JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Bioengineering

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

Published: June 26th, 2016

DOI:

10.3791/54102

1Department of Experimental, Diagnostic and Specialty Medicine - DIMES, University of Bologna, 2Department of Morphology, Surgery and Experimental Medicine, University of Ferrara, 3Department of Life Sciences and Biotechnology, University of Ferrara, 4Department of Morphology, Surgery and Experimental Medicine and Laboratory for Technologies of Advanced Therapies (LTTA), University of Ferrara

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been linked to a disease state and has the potential to be used as disease biomarker. A sensitive and accurate method for circulating microRNA quantification using a dye-based chemistry and droplet digital PCR technology has been recently developed. Specifically, using Locked Nucleic Acid (LNA)-based miRNA-specific primers with a green fluorescent DNA-binding dye in a compatible droplet digital PCR system it is possible to obtain the absolute quantification of specific miRNAs. Here, we describe how performing this technique to assess miRNA amount in biological fluids, such as plasma and serum, is both feasible and effective.

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already des....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

MicroRNA Isolation from Plasma or Serum

Note: Plasma and serum preparation is a relevant step in circulating miRNA quantification. There is no preferred procedure for plasma and serum preparation. The only important thing to consider is that all the samples from the same experiment must be processed using exactly the same workflow. Start from 200 µl serum or plasma. Total RNA can be isolated from serum or plasma using commercially available kits.

1. Protocol for Total RNA (including mi.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The absolute amount of specific miRNAs per ml of plasma or serum can be determined using a green fluorescent DNA-binding dye and droplet digital PCR technology. Figure 1 presents the process of positive-droplets selection, which determines the final miRNA concentration (copies/µl) in the amplification reaction calculated by the analysis software. The amount of each miRNA in the blood is very different, being some miRNA species more abundant than others. Using a 1:50 .......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Circulating miRNAs are present in blood at extremely low concentrations and the amount of RNA that can be extracted from plasma and serum samples is low. For this reason, they are difficult to quantify with other techniques such as microarray and RNA sequencing. Moreover, there is a generalized lack of agreement on data normalization and the presence of endogenous "reference" miRNAs in the blood. In this context, a sensitive technology like droplet digital PCR, capable of counting the number of miRNA copies per m.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Supported by funding from the Italian Association for Cancer Research (AIRC) to MF (MFAG 11676) and to MN (Special Program Molecular Clinical Oncology - 5 per mille n. 9980, 2010/15) and from the Italian Ministry of Instruction, University and Research FIRB 2011 to MN (Project RBAPIIBYNP).

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. , (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. , (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved