A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.
במחזור (של תא-חינם) מיקרו-רנ"א (miRNAs) משתחררים מתאי לתוך זרם הדם. סכום של מיקרו-רנ"א ספציפי במחזור נקשר למצב המחלה ויש לו פוטנציאל לשמש סמן ביולוגי למחלה. שיטה רגישה ומדויקת עבור מחזורי כימות microRNA באמצעות כימיה מבוססת לצבוע צַחצוֹחִית טכנולוגית PCR דיגיטלית פותחה לאחרונה. באופן ספציפי, באמצעות נעול חומצות גרעין (LNA) מבוססות פריימרים ספציפי מירנה עם צבע DNA מחייבת פלואורסצנטי ירוק במערכת PCR דיגיטלית תואמת אגל אפשר להשיג כימות המוחלטת של miRNAs הספציפי. כאן אנו מתארים כיצד לבצע בטכניקה זו כדי להעריך כמות מירנה נוזלים ביולוגיים, כגון פלזמה ו בסרום, הוא גם ריאלי אפקטיבי.
MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14.
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.
בידוד MicroRNA מ פלזמה או סרום
הערה: פלזמה והכנה בסרום הוא צעד רלוונטי במחזור כימות מירנה. לא מקיים הליך מועדף עבור פלזמה והכנה בסרום. הדבר היחיד שחשוב לקחת בחשבון הוא כי כל הדגימות מאותו הניסוי חייבות להיות מעובד באמצעות העבודה בדיוק. התחל 200 μl בסרום או פלזמה. RNA סה"כ יכול להיות מבודד סרום או פלזמה באמצעות ערכות זמינות מסחרי.
1. ניתוק פרוטוקול RNA (כולל מירנה)
2. שעתוק לאחור MicroRNA
3. cDNA דילול
דור אגל 4. PCR
הערה: דור אגל צריך להתבצע ב -8 דגימות בכל פעם. משכפל טכני אינו נדרש, בשל השחזור הגבוה של טכנולוגיה זו 12,15 .א אין שליטת תבנית (NTC) מדגם צריך לרוץ בכל צלחת עבור כל תנאי ddPCR שונים.
5. קריאה אגל
הסכום המוחלט של miRNAs ספציפי לכל מיליליטר של פלזמה או בסרום ניתן לקבוע באמצעות צבע DNA מחייבת ניאון ירוק אַגְלִיל הטכנולוגיה PCR דיגיטלי. איור 1 מציג את התהליך של סלקציה חיובית-טיפות, אשר קובע את הריכוז מירנה הסופי (עותקים / μl ) ב תגובת ההגברה מחו?...
miRNAs במחזור הנוכחים בדם בריכוזים נמוכים מאוד וכמות רנ"א שיכול להיות מופקת דגימות פלזמת בדם היא נמוכה. מסיבה זו, הם קשה לכמת עם טכניקות אחרות כגון microarray וסדר RNA. יתר על כן, קיימת חוסר כללי של הסכם על נורמליזצית נתונים ואת הנוכחות של miRNAs "ייחוס" אנדוגני בדם. בהקשר ז?...
The authors have nothing to disclose.
בתמיכה כספית של האגודה האיטלקית לחקר הסרטן (AIRC) כדי MF (MFAG 11,676) וכדי MN (לאונקולוגיה קלינית מולקולרית תכנית מיוחדת -. 5 לכל n mille 9980, 2010/15) ומהמשרד של הוראה האיטלקית, האוניברסיטה מחקר FIRB 2011 MN (פרויקט RBAPIIBYNP).
Name | Company | Catalog Number | Comments |
miRNeasy Mini Kit | Qiagen | 217004 | Columns for total RNA, including miRNA, extraction from serum/plasma |
100 nmole RNA oligo Cel-miR-39-3p | Integrated DNA Technologies | Custom | Sequence: UCACCGGGUGUAAAUCAGCUUG |
Universal cDNA synthesis kit II, 8-64 rxns | Exiqon | 203301 | Kit for microRNA reverse transcription |
MicroRNA LNA PCR primer set | Exiqon | 204000-206xxx and 2100000-21xxxxx | Primers for miRNA amplification inside droplets |
QX200 droplet generator | BioRad | 186-4002 | Instrument used for droplet reading |
QX200 droplet reader | BioRad | 186-4003 | Instrument used for droplet generation |
QuantaSoft software | BioRad | 186-3007 | Software for data collection and analysis |
PX1 PCR plate sealer | BioRad | 181-4000 | Plate sealer |
DG8 droplet generator cartridges and gaskets | BioRad | 186-4008 | Cartridges used to mix sample and oil to generate droplets |
QX200 ddPCR EvaGreen supermix | BioRad | 186-4033/36 | PCR supermix |
QX200 droplet generator oil for EvaGreen dye | BioRad | 186-4005 | Oil for droplet generation |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved