This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: Isolement des ARN de petite taille à partir de P. Au cours de l&#39;IDC falciparum <ol><li> Obtenir parasites du paludisme dans la culture asexuée 29. NOTE: La taille de culture nécessaire varie en fonction de l&#39;application désirée; Cependant, une culture de 10 ml à 5.3% et 5% de parasitémie hématocrite fournit suffisamment d&#39;ARN pour PCR en temps réel (RT-PCR). La technique a été initialement optimisé pour les cultures asynchrones, mais quand des moments précis durant le cycle de l&#39;infection sont souhaitées, les parasites au stade annulaire peut être synchronisé par la synchronisation de sorbitol au plus tard 10-12 heures post-invasion. Synchronisation doit être répété après un cycle (environ 48 h) 29. </li><li> Piscine à cellules infectées ensemble (~ 5 x 10 9 hématies à 3-5% de parasitémie) et remplissent PBS froid à la partie supérieure du tube et centrifuger à 800 g pendant 5 min sans frein pour sédimenter les globules rouges. </li><li> Après centrifugation, éliminer le surnageant soigneusement à l&#39;aide d&#39;une pipette d&#39;aspiration, jointà un vide, puisque le culot érythrocytaire est facile à déloger. Laver le culot une fois de plus avec 1x PBS froid. </li><li> Remettre en suspension culot cellulaire dans le froid 0,15% de saponine (en 1x PBS) et le placer sur la glace pendant 30 min. </li><li> Centrifuger les cellules à 1500 g pendant 12 min à 4 ° C, retirer surnageant (qui sera de couleur rouge foncé) et remettre le culot dans du PBS froid. Répétez cette étape une fois de plus. NOTE: Afin de veiller à ce que les microARN présents étaient le reflet de microARN au sein des parasites, et non la contamination érythrocytaire, un certain nombre de conditions d&#39;isolement de parasites ont été testés: 1) saponine lyse, 2) saponine lyse combiné avec un traitement RNaseA des miARN cellulaires hôtes et 3 ) méthyl-bêta-cyclodextrine traitement pour éliminer le parasite de la érythrocytaire hôte. Tous les traitements ont donné des résultats similaires. </li><li> Lyse le culot parasitaire isolé en utilisant les recommandations 600 pl de tampon de lyse. Ce volume de tampon de lyse est suffisante pour cultures jusqu&#39;à ~ 30 ml à 2% d&#39;hématocrite et 5% de parasitémie. NOTE: Pour les grandes cultures de parasites, ce volume peut être augmenté. Il est important d&#39;assurer une lyse complète du culot parasitaire par tourbillonnement complète pendant au moins 1 min. En outre, pour faciliter l&#39;extraction, les échantillons lysés peuvent être transférées à un tube de microcentrifugation de 1,7 ml. </li><li> Ajouter 60 ul, ou 1/10 de volume de tampon de lyse utilisé dans l&#39;étape 6, l&#39;additif d&#39;homogénat (acétate de sodium 2 M, pH 4). </li><li> Donner des échantillons sur la glace pendant 10 min. </li><li> Ajouter 600 ul, ou un volume égal à la quantité de tampon de lyse ajouté à l&#39;étape 6, de phénol chloroforme acide à chaque échantillon et vortexer pendant 1 mn. </li><li> Séparer les phases aqueuse et organique par centrifugation des échantillons à 10 000 xg pendant 5 min. Cette rotation est plus longue que celle suggérée par le kit pour assurer que tous hémoglobine / hémozoïne est dans la phase organique. </li><li> Recueillir le (aqueuse) couche supérieure et de la transférer dans un nouveau tube. Répétez les étapes 9 et 10 si la phase aqueuse est blanc ou (plus probablement) de couleur brune, ce qui suggère procontamination protéine. </li><li> Déterminer le volume du surnageant obtenu à la pipette, puis ajouter 1,25 volumes d&#39;éthanol à 100% (~ 800 ul) et mélanger en inversant le tube de microcentrifugation de 1,7 ml 5 fois. </li><li> Passer chaque échantillon à travers une cartouche de filtre de liaison à l&#39;ARN disponible (différent de plusieurs qui sont disponibles dans le commerce), soit par centrifugation à 14.000 g pendant 1 min ou en utilisant un collecteur à vide. </li><li> Laver la cartouche du filtre avec 700 pi de la miRNA Wash Buffer 1 en utilisant une microcentrifugeuse, tournant à 14 000 g pendant 1 min. </li><li> Laver le filtre avec la cartouche de 500 ul de tampon de lavage par centrifugation deux fois 2/3 à 14 000 xg pendant 1 minute chacun. </li><li> Eluer l&#39;ARN avec 100 ul d&#39;eau DEPC, qui a été préchauffé à 95 ° C, à deux lavages de 50 ul, 14 000 xg à centrifugation pendant 1 min chacun. Mesurer la concentration de l&#39;ARN par absorbance UV à 260 nm. REMARQUE: Un gel de l&#39;ARN (soit acrylamide TBE-urée ou de gel dénaturant formaldéhyde agarose) peut be utilisée pour évaluer la distribution des tailles des ARN isolés. REMARQUE: Cet ARN est adapté à l&#39;analyse par puce à ADN, de l&#39;ARN-séquençage, transfert de Northern et de dosage de protection de ribonucléase. </li></ol> 2: Quantification de l&#39;ARN de petite taille à partir de P. Au cours de l&#39;IDC falciparum <ol><li> Déterminer la concentration d&#39;échantillons individuels isolés à l&#39;étape 1 en utilisant spectrophotométrie UV à 260 nm. </li><li> Générer des amorces de PCR en temps réel pour les espèces d&#39;ARN souhaitées. Pour miARN seul, nous avons utilisé préfabriqués dosages miARN qPCR, tandis que pour les ARNm ou fusion miARN-ARNm nous avons conçu des amorces pour SYBR vert. Pour des ARN de fusion, l&#39;amorce sens était la séquence de miARN elle-même (miR-451: AAACCGTTACCATTACTGAGTT), tandis que l&#39;inverse était une amorce ~ 100 pb spécifique de gène en aval du miRNA dans la séquence d&#39;ARNm (PKA-R: ATCGAACATGCTGTGAACAT). </li><li> Assurez-ADNc à partir des échantillons d&#39;ARN en utilisant soit une amorce en épingle à cheveux pour les miARN (utiliser 20-40 ng d&#39;ARN) seul ou hexamères aléatoires pour l&#39;ARNm et / ou miARN-ARNm espèces de fusion (en utilisant 1 pg d&#39;ARN). Mélanger l&#39;ARN et des amorces pendant 5 min à 65 ° C, puis laisser refroidir à température ambiante. Ensuite, ajouter la transcriptase inverse mélange (0,5 pi transcriptase inverse, un inhibiteur de la RNase 0,5 ul, 1 ul de dNTP de 2,5 mM chacun (), 4 pi de 5 x tampon, 0,1 M de 2 ul de DTT, 1 pi de H 2 O). <ol><li> Échantillons exécuté sur un thermocycleur capable de détecter soit SYBR sondes vertes ou TaqMan. SYBR vert PCR quantitative 30 pour des gènes spécifiques est exécuté en tant que 3-étape de PCR, 95 ° C pendant 15 s, le plus faible température de recuit primaire moins 5 ° C pendant 30 sec, et 68 ° C pendant 30 secondes, pendant 40 cycles, en utilisant un SYBR commerciale mix master vert. miRNA-PCR en temps réel a été exécutée comme une PCR en deux étapes, 95 ° C pendant 15 s et 60 ° C pendant 1 minute, pendant 40 cycles. </li><li> Quantifier les tests utilisant la méthode ΔΔCt et de normaliser contre eux soit Rab GTPase (PF08_0110) ou 18S 31. </li></ol></li></ol> 3: Présentationde petits ARN en parasites du paludisme <ol><li> Pellet 300 pi de globules rouges par transfection (250 pi de globules rouges, environ 1,5 x 10 9 cellules, sera finalement utilisé) dans les médias du paludisme complète par centrifugation à 800 g pendant 5 min à frein 1. </li><li> Laver les erythrocytes deux fois avec du RPMI et remettre en suspension dans CYTOMIX intégral (mM KCl 120; 0,15 mM de CaCl2, 10 mM de K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM de HEPES, pH 7,6; 2 mM d&#39;EGTA, pH 7,6; MgCl2 5 mM; pH a été ajusté avec du KOH) à 50% d&#39;hématocrite après centrifugation à 800 xg pendant 5 min à 1 frein. </li><li> Transférer les cellules à une cuvette d&#39;électroporation de 0,2 cm. </li><li> Ajouter 10 ug, ou approprié quantité, d&#39;oligonucléotides synthétiques personnalisé aux cuvettes et remettre les cultures. </li><li> Réglez le électroporateur à 310 V / 950 pF et délivrer une impulsion à chaque cuvette. </li><li> Reprendre les 300 pi de globules rouges dans le cuvette dans préchauffé mal complètearia médias et de la plaque les plaques à 24 puits et incuber à 37 ° C dans un récipient hermétique avec un mélange de gaz de sang de la malaria (3% de O 2, 5% de CO 2). </li><li> Après 4 heures, infecter les globules rouges transfectées avec trophozoïtes fin synchronisées à une parasitémie finale approximative de 1%. </li><li> Ajouter globules rouges fraîchement transfectées tous les 4-6 jours pour les cultures infectées et déterminer la parasitémie% par FACS en utilisant YoYo-1 coloration, comme indiqué à la section 4. </li></ol> 4: Détermination des érythrocytes microARN Effet Sur Parasite Taux d&#39;infection <ol><li> Prenez 100 pi de la culture remis en suspension par micropipette et le placer dans un tube de 1,7 ml à centrifuger. Laver deux fois avec 1 ml de 1 x PBS et centrifugation dans une microcentrifugeuse de table par centrifugation à 800 xg pendant 5 min. </li><li> Remettre en suspension le culot dans 1 ml de glutaraldéhyde à 0,025%. Incuber les échantillons pendant 20 min à température ambiante. Note: Les échantillons peuvent être stockés ici pendant plusieurs semaines à 4 ° C. Ensuite, le culot infecté RBC par centrifugation à 800 g pendant 5 min. Laver deux fois avec 1 ml de PBS 1x. </li><li> Remettre en suspension le culot dans 1 ml de 0,015% de saponine. Incuber à 4 ° C pendant 15 min. Pellet globules rouges infectés par centrifugation à 800 xg pendant 5 min. Laver deux fois avec 1 ml de PBS 1x. Repeat.4.3. Resuspendre les cellules dans 1 ml de 1 x PBS contenant 1 ul (1,000X) ADN tache. </li><li> Déterminer les degrés de la parasitémie sur un cytomètre de flux, à 488 nm excitation et ~ 530 nm (FL-1) l&#39;émission. </li><li> Premièrement, porte le cytomètre de flux basé sur FSC et SSC se concentrer sur les globules rouges. Puis mesurer les degrés de la parasitémie (les globules rouges infectés) dans la RBC fermée par fluorescence dans le canal FL-1. NOTE: plus tard, les parasites au stade sont 10X plus fluorescente de parasites au stade antérieures, et ~ 100X-dessus de globules rouges non infectés. En outre, la collecte à basse vitesse tend à réduire le bruit. Enfin, cette approche a été comparé à 3 H-hypoxanthine constitution et Giemsa, à la fois comme précédemment rapporté 13, et toutes les techniques GAVe des résultats similaires. </li></ol> 5: biotine-tagging et élution de miARN-ARNm Fusion Produits <ol><li> Commander directement oligonucléotides synthétiques personnalisée d&#39;ARN avec desthiobiotine (DB) liés de manière covalente à l&#39;extrémité 5 &#39;. </li><li> Transfecter hématies non infectées avec desthiobiotine-conjugué (DB) miARN et non modifiée miARN (contrôle négatif), comme indiqué à l&#39;étape 3. </li><li> Infecter les globules rouges transfectées avec P. falciparum parasites à une parasitémie de départ de 0,5% (étape 1.1). </li><li> Extraire l&#39;ARN parasite 4 jours (96 h) plus tard comme décrit ci-dessus à l&#39;étape 1. </li><li> Incuber 10 ug d&#39;ARN du parasite avec 50 ul emballés billes de streptavidine, ajouté au moyen d&#39;une micropipette, et tourner sur un dispositif de rotation de tube de microcentrifugation pendant 1 heure à 4 ° C. </li><li> Pellet les perles à 800 g pendant 30 sec et laver avec 20 mM de KCl et 1 / 1.000 RNase Inhibitor. </li><li> Eluer ARN à partir des billes par compétition avec la biotine et 2 mM avec 200 pi de tampon d&#39;élution de l&#39;ARN capture (20 mM de KCl, 1.1, 000 RNase Inhibitor et 2 mM de biotine) à 4 ° C pendant une nuit avec rotation. </li><li> Déterminer le degré d&#39;enrichissement du indiqué P. transcriptions falciparum utilisant SYBR vert qRT-PCR, et l&#39;enrichissement de microARN (contrôle positif) par TaqMan qPCR comme indiqué à l&#39;étape 2. </li></ol> 6: Séparation polysome pour déterminer les ribosomique Occupation de P. falciparum <ol><li> Placer solution de saccharose à 5 ml de 15% (400 mM d&#39;acétate de potassium, l&#39;HEPES de potassium 25 mM, pH 7,2, acétate de magnésium 15 mM, 200 uM de cycloheximide, DTT 1 mM, PMSF 1 mM, 40 U / ml d&#39;inhibiteur de RNase, et de 15% de saccharose ) dans un tube d&#39;ultracentrifugation SW41 (14 x 89 mm). </li><li> L&#39;utilisation d&#39;une seringue de 5 ml, ajouter une solution de saccharose à 5 ml de 50% (400 mM d&#39;acétate de potassium, l&#39;HEPES de potassium 25 mM, pH 7,2, acétate de magnésium 15 mM, 200 uM de cycloheximide, DTT 1 mM, PMSF 1 mM, 40 U / ml de RNase inhibiteur, et 50% de saccharose) sous le saccharose 15% en utilisant une aiguille d&#39;acier de long, puis retirer l&#39;aiguille. </li><li&gt; sceller le dessus du tube de gradient avec du Parafilm, inclinez lentement le tube sur le côté, dans une position stable pour éviter de roulement, de sorte qu&#39;il est étendu horizontalement sur la table. Garder le tube de son côté pendant au moins 2 h. En attendant, commencez à l&#39;étape 6.5. </li><li> Après 2 h, incliner lentement le tube dos droit et de transférer le tube à la glace, la laisser refroidir pendant au moins 15 min avant le chargement des échantillons (étape 14). </li><li> Recueillir la culture assez de stade sanguin infecté par le Plasmodium pour générer 100-500 ug d&#39;ARN total, soit environ 100 ml d&#39;une culture asynchrone à 3-5% de parasitémie. Ajouter 1/10 ème de ce volume de milieu de culture contenant 10x (2 mM) cycloheximide (CHX) et incuber à 37 ° C pendant 10 min. <ol><li> Cultures pellets par centrifugation à 500 g pendant 7 minutes avec la centrifugeuse (frein 1), puis laver deux fois avec la température ambiante 1x PBS contenant 200 uM CHX. Reprendre les cultures de parasites dans 1x PBS contenant 200 uM CHX et de les stocker sur la glace. </li></ol></li&gt; <li> Estimer le volume de la pastille RBC. Ajouter du tampon de lyse (400 mM d&#39;acétate de potassium, l&#39;HEPES de potassium 25 mM, pH 7,2, acétate de magnésium 15 mM, 200 uM CHX, DTT 1 mM, PMSF 1 mM, 40 U / ml d&#39;inhibiteur de RNase, 1% (v / v) de IGEPAL CA -630, et 0,5% (p / v) DOC) au culot de globules rouges à un volume final de 4,25 ml. Incuber le lysat à 4 ° C pendant 10 min tout en tournant. </li><li> Transférer le lysat pour microtubes, puis centrifuger les échantillons dans une microcentrifugeuse à 16.000 xg et 4 ° C pendant 10 min. </li><li> Préparer des coussins de saccharose à la pipette 1,25 ml d&#39;une solution de saccharose à coussin froid 0,5 M (400 mM d&#39;acétate de potassium, l&#39;HEPES de potassium 25 mM, pH 7,2, acétate de magnésium 15 mM, 200 uM de cycloheximide, DTT 1 mM, PMSF 1 mM, 40 U / ml de RNase Inhibitor, et 0,5 M de saccharose) dans un tube d&#39;ultracentrifugation SW55 (13 x 51 mm). </li><li> Superposer avec précaution 3,75 ml de surnageant de lysat (de l&#39;étape 7) sur le dessus du coussin de saccharose à l&#39;aide d&#39;une petite seringue et (~ 27) d&#39;aiguille de jauge. Store lysat restant (~ 500 pi) à -80 ° C pour extraire les niveaux d&#39;ARN totaux, comme indiqué à l&#39;article 1. </li><li> Charger les échantillons dans un rotor d&#39;ultracentrifugation, pré-réfrigérés à 4 ° C, qui peut contenir 13,2 ml tubes. Centrifuger les échantillons à 366 000 x g et 4 ° C pendant 146 min. </li><li> En utilisant une pipette, transférer le surnageant dans un tube conique de 15 ml. Stocker le surnageant à -80 ° C pour l&#39;isolement de l&#39;ARN du libre (non liée par les ribosomes) ARN. </li><li> Reprendre le culot ribosome dans 500 ul de tampon de remise en suspension ribosome (400 mM d&#39;acétate de potassium, l&#39;HEPES de potassium 25 mM, pH 7,2, acétate de magnésium 15 mM, 200 uM de cycloheximide, DTT 1 mM, PMSF 1 mM, et 40 U / ml d&#39;inhibiteur de RNase) par aspiration pendant 5 minutes. </li><li> Centrifuger les échantillons dans une microcentrifugeuse à 16 000 x g et 4 &#160; ° C pendant 10 min. </li><li> Tout en gardant le gradient de l&#39;étape n ° 4 sur la glace, retirez le Parafilm, puis la couche attentivement la suspension ribosome sur le dessus de l&#39;USI de gradientng une petite seringue et (~ 27) de l&#39;aiguille de la jauge. </li><li> Chargez le tube dans une ultracentrifugeuse rotor pré-réfrigérée et centrifuger les gradients chargés à 200.000 xg et 4 ° C pendant 180 minutes. Lorsque la rotation est terminée, magasin centrifugé gradients à 4 ° C jusqu&#39;au moment de charger sur la colonne de fractionnement. </li><li> Charger un tube d&#39;ultracentrifugation vide dans la colonne de fractionnement gradient (cela peut être un tube utilisé dans un essai précédent), puis laver avec de l&#39;eau sans RNAse pendant 5 min à 100 x 10 vitesses. </li><li> Lors du lavage à l&#39;étape 6.16, régler la sensibilité du détecteur d&#39;absorbance UV. Une bonne sensibilité de départ est de 0,2, mais ceci peut être ajusté en court le plus tard en fonction du signal A 254 (qui varie en fonction du nombre de parasites, etc.). </li><li> Une fois la sensibilité du détecteur est réglé, le signal de référence à zéro tandis que l&#39;eau coule à travers le détecteur. </li><li> Après avoir lavé le collecteur de fraction, inverser l&#39;écoulement de fluide jusqu&#39;à ce que les lignes sont vides puis remove le tube d&#39;ultracentrifugation vide. </li><li> Exécutez solution de saccharose à 60% à travers la colonne de fractionnement jusqu&#39;à ce qu&#39;il quitte l&#39;appareil de l&#39;aiguille. </li><li> Insérez le tube contenant le premier gradient au sommet de la chambre de chargement et serrer le joint, en prenant soin de ne pas trop serrer. Ensuite, percer le fond du tube avec l&#39;aiguille. </li><li> Réinitialiser la vitesse d&#39;écoulement du fluide à 12,5 x 10 (contrôlé par le bouton de commande de vitesse d&#39;écoulement sur le devant de la pompe), puis réglez le collecteur de fractions automatisé pour recueillir 18 fractions de la SEC (~ 330 pi / fraction) dans des microtubes. </li><li> Démarrage avant écoulement de la solution de saccharose à 60%. </li><li> Lorsque la première goutte de la solution de gradient tombe dans le tube à centrifuger, commencer immédiatement à la fois la collecte de fractions et l&#39;enregistrement en direct du signal A 254. </li><li> Une fois une forte baisse est observée dans le signal A 254, correspondant à l&#39;interface entre les solutions de saccharose à 50% et 60%, à la fois arrêter l&#39;écoulement du fluide et A 254 </sub&gt; enregistrement. </li><li> Stocker les fractions de gradient à -80 &#160; ° C pour une utilisation ultérieure. </li><li> Inverser l&#39;écoulement de fluide à 100 x 10 vitesse jusqu&#39;à ce que la solution de saccharose à 60% de vide sur le tube d&#39;ultracentrifugeuse. </li><li> Si il ya des gradients supplémentaires pour fractionner, retirer le tube d&#39;ultracentrifugation vide de la chambre de chargement et redémarrez de l&#39;étape 6.21. Si tous les échantillons sont terminées, laver l&#39;appareil a été effectuée dans les étapes 6.16 et 6.19. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HbS est l&#39;un des variants de l&#39;hémoglobine les plus communs dans les zones d&#39;endémie du paludisme, en grande partie parce qu&#39;elle offre une protection contre le paludisme grave causée par P. falciparum. Les techniques nécessaires pour caractériser le rôle des microARN humaine dans la régulation des gènes de P. falciparum sont détaillées tout au long de ce manuscrit. En extrayant l&#39;ARN total dans une manière à inclure tous les petits ARN, et en effectuant une pro...

Le paludisme, causée par des parasites apicomplexes du genre Plasmodium, est la maladie parasitaire la plus fréquente humaine, infectant globalement environ 200 millions de personnes chaque année et provoque environ 600.000 décès 1. Parmi les cinq espèces de Plasmodium qui infectent les humains, les plus pertinents à la maladie humaine sont P. falciparum et P. vivax, en raison de leurs distributions généralisées et le potentiel pour des complications graves de paludisme. Le cycle de vie du parasite de la malaria infection nécessite à la fois les moustiques et les humains. Quand un moustique infecté pique un humain, les parasites dans la circulation sanguine vers le foie, où une première série de réplication. Après mérozoïtes rupture de l&#39;hépatocyte hôte, ils infectent les globules rouges à proximité, initier la réplication soit sexuée ou asexuée. Le stade asexué de réplication, qui dure 48 heures dans P. falciparum, est l&#39;objet de cette étude, car il est à la fois la source de la plupart malsymptômes aria et est facilement récapitulées in vitro. Bien qu&#39;un certain nombre d&#39;initiatives de santé publique, y compris l&#39;amélioration des thérapies anti-paludiques, ont quelque peu réduit la charge du paludisme à l&#39;échelle mondiale, l&#39;émergence continue de parasites résistants aux médicaments pose un problème pour les efforts de lutte contre le paludisme. Un aspect qui pourrait suggérer de nouvelles approches thérapeutiques est l&#39;étude sur la façon dont diverses variantes génétiques confèrent une résistance au paludisme. Dans les régions où le paludisme est endémique, une variété de polymorphismes érythrocytaires sont assez commun 2,3. Ces mutations, avec la drépanocytose étant peut-être le plus important, sont souvent associées à une résistance substantielle à l&#39;apparition de l&#39;infection paludéenne 4 symptomatique. Les mécanismes sous-jacents qui causent érythrocytes ils à résister aux infections de paludisme sont encore mal compris. Hématies parasitées avec des mutations de l&#39;hémoglobine sont soumis à la phagocytose renforcée par la rigidité cellulaire accrue et la déshydratation, quiest associé à une diminution de l&#39;invasion par P. 5 falciparum. L&#39;allèle HbC affecte également l&#39;expression des protéines à la surface des érythrocytes et avec le remodelage du cytosquelette, l&#39;inhibition de la poursuite du développement du parasite 6,7. Enfin, P. falciparum pousse mal dans les falciformes homozygote (HbSS) 8,9 érythrocytes in vitro, suggérant facteurs érythrocytaires intrinsèques de résistance du paludisme. Cependant, alors que l&#39;ensemble de ces mécanismes semblent jouer un rôle, ils ne expliquent pas complètement les mécanismes derrière la résistance de la drépanocytose au paludisme. Un ensemble potentiel des facteurs érythrocytaires qui restent mal compris est la grande piscine de miARN présents dans les érythrocytes matures. Les microARN sont de petits ARN non codants, 19-25 nt de taille, qui médient la traduction et / ou la stabilité des ARNm cibles par appariement de bases à l&#39;intérieur de la 3 &#39;UTR. Ils ont été impliqués dans la régulation de la réponse immunitaire des mammifères, y compris la suppression of 10 la replication du virus, et ont été montrés pour conférer une résistance aux virus dans des plantes Ils ont également été montré pour réguler plusieurs processus, y compris l&#39;érythropoïèse érythrocytaires 11,12 et 13 le métabolisme du fer. Des études précédentes ont identifié une population abondante et diversifiée des miARN érythrocytaires, dont l&#39;expression a été considérablement modifié dans HbSS érythrocytes 14,15. Depuis érythrocytes matures manquent transcription active et la traduction, le rôle fonctionnel de ces miARN érythrocytaires reste incertaine. En échange de matière important se produit entre la cellule hôte et P. falciparum au cours du cycle de développement intra-érythrocytaire (IDC) 16, il a été spéculé que le profil miARN modifié au érythrocytes HbS peut contribuer directement à la résistance du paludisme cellule-intrinsèque. Ces études ont finalement abouti à l&#39;élaboration d&#39;un pipeline pour isoler, identifier et fonctionnellement étudier le rôle des miARN humain dans le malaria parasite, P. falciparum, qui a indiqué que ces hôtes / miARN humains finalement covalente fusible puis réprimer translation parasite transcriptions d&#39;ARNm 17. Cela a fourni un exemple des premiers inter-espèces transcriptions chimériques formés par trans-épissage et implique que cette fusion miARN-ARNm pouvait se produire chez d&#39;autres espèces, y compris d&#39;autres parasites. Tous les ARNm trypanosomes sont trans-épissage avec une épissure leader (SL) pour réguler la séparation des transcriptions polycistroniques 18. Depuis P. falciparum manque orthologues pour Dicer / Ago 19,20, il est possible que miARN érythrocytaires détournent SL machines similaires dans P. falciparum à intégrer dans les gènes cibles. Des études récentes dans P. falciparum ont en effet indiqué la présence de 5 &#39;des séquences de tête 21 d&#39;épissage. Cette étude détaille les méthodes qui ont conduit à la découverte de l&#39;homme-parasite miARN-ARNm transcrits de fusion, y compris à la fois transcriptomique et traductechniques de régulation supplémentaires. Les objectifs généraux de ces méthodes sont d&#39;étudier les effets de petits ARN dans la régulation des gènes, les phénotypes et la traduction potentiel de P. transcriptions falciparum. L&#39;identification initiale des transcriptions chimères humains-parasite invoqué l&#39;utilisation des techniques d&#39;analyse d&#39;ARN, comme PCR en temps réel, le séquençage du transcriptome et la bibliothèque capture HNE, qui comprenait à la fois totale et petits ARN, plutôt que d&#39;utiliser des techniques qui ne isolés petits ARN. Isolement de l&#39;ARN tous ensemble dans une grande piscine, plutôt que séparément, a permis l&#39;identification de deux petits ARN humains translocation dans le parasite ainsi que la présence de ces petites séquences d&#39;ARN en tant que partie d&#39;une séquence plus grande. Ce alors requis une analyse de l&#39;état de la traduction de ces ARNm de fusion afin de déterminer les conséquences fonctionnelles de ces fusions. Bien que des efforts considérables sur la caractérisation du génome de l&#39;un du parasited transcriptome ont ajouté à la compréhension de la biologie du parasite 22-25, loin on connaît moins la régulation de la traduction de l&#39;ARNm du transcriptome à travers le cycle de vie de P. 26 falciparum. Cette compréhension limitée du protéome du parasite a entravé la fois la compréhension de la biologie du parasite et la capacité à identifier de nouvelles cibles pour la prochaine génération de thérapies anti-paludiques. Cet écart dans la compréhension de la biologie cellulaire du parasite a persisté principalement en raison de l&#39;absence de techniques adéquates pour enquêter régulation de la traduction dans P. falciparum. Un récent document décrit l&#39;utilisation de l&#39;empreinte ribosomal de P. falciparum pour déterminer le statut de la traduction globale 21. Une mesure de potentiel bien établie de translation de la transcription est le nombre de ribosomes associés déterminés par polysomes profilage. Cependant, lorsque cette technique est appliquée à P. falciparum &lt;/ em&gt;, il est incapable de récupérer la plupart des polysomes et capte principalement monosomes. Récemment, plusieurs groupes 27,28 ont optimisé P. techniques de polysome falciparum par lyse des érythrocytes et le parasite simultanément pour préserver les polysomes et de caractériser l&#39;occupation ribosomique et le potentiel de translation de ces parasites du paludisme au cours de leur développement asexuée dans des cellules hôtes rouges 28. Collectivement, ces méthodes montrent que la fusion observée des ARNm miRNA et parasite humain module traduction de ces ARNm de fusion, qui a été démontré en utilisant des méthodes précédemment rapportés 27 protéines du parasite, et est un déterminant majeur de la résistance du paludisme dans HbAS et HbSS érythrocytes 17. Ces procédés seraient utiles dans n&#39;importe quel système cherche à identifier et à explorer fonctionnellement événements d&#39;épissage d&#39;ARN, si ces ARN de fusion sont dans un rayon P. falciparum ou d&#39;autres systèmes eucaryotes.

