mesurant Abs 260 x 50 ug / ml. </li><li> Ligaturer l&#39;ADN codant EmGFP purifié dans 50 à 100 ng de pET-2F-ZiF en utilisant 1 U de T4 DNA Ligase pendant au moins 1 h à température ambiante. Pour de meilleurs résultats, effectuer la réaction de ligature en utilisant un rapport de 6: 1 insert-à-vecteur molaire. </li><li> Thaw 50 pi de toute cellules XL-1 coli Bleu Escherichia chimiquement compétentes sur la glace et mélanger doucement avec 10-20 ng d&#39;ligaturé pET-2F-ZiF-EmGFP. </li><li> Gardez sur la glace pendant 30 min. choc thermique le mélange à 42 ° C pendant 90 secondes et récupérer les cellules dans 2 ml de bouillon de Super optimale avec la répression catabolique (SOC) pendant 1 heure à 37 ° C avec agitation. </li><li> Étaler 100 pi de la culture de récupération sur un bouillon de lysogénie (LB) plaque de gélose avec 50 ug / ml de kanamycine et incuber O / N à 37 ° C. </li><li> Le lendemain, inoculer 6 ml de Super Broth (SB) ou à la culture LB contenant 50 pg / ml de kanamycine avec une colonie de la plaque de gélose LB et la culture O / N à 37 ° C. Remarque: colonie PCR en utilisant les amorces 5 &#39;Xmal-EmGFP et 3&#39; Sacl-EmGFP pourrait être utilisée pour identifier des clones positifs avant Miniprep. </li><li> Purifier pET-2F-ZiF-EmGFP par miniprep et confirmer plasmide par séquençage d&#39;ADN en utilisant le promoteur T7 (5&#39;-TAATACGACTCACTATAGGG-3 &#39;). </li></ol> 2. Expression et purification <ol><li> Décongeler 50 pi de chimiquement compétente BL21 E. coli cellules sur la glace et mélanger doucement avec 100 ng de PET-2F-ZiF-EmGFP plasmid. Transformez comme décrit dans les étapes 1.7 à 1.8. </li><li> Le lendemain, inoculer 10 ml de milieu LB contenant 50 ug / ml de kanamycine avec une colonie unique et faire croître O / N à 37 ° C avec agitation par secousses. </li><li> Le jour suivant, les diluer 10 ml de culture O / N dans 1 L de milieu LB additionné de 50 pg / ml de kanamycine, 0,2% de glucose et 100 uM ZnCl2. Cultiver la culture à 37 ° C avec agitation par secousses à une densité optique à 600 nm (DO600) de 0,8 et induire l&#39;expression de la protéine avec 2 mM d&#39;isopropyl-β-D-1-thiogalactopyranoside (IPTG). Après 6 heures de croissance à 37 ° C, les cellules de récolte par centrifugation à 5000 xg pendant 10 min à 4 ° C. Nota: conditions d&#39;induction sont très variables et dépendent de la stabilité des protéines est exprimé. Surveiller la DO 600 toutes les 30 minutes jusqu&#39;à ce qu&#39;une DO 600 de 0,8 soit atteint. </li><li> Remettre en suspension le culot cellulaire dans 5 ml de tampon de lyse (50 mM Tris-HCl, 500 mM de NaCl, 100 uM de ZnCl2, 1 mM dithiothréitol (DTT), 1 mM de MgCl2, 1 mM de fluorure de phénylméthylsulfonyle (PMSF) et de l&#39;imidazole 10 mM, pH 8,0). Lyse des cellules sur la glace par ultrasons avec le réglage suivant: sortie de puissance de 50%, 4 min temps de processus avec 5 sec sur / 10 sec éteint intervalles. Éviter la surchauffe de la solution. </li><li> Centrifuger le lysat cellulaire à 25 000 xg pendant 30 min à 4 ° C et transférer le surnageant dans un nouveau tube de collecte. Pour de meilleurs résultats, effectuer toutes les étapes suivantes à 4 ° C. </li><li> Exécuter le surnageant à travers une colonne pré-garnie de 1 ml d&#39;une suspension équilibrée de Ni-NTA. Laver la résine avec 20 ml de tampon de lavage (50 mM de Tris-HCl, 500 mM de NaCl, 100 uM de ZnCl2, 1 mM de DTT, 1 mM MgCl 2 et 30 mM d&#39;imidazole, pH 8,0). </li><li> Eluer la protéine avec 5 ml de tampon d&#39;élution (50 mM de Tris-HCl, 500 mM de NaCl, 100 uM de ZnCl2, 1 mM de DTT, 1 mM de MgCl2, et 300 mM d&#39;imidazole, pH 8,0). </li><li> Tampon échanger la protéine est éluée avec un tampon de stockage (50 mMTris-HCl, 500 mM de NaCl, 100 uM de ZnCl2, 1 mM de DTT, 1 mM de MgCl2 et 10% de glycerol, pH 8,0) et on concentre la protéine à au moins 40 uM en utilisant un concentreur centrifuge par centrifugation selon les instructions du fabricant. </li><li> Déterminer la concentration de protéines par BCA ou dosage de Bradford. Mélanger 2 ul de protéines purifiées avec 2 pi 2 × SDS-PAGE colorant de charge, faire bouillir à 95 ° C pendant 10 min, puis résoudre le 4% à 20% de Tris-Glycine SDS-PAGE pour évaluer la pureté de la protéine (figure 2). </li></ol> 3. Protéines de stockage <ol><li> Aliquoter la protéine concentrée, gel rapide dans l&#39;azote liquide et conserver à -80 ° C. Pour les protéines de fusion EmGFP, couvrir le tube de papier d&#39;aluminium pour protéger la protéine de la lumière. </li><li> Évitez congélation et décongélation de la solution de protéine répétée. Remarque: protéines ZiF fusionnés sont stables dans ces conditions pendant au moins un mois. Ou&gt; 4 stockage inapproprié de mois peut conduireà la précipitation des protéines ou des EmGFP photoblanchiment. </li></ol> 4. Protéines de transduction <ol><li> Maintenir des cellules HeLa dans du milieu de Eagle modifié par Dulbecco (DMEM) contenant 10% (v / v) de sérum bovin fœtal (FBS) et 1% d&#39;antibiotique-antimycotique à 37 ° C dans une atmosphère complètement humidifiée avec 5% de CO 2. Note: Les cellules des passages plus de 30 fois ne sont pas recommandés pour la protéine de transduction. </li><li> Pré-enduire une plaque à 24 puits avec 500 ul de 50 ug / ml de poly-lysine pendant 30 à 60 min à 25 ° C. cellules de semences sur une plaque de 24 puits à une densité de 2 x 10 5 cellules par puits. À 24 h après le semis, ou une fois les cellules sont entre 80% -90% de confluence, retirer les supports de chaque puits et laver avec 500 pi de DMEM sans sérum préchauffé (AFD). </li><li> Pour chaque puits, ajouter 250 pi de GDF contenant 2 uM de la protéine ZiF-EmGFP et 100 uM ZnCl 2. Incuber les cellules à 37 ° C pendant 1 heure. Remarque: ZIF domaines pénètrent dans les cellules primarily travers macropinocytose, 34 qui est un mécanisme dépendant de l&#39;énergie. Par conséquent, les cellules doivent être incubées à 37 ° C pendant une internalisation efficace de la protéine. </li><li> Retirez le support de cellules et laver trois fois avec 500 ul de calcium et sans magnésium tamponnée au phosphate salin de Dulbecco (DPBS) supplémenté avec 0,5 mg / ml d&#39;héparine. Remarque: L&#39;héparine est nécessaire pour éliminer la protéine liée à la surface qui pourraient compliquer les analyses en aval. </li><li> (Facultatif) Les traitements répétés jusqu&#39;à trois fois pour une meilleure exécution. </li><li> Isoler les cellules traitées immédiatement après l&#39;héparine lavage par digestion avec 0,05% de trypsine-EDTA à 37 ° C pendant 2 min. Remettre en suspension les cellules détachées dans 0,5 ml de DPBS supplémenté avec 1% de FBS. </li><li> Mesurer l&#39;intensité de fluorescence de chaque échantillon par cytométrie de flux en utilisant le canal 35 l&#39;isothiocyanate de fluorescéine (FITC) (figure 3). Réglez la diffusion vers l&#39;avant (FSC) et la diffusion latérale (SSC) à placer la population deintérêt à l&#39;échelle, en assurant que les populations ayant des propriétés différentes sont réglées l&#39;une de l&#39;autre. </li><li> Recueillir 10 000 événements en direct pour chaque échantillon et d&#39;analyser les données en utilisant la cytométrie en flux analyse des données logiciel. 36 Normaliser la fluorescence de cellules HeLa traitées avec ZiF-EmGFP à ces cellules traitées seulement avec GDF. </li></ol>

<ol>
	<li>Berg, A., Dowdy, S. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+transduction+domain+delivery+of+therapeutic+macromolecules.">Protein transduction domain delivery of therapeutic macromolecules.</a> Curr. Opin. Biotechnol. 22, 888-893 (2011).</li><li>Lindsay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide-mediated+cell+delivery:+application+in+protein+target+validation.">Peptide-mediated cell delivery: application in protein target validation.</a> Curr. Opin. Pharmacol. 2, 587-594 (2002).</li><li>Luo, D., Saltzman, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+DNA+delivery+systems.">Synthetic DNA delivery systems.</a> Nat. Biotechnol. 18, 33-37 (2000).</li><li>Guo, X., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+nonviral+vectors+for+gene+delivery.">Recent advances in nonviral vectors for gene delivery.</a> Acc. Chem. Res. 45, 971-979 (2012).</li><li>Thomas, C. E., Ehrhardt, A., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+problems+with+the+use+of+viral+vectors+for+gene+therapy.">Progress and problems with the use of viral vectors for gene therapy.</a> Nat. Rev. Genet. 4, 346-358 (2003).</li><li>Frankel, A. D., Pabo, C. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+uptake+of+the+tat+protein+from+human+immunodeficiency+virus.">Cellular uptake of the tat protein from human immunodeficiency virus.</a> Cell. 55, 1189-1193 (1988).</li><li>Elliott, G., O'Hare, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intercellular+trafficking+and+protein+delivery+by+a+herpesvirus+structural+protein.">Intercellular trafficking and protein delivery by a herpesvirus structural protein.</a> Cell. 88, 223-233 (1997).</li><li>Derossi, D., Joliot, A. H., Chassaing, G., Prochiantz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+third+helix+of+the+Antennapedia+homeodomain+translocates+through+biological+membranes.">The third helix of the Antennapedia homeodomain translocates through biological membranes.</a> J. Biol. Chem. 269, 10444-10450 (1994).</li><li>Smith, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimally+cationic+cell-permeable+miniature+proteins+via+alpha-helical+arginine+display.">Minimally cationic cell-permeable miniature proteins via alpha-helical arginine display.</a> J. Am. Chem. Soc. 130, 2948-2949 (2008).</li><li>Daniels, D. S., Schepartz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsically+cell-permeable+miniature+proteins+based+on+a+minimal+cationic+PPII+motif.">Intrinsically cell-permeable miniature proteins based on a minimal cationic PPII motif.</a> J. Am. Chem. Soc. 129, 14578-14579 (2007).</li><li>Karagiannis, E. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rational+design+of+a+biomimetic+cell+penetrating+peptide+library.">Rational design of a biomimetic cell penetrating peptide library.</a> ACS Nan. 7, 8616-8626 (2013).</li><li>Gao, S., Simon, M. J., Hue, C. D., Morrison, B., 3r, S., Banta, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+unusual+cell+penetrating+peptide+identified+using+a+plasmid+display-based+functional+selection+platform.">An unusual cell penetrating peptide identified using a plasmid display-based functional selection platform.</a> ACS Chem. Biol. 6, 484-491 (2011).</li><li>Fuchs, S. M., Raines, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arginine+grafting+to+endow+cell+permeability.">Arginine grafting to endow cell permeability.</a> ACS Chem. Biol. 2, 167-170 (2007).</li><li>Cronican, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+delivery+of+functional+proteins+into+mammalian+cells+in+vitro+and+in+vivo+using+a+supercharged+protein.">Potent delivery of functional proteins into mammalian cells in vitro and in vivo using a supercharged protein.</a> ACS Chem. Biol. 5, 747-752 (2010).</li><li>Panyam, J., Labhasetwar, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biodegradable+nanoparticles+for+drug+and+gene+delivery+to+cells+and+tissue.">Biodegradable nanoparticles for drug and gene delivery to cells and tissue.</a> Adv. Drug Deliv. Rev. 55, 329-347 (2003).</li><li>Zelphati, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+delivery+of+proteins+with+a+new+lipid-mediated+delivery+system.">Intracellular delivery of proteins with a new lipid-mediated delivery system.</a> J. Biol. Chem. 276, 35103-35110 (2001).</li><li>Kaczmarczyk, S. J., Sitaraman, K., Young, H. A., Hughes, S. H., Chatterjee, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+delivery+using+engineered+virus-like+particles.">Protein delivery using engineered virus-like particles.</a> Proc. Natl. Acad. Sci. U. S. A. 108, 16998-17003 (2011).</li><li>Voelkel, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+transduction+from+retroviral+Gag+precursors.">Protein transduction from retroviral Gag precursors.</a> Proc. Natl. Acad. Sci. U. S. A. 107, 7805-7810 (2010).</li><li>Sinha, V. R., Trehan, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biodegradable+microspheres+for+protein+delivery.">Biodegradable microspheres for protein delivery.</a> J. Control Release. 90, 261-280 (2003).</li><li>Liu, J., Gaj, T., Patterson, J. T., Sirk, S. J., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-penetrating+peptide-mediated+delivery+of+TALEN+proteins+via+bioconjugation+for+genome+engineering.">Cell-penetrating peptide-mediated delivery of TALEN proteins via bioconjugation for genome engineering.</a> PLoS One. 9, e85755 (2014).</li><li>Ramakrishna, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+disruption+by+cell-penetrating+peptide-mediated+delivery+of+Cas9+protein+and+guide+RNA.">Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA.</a> Genome Res. 24, 1020-1027 (2014).</li><li>Fuchs, S. M., Raines, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyarginine+as+a+multifunctional+fusion+tag.">Polyarginine as a multifunctional fusion tag.</a> Protein Sci. 14, 1538-1544 (2005).</li><li>Mai, J. C., Shen, H., Watkins, S. C., Cheng, T., Robbins, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficiency+of+protein+transduction+is+cell+type-dependent+and+is+enhanced+by+dextran+sulfate.">Efficiency of protein transduction is cell type-dependent and is enhanced by dextran sulfate.</a> J. Biol. Chem. 277, 30208-30218 (2002).</li><li>Al-Taei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+traffic+and+fate+of+protein+transduction+domains+HIV-1+TAT+peptide+and+octaarginine.+Implications+for+their+utilization+as+drug+delivery+vectors.">Intracellular traffic and fate of protein transduction domains HIV-1 TAT peptide and octaarginine. Implications for their utilization as drug delivery vectors.</a> Bioconjug. Chem. 17, 90-100 (2006).</li><li>Jones, S. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterisation+of+cell-penetrating+peptide-mediated+peptide+delivery.">Characterisation of cell-penetrating peptide-mediated peptide delivery.</a> Br. J. Pharmacol. 145, 1093-1102 (2005).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genet. 11, 636-646 (2010).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+with+zinc-finger+nucleases.">Genome engineering with zinc-finger nucleases.</a> Genetics. 188, 773-782 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F., 3rd, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Gaj, T., Guo, J., Kato, Y., Sirk, S. J., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+gene+knockout+by+direct+delivery+of+zinc-finger+nuclease+proteins.">Targeted gene knockout by direct delivery of zinc-finger nuclease proteins.</a> Nat. Methods. 9, 805-807 (2012).</li><li>Gersbach, C. A., Gaj, T., Barbas, C. F., 3rd, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+zinc+finger+proteins:+the+advent+of+targeted+gene+regulation+and+genome+modification+technologies.">Synthetic zinc finger proteins: the advent of targeted gene regulation and genome modification technologies.</a> Acc. Chem. Res. 47, 2309-2318 (2014).</li><li>Gaj, T., Gersbach, C. A., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN,+TALEN,+and+CRISPR/Cas-based+methods+for+genome+engineering.">ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Perez-Pinera, P., Ousterout, D. G., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+targeted+genome+editing.">Advances in targeted genome editing.</a> Curr. Opin. Chem. Biol. 16, 268-277 (2012).</li><li>Cronican, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+class+of+human+proteins+that+deliver+functional+proteins+into+mammalian+cells+in+vitro+and+in+vivo.">A class of human proteins that deliver functional proteins into mammalian cells in vitro and in vivo.</a> Chem. Biol. 18, 833-838 (2011).</li><li>Gaj, T., Liu, J., Anderson, K. E., Sirk, S. J., Barbas, C. F., 3rd, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+delivery+using+Cys2-His2+zinc-finger+domains.">Protein delivery using Cys2-His2 zinc-finger domains.</a> ACS Chem. Biol. 9, 1662-1667 (2014).</li><li>Radcliff, G., Jaroszeski, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basics+of+flow+cytometry.">Basics of flow cytometry.</a> Methods Mol. Biol. 91, 1-24 (1998).</li><li>Mercer, A. C., Gaj, T., Sirk, S. J., Lamb, B. M., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+endogenous+human+gene+expression+by+ligand-inducible+TALE+transcription+factors.">Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.</a> ACS Synth. Biol. 3, 723-730 (2014).</li><li>Segal, D. J., Crotty, J. W., Bhakta, M. S., Barbas, C. F., Horton, N. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+Aart,+a+designed+six-finger+zinc+finger+peptide,+bound+to+DNA.">Structure of Aart, a designed six-finger zinc finger peptide, bound to DNA.</a> J. Mol. Biol. 363, 405-421 (2006).</li></ol>

Les auteurs ne ont rien à divulguer.

Ici, un protocole étape par étape, pour la délivrance de protéines à doigt de zinc en utilisant (ZiF domaines cellulaires) perméable est présentée. Le domaine ZiF ne réduit pas l&#39;activité enzymatique de la cargaison 34 condensé; permet la production et la purification de protéines avec des rendements pratiquement identiques à celles observées avec la protéine non modifiée; et peut transporter des protéines et des enzymes dans un large éventail de types de cellules avec des rendements qui...

Très stratégies de prestation de protéines efficaces et polyvalents sont essentiels pour beaucoup la recherche fondamentale et les applications thérapeutiques. La livraison directe des protéines purifiées dans les cellules représente l&#39;une des méthodes les plus sûres et les plus faciles pour atteindre cet objectif. 1,2 Contrairement aux stratégies qui se appuient sur ​​l&#39;expression des gènes à partir d&#39;acides nucléiques, 3-5 délivrance de protéines ne pose pas de risque de mutagenèse insertionnelle, est indépendante de la transcription / machinerie de traduction cellulaire et permet pour un effet immédiat. Cependant, le manque de méthodes simples et généralisables pour doter l&#39;activité pénétrant dans les cellules sur des protéines confond régulièrement leur entrée directe dans les cellules. Les méthodes actuelles pour faciliter la délivrance de protéines intracellulaires sont basés sur l&#39;utilisation d&#39;origine naturelle ou conçus 08.06 peptides de pénétration cellulaire, 12.9 domaines de transduction suralimentés, 13,14 nanoparticules, des liposomes 15 et 16 particules pseudo-virales 17,18 </sup&gt; et les matériaux de microsphères polymères. 19 Malheureusement, plusieurs de ces approches sont entravés par de faibles taux d&#39;absorption cellulaire, 20,21 mauvaise stabilité, 22 par inadvertance spécificité de type cellulaire, 23 bas endosomales échappement propriétés 24 et la toxicité. 25 En outre, beaucoup de protéines technologies de transduction de réduire la bioactivité des protéines livrés. 14 Notre laboratoire précédemment démontré que la nucléase en doigt de zinc (ZFN) protéines - restriction endonucléases chimérique constitué d&#39;un Cys 2 -His deux doigt de zinc protéine de liaison à l&#39;ADN programmable et le domaine de clivage de l&#39;endonucléase de restriction FokI 26-28 - sont intrinsèquement Cell- perméable. 29 Cette activité pénétrant les cellules-surprenant se est révélée être une propriété intrinsèque du domaine en doigt de zinc conçu sur mesure, une plate-forme de liaison à l&#39;ADN qui a émergé comme un outil puissant pour génome ciblé eningé-, 30-32 et est considéré comme le résultat de la constellation de six résidus chargés positivement sur ​​la surface de la protéine. En effet, plusieurs protéines de liaison à l&#39;ADN, y compris c-Jun et N-DEK ont été démontré qu&#39;ils possèdent une capacité innée à traverser les membranes cellulaires. 33 Plus récemment, notre laboratoire élargi sur ces résultats et a démontré que l&#39;activité pénétrant dans les cellules du zinc doigt (ZiF) domaines pourraient être mises à profit pour la livraison de protéine intracellulaire. Fusion génétique soit des domaines de ZIF une ou deux doigts à la cargaison de protéine spécifique conduit à l&#39;absorption efficacité qui dépassaient de nombreux systèmes de livraison classiques de peptides de pénétration cellulaire. 34 Plus particulièrement, la livraison ZiF médiation n&#39;a pas compromis l&#39;activité de fret enzymatique fusionné et facilité des niveaux élevés de livraison cytosolique. Collectivement, ces résultats démontrent le potentiel du domaine ZiF pour faciliter la prestation efficace et facile de protéines, et potentiellement plus divers types de macromolécules, dans les cellules. Ici, un protocole étape par étape détaillées sur la façon de mettre en œuvre la technologie ZIF pour la distribution des protéines dans les cellules de mammifères sont présentées. Nous avons déjà construit une suite de un, deux, trois, quatre, cinq et six doigt des domaines ZIF qui ne ont pas la capacité de lier l&#39;ADN, en raison de la substitution de chacun des résidus de liaison à l&#39;ADN α-hélicoïdale, mais sont capables de délivrer des protéines dans des cellules 34 (figure 1). La production et la transduction de Emerald GFP (EmGFP) dans des cellules HeLa en utilisant un domaine ZiF deux doigt est décrite. Ce protocole est extensible à presque ne importe quelle protéine soluble capable d&#39;expression dans Escherichia coli et presque ne importe quel type de cellule de mammifère. Les résultats attendus sont fournis et des stratégies pour maximiser la performance de ce système sont également discutés.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>XmaI</td>
			<td>New England Biolabs</td>
			<td>R0180L</td>
			<td></td>
		</tr>
		<tr>
			<td>SacI</td>
			<td>New England Biolabs</td>
			<td>R0156L</td>
			<td></td>
		</tr>
		<tr>
			<td>Expand High Fidelity PCR system</td>
			<td>Roche</td>
			<td>11759078001</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>New England Biolabs</td>
			<td>N0446S</td>
			<td></td>
		</tr>
		<tr>
			<td>4-20% Tris-Glycine Mini protein gels, 1.5 mm, 10 wells</td>
			<td>Life Technologies</td>
			<td>EC6028BOX</td>
			<td></td>
		</tr>
		<tr>
			<td>2x Laemmli Sample Buffer</td>
			<td>BioRad</td>
			<td>161-0737</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>Life Technologies</td>
			<td>15224-017</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 (DE3) Competent E. coli</td>
			<td>New England Biolabs</td>
			<td>C2527I</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Thermo Scientific</td>
			<td>R0391</td>
			<td></td>
		</tr>
		<tr>
			<td>Zinc Chloride</td>
			<td>Sigma-Aldrich</td>
			<td>208086-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP906-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma-Aldrich</td>
			<td>G8270-100G</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>Fisher Scientific</td>
			<td>BP152-25</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Chloride</td>
			<td>Sigma-Aldrich</td>
			<td>S9888-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>Fisher Scientific</td>
			<td>PR-V3151&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>PMSF</td>
			<td>Thermo Scientific</td>
			<td>36978</td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA Agarose Resin</td>
			<td>QIAGEN</td>
			<td>30210</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Sigma-Aldrich</td>
			<td>G5516-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Sigma-Aldrich</td>
			<td>I5513-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra-15 Centrifugal Filter Units</td>
			<td>EMO Millipore</td>
			<td>UFC900324</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Life Technologies</td>
			<td>11966-025</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Life Technologies</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibiotic-Antimycotic&#160;</td>
			<td>Life Technologies</td>
			<td>15240-062</td>
			<td></td>
		</tr>
		<tr>
			<td>24-Well Flat Bottom Plate</td>
			<td>Sigma-Aldrich</td>
			<td>CLS3527-100EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly-Lysine</td>
			<td>Sigma-Aldrich</td>
			<td>P7280</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS, No Calcium, No Magnesium</td>
			<td>Life Technologies</td>
			<td>21600010</td>
			<td></td>
		</tr>
		<tr>
			<td>Heparan Sulfate</td>
			<td>Sigma-Aldrich</td>
			<td>H4777</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Life Technologies</td>
			<td>25300054</td>
			<td></td>
		</tr>
		<tr>
			<td>Hela cells</td>
			<td>ATCC</td>
			<td>CCL-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Nano Drop ND-1000 spectrophotometer&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit</td>
			<td>QIAGEN</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>QIAGEN</td>
			<td>28704</td>
			<td></td>
		</tr>
	</tbody>
</table>

direct protein delivery to mammalian cells using cell-permeable cys2-his2 zinc-finger domains

Due to their modularity and ability to be reprogrammed to recognize a wide range of DNA sequences, Cys2-His2 zinc-finger DNA-binding domains have emerged as useful tools for targeted genome engineering. Like many other DNA-binding proteins, zinc-fingers also possess the innate ability to cross cell membranes. We recently demonstrated that this intrinsic cell-permeability could be leveraged for intracellular protein delivery. Genetic fusion of zinc-finger motifs leads to efficient transport of protein and enzyme cargo into a broad range of mammalian cell types. Unlike other protein transduction technologies, delivery via zinc-finger domains does not inhibit enzyme activity and leads to high levels of cytosolic delivery. Here a detailed step-by-step protocol is presented for the implementation of zinc-finger technology for protein delivery into mammalian cells. Key steps for achieving high levels of intracellular zinc-finger-mediated delivery are highlighted and strategies for maximizing the performance of this system are discussed.

Deux doigts protéines de fusion ZiF-EmGFP peuvent être exprimées dans E. coli avec&gt; 95% d&#39;homogénéité et des rendements élevés (&gt; 25 mg / ml) (Figure 2). En général, un ou deux doigts protéines de fusion ZIF peuvent être produites en quantités presque identiques à celles de type sauvage protéine non modifiée. Toutefois, dans certains contextes, des protéines de fusion ZiF cinq et six doigts ne peuvent pas être produits avec des rendements suffisamment élevés pour l...

Watch this Scientific Journal Video about Direct Protein Delivery to Mammalian Cells Using Cell-permeable Cys2-His2 Zinc-finger Domains at JoVE.com

Direct Protein Delivery to Mammalian Cells Using Cell-permeable Cys2-His2 Zinc-finger Domains

Domaines à doigt de zinc sont intrinsèquement perméable cellule et capable de médier la délivrance de protéines dans une large gamme de types de cellules de mammifères. Ici, un protocole étape par étape détaillé pour la mise en œuvre de la technologie à doigt de zinc pour la livraison de protéine intracellulaire est présenté.

Protein livraison directe aux cellules de mammifères en utilisant la cellule perméable Cys<sub&gt; 2</sub&gt; -His<sub&gt; 2</sub&gt; Domaines doigt de zinc

Due to their modularity and ability to be reprogrammed to recognize a wide range of DNA sequences, Cys2-His2 zinc-finger DNA-binding domains have emerged ...

direct-protein-delivery-to-mammalian-cells-using-cell-permeable-cys2

Research

JoVE Journal

Biology

Direct Protein Delivery to Mammalian Cells Using Cell-permeable Cys2-His2 Zinc-finger Domains

9.8K vues.  The Scripps Research Institute.  Domaines à doigt de zinc sont intrinsèquement perméable cellule et capable de médier la délivrance de protéines dans une large gamme de types de cellules de mammifères. Ici, un protocole étape par étape détaillé pour la mise en œuvre de la technologie à doigt de zinc pour la livraison de protéine intracellulaire est présenté. 