<table border="0" cellpadding="0" cellspacing="0" width="651">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:651px;">REAGENTS-All reagents must be RNAse-free.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Diethyl pyrocarbonate (DEPC; Sigma, cat. no. D5758)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC-treated water (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Yoyo-1 DNA fluorescent dye (Thermo Fisher)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gene Pulser II (or comparible) electroporator (Bio-Rad)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.2 cm Electroporation cuvettes</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4 M potassium acetate (Mallinckrodt, cat. no. 6700)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 M potassium HEPES (pH 7.2; Sigma, cat. no. H0527)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M magnesium acetate (Sigma, cat. no. M-2545)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M dithiothreitol (DTT; Research Products International, cat. no. D11000)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM phenylmethylsulfonate fluoride (PMSF; dissolved in isopropanol; Sigma, cat. no. P7626)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (v/v) Igepal CA-630 (Sigma-Aldrich, cat. no. I3021)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (w/v) sodium deoxycholate (DOC; Sigma, cat. no. D-6750)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Cycloheximide (CHX; Sigma, cat. no. C-7698)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose (Mallinckrodt, cat. no. 8360-04)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNAseOUT (Invitrogen, cat. no. 100000840)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RPMI-1640 w/ L-glutamine (Cellgro, cat. no. 10-040-CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% AlbuMAX I (w/v in sterile water) (Invitrogen, cat. no. 11020-039)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gentamicin (Gibco, cat. no. 15750-060))</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HT supplement (100x) (Invitrogen, cat. no. 11067030)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">45% (w/v) sucrose (Sigma, cat no. G8769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M HEPES buffer (Gibco, cat. no. 15630-080)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass slides (VWR, cat. no. 48311-702)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Giemsa stain (50X) (VWR, cat no. m708-01)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#39; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotin powder (Sigma-Aldrich)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1M Potassium Chloride</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin Sepharose High Performance Beads (GE Healthcare)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose cushion (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose chase solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA capture Wash Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Elution Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">REAGENT SETUP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">500 ml RPMI-1640 w/ L-glutamine</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 ml gentamicin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml HT supplement</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2.5 ml 45% glucose</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 ml 10% AlbuMAX I</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">12.5 ml 1 M HEPES</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sterile filter with 0.2 mm vacuum filter flask.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media containing 10x CHX</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as Plasmodium cell culture media above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 mM cycloheximide</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x PBS containing cycloheximide</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">400 mM potassium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 mM potassium HEPES, pH 7.2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15 mM magnesium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">200 mM cycloheximide (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM DTT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM PMSF (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40 U/ml RNaseOUT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% (v/v) Igepal CA-630</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% (w/v) DOC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose to make 15% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose to make 50% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose to make 0.5 M sucrose cushion</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">The 60% sucrose chase solution requires only sucrose and water, no other components</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Wash Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20mM&#160; KCl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5unit/ml Rnase Out (Invitrogen)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Elution Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as RNA Capture Wash Buffer, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2mM Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">EQUIPMENT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Ultra-ClearTM &#189; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polyallomer 9/16 x 3 &#189; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">L8-80M ultracentrifuge (Beckman)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Steel blunt syringe needle, 4 inch, 16G (Aldrich, cat. no. Z261378)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 ml syringe with 27G&#189; needle (Becton Dickinson, cat no. 309623)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml syringe (Becton Dickinson, cat. no. 309646)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Parafilm</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tube rotator, end-over-end</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microcentrifuge, refrigerated</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">TracerDAQ (Measurement Computing)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf 5810R centrifuge</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td>
		</tr>
	</tbody>
</table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

La variation génétique responsable de l&#39;allèle drépanocytaire (HbS) permet érythrocytes à résister à l&#39;infection par le parasite du paludisme, P. falciparum. La base moléculaire de cette résistance, qui est connu pour être multifactorielle, reste mal compris. Des études récentes ont constaté que l&#39;expression différentielle des microARN érythrocytaires, une fois transplantées dans des parasites du paludisme, affectent à la fois la régulation des gènes et de la croissance du parasite. Ces miARN ont ensuite été présentés pour inhiber la traduction de l&#39;ARNm en formant une transcription de l&#39;ARN chimérique via 5 «fusion d&#39;ARN avec des sous-ensembles discrets d&#39;ARNm de parasites. Ici, les techniques qui ont été utilisées pour étudier le rôle fonctionnel et mécanisme putatifs microARN érythrocytaires sous-jacentes sur la régulation des gènes et le potentiel de translation de P. falciparum, y compris la transfection de microARN synthétiques modifiés dans les érythrocytes d&#39;accueil, seront détaillées. Enfin, une méthode de gradient de polysomes est utilisée pour déterminer l&#39;étendue de translation de ces transcriptions. Ensemble, ces techniques nous ont permis de démontrer que les niveaux dérégulés de microARN érythrocytaires contribuent à la résistance du paludisme cellule-intrinsèque des érythrocytes falciformes.