Vidéo: Direct Protein Delivery to Mammalian Cells Using Cell-permeable Cys2-His2 Zinc-finger Domains

Long-term Imaging Mammalian Cells using Wide-Field Microscopy

Cellules d&#39;imagerie à long terme des mammifères en utilisant la microscopie à champ large

Recherche

Biologie

Trypsinizing and Subculturing Mammalian Cells

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in cell death. The first step in subculturing is to detach cells from the surface of the primary culture vessel by trypsinization or mechanical means. The resultant cell suspension is then subdivided, or reseeded, into fresh cultures. Secondary cultures are checked for growth and fed periodically, and may be subsequently subcultured to produce tertiary cultures. The time between passaging of cells varies with the cell line and depends on the growth rate.

As cells reach confluency, they must be subcultured or passaged. This video will demonstrate a procedure for subculturing both adherent and suspension cells.

Trypsinisation et Repiquage des cellules de mammifères

As cells reach confluency, they must be subcultured or passaged. Failure to subculture confluent cells results in reduced mitotic index and eventually in ...

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

Ingénierie cellulaire perméable protéines

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Using the GELFREE 8100 Fractionation System for Molecular Weight-Based Fractionation with Liquid Phase Recovery

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based fractionation. The system is comprised of single-use, 8-sample capacity cartridges and a benchtop GELFREE Fractionation Instrument. During separation, a constant voltage is applied between the anode and cathode reservoirs, and each protein mixture is electrophoretically driven from a loading chamber into a specially designed gel column gel. Proteins are concentrated into a tight band in a stacking gel, and separated based on their respective electrophoretic mobilities in a resolving gel. As proteins elute from the column, they are trapped and concentrated in liquid phase in the collection chamber, free of the gel. The instrument is then paused at specific time intervals, and fractions are collected using a pipette. This process is repeated until all desired fractions have been collected. If fewer than 8 samples are run on a cartridge, any unused chambers can be used in subsequent separations.
This novel technology facilitates the quick and simple separation of up to 8 complex protein mixtures simultaneously, and offers several advantages when compared to previously available fractionation methods. This system is capable of fractionating up to 1mg of total protein per channel, for a total of 8mg per cartridge. Intact proteins over a broad mass range are separated on the basis of molecular weight, retaining important physiochemical properties of the analyte. The liquid phase entrapment provides for high recovery while eliminating the need for band or spot cutting, making the fractionation process highly reproducible1.

The accompanying video describes the use of the GELFREE 8100 Fractionation System, which partitions complex protein samples on the basis of molecular weight and recovers the fractions in liquid phase. The video describes how the technology works, how it is used, and provides resultant data, with polyacrylamide gel electrophoresis analysis of fractionated bovine liver homogenate.

Utiliser le système de fractionnement GELFREE 8100 pour les Poids Moléculaire à base de fractionnement avec récupération de la phase liquide

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

Génome édition avec des nucléases personnalisés CompoZr doigt de zinc (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

Investigating Protein-protein Interactions in Live Cells Using Bioluminescence Resonance Energy Transfer

Assays based on Bioluminescence Resonance Energy Transfer (BRET) provide a sensitive and reliable means to monitor protein-protein interactions in live cells. BRET is the non-radiative transfer of energy from a 'donor' luciferase enzyme to an 'acceptor' fluorescent protein. In the most common configuration of this assay, the donor is Renilla reniformis luciferase and the acceptor is Yellow Fluorescent Protein (YFP). Because the efficiency of energy transfer is strongly distance-dependent, observation of the BRET phenomenon requires that the donor and acceptor be in close proximity. To test for an interaction between two proteins of interest in cultured mammalian cells, one protein is expressed as a fusion with luciferase and the second as a fusion with YFP. An interaction between the two proteins of interest may bring the donor and acceptor sufficiently close for energy transfer to occur. Compared to other techniques for investigating protein-protein interactions, the BRET assay is sensitive, requires little hands-on time and few reagents, and is able to detect interactions which are weak, transient, or dependent on the biochemical environment found within a live cell. It is therefore an ideal approach for confirming putative interactions suggested by yeast two-hybrid or mass spectrometry proteomics studies, and in addition it is well-suited for mapping interacting regions, assessing the effect of post-translational modifications on protein-protein interactions, and evaluating the impact of mutations identified in patient DNA.

Interactions between proteins are fundamental to all cellular processes. Using Bioluminescence Resonance Energy Transfer, the interaction between a pair of proteins can be monitored in live cells and in real time. Furthermore, the effects of potentially pathogenic mutations can be assessed.