Profilage de microARN humaine globale dans P. falciparum Les techniques présentées ici ont été utilisés pour extraire les micro-ARN à partir de parasites dans une variété de conditions. Une chose à noter est que les extractions d&#39;ARN pour les globules rouges non infectés ont été effectués comme indiqué dans le 32, qui a souvent servi de point pour les données de microARN présentés à la fois dans cet article et l&#39;étude originale 29<...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Méthodes pour étudier le rôle de réglementation de petits ARN ribosomal et l&#39;occupation des<em&gt; Plasmodium falciparum</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K vues.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Vidéo: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the disease, is characterised by an accumulation of Plasmodium falciparum infected red blood cells (iRBC) at pigmented trophozoite stage in the microvasculature of the brain2-4. This microvessel obstruction (sequestration) leads to acidosis, hypoxia and harmful inflammatory cytokines (reviewed in 5). Sequestration is also found in most microvascular tissues of the human body2, 3. The mechanism by which iRBC attach to the blood vessel walls is still poorly understood.
The immortalized Human Brain microvascular Endothelial Cell line (HBEC-5i) has been used as an in vitro model of the blood-brain barrier6. However, Plasmodium falciparum iRBC attach only poorly to HBEC-5i in vitro, unlike the dense sequestration that occurs in cerebral malaria cases. We therefore developed a panning assay to select (enrich) various P. falciparum strains for adhesion to HBEC-5i in order to obtain populations of high-binding parasites, more representative of what occurs in vivo.
A sample of a parasite culture (mixture of iRBC and uninfected RBC) at the pigmented trophozoite stage is washed and incubated on a layer of HBEC-5i grown on a Petri dish. After incubation, the dish is gently washed free from uRBC and unbound iRBC. Fresh uRBC are added to the few iRBC attached to HBEC-5i and incubated overnight. As schizont stage parasites burst, merozoites reinvade RBC and these ring stage parasites are harvested the following day. Parasites are cultured until enough material is obtained (typically 2 to 4 weeks) and a new round of selection can be performed. Depending on the P. falciparum strain, 4 to 7 rounds of selection are needed in order to get a population where most parasites bind to HBEC-5i. The binding phenotype is progressively lost after a few weeks, indicating a switch in variant surface antigen gene expression, thus regular selection on HBEC-5i is required to maintain the phenotype.
In summary, we developed a selection assay rendering P. falciparum parasites a more "cerebral malaria adhesive" phenotype. We were able to select 3 out of 4 P. falciparum strains on HBEC-5i. This assay has also successfully been used to select parasites for binding to human dermal and pulmonary endothelial cells. Importantly, this method can be used to select tissue-specific parasite populations in order to identify candidate parasite ligands for binding to brain endothelium. Moreover, this assay can be used to screen for putative anti-sequestration drugs7.

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

An in vitro model for cerebral malaria sequestration is described1. Plasmodium falciparum infected red blood cells are selected for binding to immortalized human brain microvascular endothelial cells. The selected parasites show a distinct phenotype. The selection process can be applied using various P. falciparum strains and endothelial cell lines.

Sélection des Plasmodium falciparum Parasites des Cytoadhesion aux cellules du cerveau endothéliales humaines

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the ...

Recherche

Immunologie et infection

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Une introduction à guêpes parasites<em&gt; Drosophila</em&gt; Et la réponse immunitaire antiparasitaire

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Un<em&gt; In vitro</em&gt; Co-infection modèle pour étudier<em&gt; Plasmodium falciparum</em&gt;-VIH-1 dans les interactions de l&#39;homme primaires dérivées de monocytes cellules immunitaires

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully understood and several hypotheses have been put forward, including mechanical obstruction of microvessels by P. falciparum-parasitized red blood cells (pRBC). Indeed, during the intra-erythrocytic stage of its life cycle, P. falciparum has the unique ability to modify the surface of the infected erythrocyte by exporting surface antigens with varying adhesive properties onto the RBC membrane. This allows the sequestration of pRBC in multiple tissues and organs by adhesion to endothelial cells lining the microvasculature of post-capillary venules 1. By doing so, the mature forms of the parasite avoid splenic clearance of the deformed infected erythrocytes 2 and restrict their environment to a more favorable low oxygen pressure 3. As a consequence of this sequestration, it is only immature asexual parasites and gametocytes that can be detected in peripheral blood.
Cytoadherence and sequestration of mature pRBC to the numerous host receptors expressed on microvascular beds occurs in severe and uncomplicated disease. However, several lines of evidence suggest that only specific adhesive phenotypes are likely to be associated with severe pathological outcomes of malaria. One example of such specific host-parasite interactions has been demonstrated in vitro, where the ability of intercellular adhesion molecule-1 to support binding of pRBC with particular adhesive properties has been linked to development of cerebral malaria 4,5. The placenta has also been recognized as a site of preferential pRBC accumulation in malaria-infected pregnant women, with chondrotin sulphate A expressed on syncytiotrophoblasts that line the placental intervillous space as the main receptor 6. Rosetting of pRBC to uninfected erythrocytes via the complement receptor 1 (CD35)7,8 has also been associated with severe disease 9.
One of the most recently described P. falciparum cytoadherence phenotypes is the ability of the pRBC to form platelet-mediated clumps in vitro. The formation of such pRBC clumps requires CD36, a glycoprotein expressed on the surface of platelets. Another human receptor, gC1qR/HABP1/p32, expressed on diverse cell types including endothelial cells and platelets, has also been shown to facilitate pRBC adhesion on platelets to form clumps 10. Whether clumping occurs in vivo remains unclear, but it may account for the significant accumulation of platelets described in brain microvasculature of Malawian children who died from CM 11. In addition, the ability of clinical isolate cultures to clump in vitro was directly linked to the severity of disease in Malawian 12 and Mozambican patients 13, (although not in Malian 14).
With several aspects of the pRBC clumping phenotype poorly characterized, current studies on this subject have not followed a standardized procedure. This is an important issue because of the known high variability inherent in the assay 15. Here, we present a method for in vitro platelet-mediated clumping of P. falciparum with hopes that it will provide a platform for a consistent method for other groups and raise awareness of the limitations in investigating this phenotype in future studies. Being based in Malawi, we provide a protocol specifically designed for a limited resource setting, with the advantage that freshly collected clinical isolates can be examined for phenotype without need for cryopreservation.

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

This method investigates the platelet-mediated clumping phenotype of Plasmodium falciparum-infected erythrocytes (pRBC) in clinical isolates. This is performed by isolating and co-incubating platelet-rich plasma and a suspension of pRBC.

Un protocole simple pour agglutination des plaquettes induite par des<em&gt; Plasmodium falciparum</emLes érythrocytes&gt; infectées dans une ressource Mauvais réglage

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully ...

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

We describe a method for isolation and characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. Infection of susceptible mouse-strains with this parasite strain results in the induction of experimental cerebral malaria, a neurologic syndrome that recapitulates certain important aspects of Plasmodium falciparum-mediated severe malaria in humans 1,2 . Mature forms of blood-stage malaria express parasitic proteins on the surface of the infected erythrocyte, which allows them to bind to vascular endothelial cells. This process induces obstructions in blood flow, resulting in hypoxia and haemorrhages 3 and also stimulates the recruitment of inflammatory leukocytes to the site of parasite sequestration.
Unlike other infections, i.e neutrotopic viruses4-6, both malaria-parasitized red blood cells (pRBC) as well as associated inflammatory leukocytes remain sequestered within blood vessels rather than infiltrating the brain parenchyma. Thus to avoid contamination of sequestered leukocytes with non-inflammatory circulating cells, extensive intracardial perfusion of infected-mice prior to organ extraction and tissue processing is required in this procedure to remove the blood compartment. After perfusion, brains are harvested and dissected in small pieces. The tissue structure is further disrupted by enzymatic treatment with Collagenase D and DNAse I. The resulting brain homogenate is then centrifuged on a Percoll gradient that allows separation of brain-sequestered leukocytes (BSL) from myelin and other tissue debris. Isolated cells are then washed, counted using a hemocytometer and stained with fluorescent antibodies for subsequent analysis by flow cytometry.
This procedure allows comprehensive phenotypic characterization of inflammatory leukocytes migrating to the brain in response to various stimuli, including stroke as well as viral or parasitic infections. The method also provides a useful tool for assessment of novel anti-inflammatory treatments in pre-clinical animal models.

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

A method for isolation of adherent inflammatory leukocytes from brain blood vessels of Plasmodium berghei ANKA-infected mice is described. The method allows quantification as well as phenotypic characterization of isolated leukocytes after staining with fluorescent antibodies and subsequent analysis by flow cytometry.

Isolement et analyse de Brain-séquestrés de leucocytes<em&gt; Plasmodium berghei</em&gt; ANKA-souris infectées

We describe a method for isolation and  characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. ...

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the &asymp;40% limit, the investigator usually keeps the percentage at around 10%. In many cases it is necessary to isolate the parasite-containing red blood cells (RBCs) from the uninfected ones, to enrich the culture and proceed with a given experiment. 
When P. falciparum infects the erythrocyte, the parasite degrades and feeds from haemoglobin 2, 3. However, the parasite must deal with a very toxic iron-containing haem moiety 4, 5. The parasite eludes its toxicity by transforming the haem into an inert crystal polymer called haemozoin 6, 7. This iron-containing molecule is stored in its food vacuole and the metal in it has an oxidative state which differs from the one in haem 8. The ferric state of iron in the haemozoin confers on it a paramagnetic property absent in uninfected erythrocytes. As the invading parasite reaches maturity, the content of haemozoin also increases 9, which bestows even more paramagnetism on the latest stages of P. falciparum inside the erythrocyte.
Based on this paramagnetic property, the latest stages of P. falciparum infected-red blood cells can be separated by passing the culture through a column containing magnetic beads. These beads become magnetic when the columns containing them are placed on a magnet holder. Infected RBCs, due to their paramagnetism, will then be trapped inside the column, while the flow-through will contain, for the most part, uninfected erythrocytes and those containing early stages of the parasite.
Here, we describe the methodology to enrich the population of late stage parasites with magnetic columns, which maintains good parasite viability 10. After performing this procedure, the unattached culture can be returned to an incubator to allow the remaining parasites to continue growing.

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

The paramagnetic properties of hemozoin are used to isolate late stages of Plasmodium falciparum-infected red blood cells growing in culture. The method is simple and fast and does not affect the subsequent invasive capabilities of the parasites.