Étudier les interactions protéine-protéine dans les cellules vivantes en utilisant le transfert d&#39;énergie de résonance de bioluminescence

Assays based on Bioluminescence Resonance Energy Transfer (BRET) provide a sensitive and reliable means to monitor protein-protein interactions in live ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

siRNA contrôle pour la ubiquitine et les régulateurs du système ubiquitine-comme des voies biologiques dans des cellules de mammifères en culture

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Identification of Protein Interaction Partners in Mammalian Cells Using SILAC-immunoprecipitation Quantitative Proteomics

Quantitative proteomics combined with immuno-affinity purification, SILAC immunoprecipitation, represent a powerful means for the discovery of novel protein:protein interactions. By allowing the accurate relative quantification of protein abundance in both control and test samples, true interactions may be easily distinguished from experimental contaminants. Low affinity interactions can be preserved through the use of less-stringent buffer conditions and remain readily identifiable. This protocol discusses the labeling of tissue culture cells with stable isotope labeled amino acids, transfection and immunoprecipitation of an affinity tagged protein of interest, followed by the preparation for submission to a mass spectrometry facility. This protocol then discusses how to analyze and interpret the data returned from the mass spectrometer in order to identify cellular partners interacting with a protein of interest. As an example this technique is applied to identify proteins binding to the eukaryotic translation initiation factors: eIF4AI and eIF4AII.

SILAC immunoprecipitation experiments represent a powerful means for discovering novel protein:protein interactions. By allowing the accurate relative quantification of protein abundance in both control and test samples, true interactions may be easily distinguished from experimental contaminants, and low affinity interactions preserved through use of less-stringent buffer conditions.

Identification des protéines d&#39;interaction partenaires dans les cellules de mammifères à l&#39;aide SILAC-immunoprécipitation quantitatives en protéomique

Quantitative proteomics combined with immuno-affinity purification, SILAC immunoprecipitation, represent a powerful means for the discovery of novel ...

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell populations.&#160;These cultures contain the cells of interest, but are also contaminated with undifferentiated ESCs, non-neural derivatives and other neuronal subtypes.&#160; This limits their use in in vitro and in vivo applications, such as in vitro modeling for drug discovery or cell replacement therapy. To help overcome this, reporter cell lines, which offer a means to visualize, track and isolate cells of interest, can be engineered.&#160;However, to achieve this in human embryonic stem cells via conventional homologous recombination is extremely inefficient.&#160;This protocol describes targeting of the Pituitary homeobox 3 (PITX3) locus in human embryonic stem cells using custom designed zinc-finger nucleases, which introduce site-specific double-strand DNA breaks, together with a PITX3-EGFP-specific DNA donor vector. Following the generation of the PITX3 reporter cell line, it can then be differentiated using published protocols for use in studies such as in vitro Parkinson&#8217;s disease modeling or cell replacement therapy.

Reporter cell lines offer a means to visualize, track and isolate cells of interest from heterogeneous populations.&#160;However, gene-targeting using conventional homologous recombination in human embryonic stem cells is extremely inefficient. Herein, we describe targeting CNS midbrain specific transcription factor PITX3 locus with EGFP using zinc-finger nuclease enhanced homologous recombination.

Doigt de zinc nucléase Gene meilleur ciblage dans embryonnaires humaines Cellules souches

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

Examination of Proteins Bound to Nascent DNA in Mammalian Cells Using  BrdU-ChIP-Slot-Western Technique

Histone deacetylases 1 and 2 (HDAC1,2) localize to the sites of DNA replication. In the previous study, using a selective inhibitor and a genetic knockdown system, we showed novel functions for HDAC1,2 in replication fork progression and nascent chromatin maintenance in mammalian cells. Additionally, we used a BrdU-ChIP-Slot-Western technique that combines chromatin immunoprecipitation (ChIP) of bromo-deoxyuridine (BrdU)-labeled DNA with slot blot and Western analyses to quantitatively measure proteins or histone modification associated with nascent DNA.
Actively dividing cells were treated with HDAC1,2 selective inhibitor or transfected with siRNAs against Hdac1 and Hdac2 and then newly synthesized DNA was labeled with the thymidine analog bromodeoxyuridine (BrdU). The BrdU labeling was done at a time point when there was no significant cell cycle arrest or apoptosis due to the loss of HDAC1,2 functions. Following labeling of cells with BrdU, chromatin immunoprecipitation (ChIP) of histone acetylation marks or the chromatin-remodeler was performed with specific antibodies. BrdU-labeled input DNA and the immunoprecipitated (or ChIPed) DNA was then spotted onto a membrane using the slot blot technique and immobilized using UV. The amount of nascent DNA in each slot was then quantitatively assessed using Western analysis with an anti-BrdU antibody. The effect of loss of HDAC1,2 functions on the levels of newly synthesized DNA-associated histone acetylation marks and chromatin remodeler was then determined by normalizing the BrdU-ChIP signal obtained from the treated samples to the control samples.

In this protocol, we describe a novel BrdU-ChIP-Slot-Western technique to examine proteins and histone modifications associated with newly synthesized or nascent DNA.