Séparation de<em&gt; Plasmodium falciparum</em&gt; Late Phase érythrocytes infectés par des moyens magnétiques

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the ...

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of free merozoites from the blood by phagocytic cells. However assessing the functional efficacy of merozoite specific opsonizing antibodies is challenging due to the short half-life of merozoites and the variability of primary phagocytic cells. Described in detail herein is a method for generating viable merozoites using the E64 protease inhibitor, and an assay of merozoite opsonin-dependent phagocytosis using the pro-monocytic cell line THP-1. E64 prevents schizont rupture while allowing the development of merozoites which are released by filtration of treated schizonts. &#160;Ethidium bromide labelled merozoites are opsonized with human plasma samples and added to THP-1 cells. Phagocytosis is assessed by a standardized high throughput protocol. Viable merozoites are a valuable resource for assessing numerous aspects of P. falciparum biology, including assessment of immune function. Antibody levels measured by this assay are associated with clinical immunity to malaria in naturally exposed individuals. The assay may also be of use for assessing vaccine induced antibodies. &#160;

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Measuring antibody function is key to understanding immunity to Plasmodium falciparum malaria. This method describes the purification of viable merozoites, and measurement of opsonization-dependent phagocytosis by flow cytometry.

High Yield purification de<em&gt; Plasmodium falciparum</em&gt; Mérozoïtes Pour utilisation en opsonisants Anticorps dosages

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, therefore, suitable to be used for routine purposes. For best resolution, data evaluation and data management, a miniaturized electrophoresis system is required. Together with such an electrophoresis system and the in-house developed software (freely available here) assignment of the pattern of bands to a genotype is standardized and straight forward. DNA extraction is simple (boiling prep), setting-up of the reactions is easy and they can be run on any standard PCR machine. PCR cycling is common except prolonged ramping and elongation times. Compared to spa typing and Multi Locus Sequence Typing (MLST), RS-PCR does not require DNA sequencing what simplifies the analysis considerably and allows a high throughput. Furthermore, the resolution for bovine strains of S. aureus is at least as good as spa typing and better than MLST or pulsed-field gel electrophoresis (PFGE). The RS-PCR data base includes presently a total of 141 genotypes and variants. The method is highly associated with the virulence gene pattern, contagiosity and pathogenicity of S. aureus strains involved in bovine mastitis. S. aureus genotype B (GTB) is contagious and causes herds problems causing large costs in the Switzerland and other European countries. All the other genotypes observed in Switzerland infect individual cows and quarters. Genotyping by RS-PCR allows the reliable prediction of the epidemiological and the pathogenic potential of S. aureus involved in bovine intramammary infection (IMI), two key factors for clinical veterinary medicine. Because of these beneficial properties together with moderate costs and a high sample throughput the goal of this publication is to give a detailed, step-by-step protocol for easily establishing and running RS-PCR for genotyping S. aureus in other laboratories.

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

Here, ribosomal spacer PCR (RS-PCR) is used together with a miniaturized electrophoresis system as a fast and high resolution method for genotyping S. aureus at moderate costs allowing a high throughput.

génotypage des<em&gt; Staphylococcus aureus</em&gt; par Ribosomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

Using Phylogenetic Analysis to Investigate Eukaryotic Gene Origin

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct a tree to show the evolutionary relationship among different taxa (classification units) at the molecular level. Phylogenetic analysis can also be used to investigate domain relationships within an individual taxon, particularly for organisms that have undergone substantial change in morphology and physiology, but for which researchers lack fossil evidence due to the organisms&#39; long evolutionary history or scarcity of fossilization.
In this text, a detailed protocol is described for using the phylogenetic method, including amino acid sequence alignment using Clustal Omega, and subsequent phylogenetic tree construction using both Maximum Likelihood (ML) of Molecular Evolutionary Genetics Analysis (MEGA) and Bayesian Inference via MrBayes. To investigate the origin of eukaryotic Sugars Will Eventually be Exported Transporters (SWEET) genes, 228 SWEETs including 35 SWEET proteins from unicellular eukaryotes and 57 SemiSWEET proteins from prokaryotes were analyzed. Interestingly, SemiSWEETs were found in prokaryotes, but SWEETs were found in eukaryotes. Two phylogenetic trees constructed using theoretically distinct methods have consistently&#160;suggested that the first eukaryotic SWEET gene might stem from the fusion of a bacterial SemiSWEET gene and an archaeal SemiSWEET gene.&#160;It is worth noting that one should be cautious to draw a conclusion based only on phylogenetic analysis, although it is useful to explain the underlying relationship between different taxa, which is difficult or even impossible to discern through experimental means.

A method of constructing a phylogenetic tree based on sequence homology of SWEETs from eukaryotes and SemiSWEETs from prokaryotes is described. Phylogenetic analysis is a useful tool for explaining the evolutionary relatedness between homologous proteins or genes from different organism groups.

À l’aide de l’analyse phylogénétique pour étudier l’origine de gènes eucaryotes

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct ...

Bone Marrow Transplantation Platform to Investigate the Role of Dendritic Cells in Graft-versus-Host Disease

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to eradicate tumors. However, its application is limited by the development of graft-versus-host disease (GVHD), a major complication of BMT. GVHD is evoked when T-cells in the donor grafts recognizealloantigen expressed by recipient cells and mount unwanted immunological attacks against recipient healthy tissues. Thus, traditional therapies are designed to suppress donor T-cell alloreactivity. However, these approaches substantially impair the GVL effect so that the recipient&#39;s survival is not improved. Understanding the effects of therapeutic approaches on BMT, GVL, and GVHD, is thus essential. Due to the antigen-presenting and cytokine-secreting capacities to stimulate donor T-cells, recipient dendritic cells (DCs) play a significant role in the induction of GVHD. Therefore, targeting recipient DCs becomes a potential approach for controlling GVHD. This work provides a description of a novel BMT platform to investigate how host DCs regulate GVH and GVL responses after transplantation. Also presented is an effective BMT model to study the biology of GVHD and GVL after transplantation.

Graft-versus-host disease is a major complication after allogeneic bone marrow transplantation. Dendritic cells play a critical role in the pathogenesis of graft-versus-host disease. The current article describes a novel bone marrow transplantation platform to investigate the role of dendritic cells in the development of graft-versus-host disease and the graft-versus-leukemia effect.

Plate-forme de transplantation de moelle osseuse pour étudier le rôle des cellules dendritiques dans la maladie de greffe-contre-hôte

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to ...