אנו מודים לגורדון פרימן למתן נוגדן החסימה אנטי PD-L1. אנו מודים לצוות הרפואי ומעבדה בבית החולים הכללי מסצ&#39;וסטס וכל משתתפי המחקר לתפקיד רב הערך שלהם בפרויקט זה. מחקר זה נתמך על ידי המכון הלאומי לאלרגיה ומחלות זיהומיות של המכונים הלאומיים לבריאות (PO1 AI-080,192; DEK), הלאומי ללב ריאות ודם מכון של המכון הלאומי לבריאות (RO1 HL-092,565; DEK). DEK נתמך פרס קריירה Scholar המחקר של בריאות קרן המחקר לקוויבק (FRQS) על ידי. FP נתמך על ידי מענק מלגה של כללי וועד הפועל של בית החולים מסצ&#39;וסטס על מחקר והמוסד לבריאות הגלובלית של הרווארד (HGHI).

1. דלדול ובידוד של PBMCs באמצעות הפרדת Ficoll <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לרוקן תאי CD8 + T על ידי הוספת קוקטייל דלדול אדם CD8 + ב50 / מיליליטר μl של דם מלא. </li><li style=";text-align:right;direction:rtl"> מערבבים היטב דגירה עבור 20 דקות בטמפרטורת חדר (18-25 ° C). </li><li style=";text-align:right;direction:rtl"> לאחר דגירה, לערבב דם כל עם HBSS (תמיסת מלח מאוזנת של האנק ללא Ca 2 + או Mg 2 +) ושכבה מעל Histopaque. ספין ב340 RCF ל30 דקות (לא בלם, האצה איטית). </li><li style=";text-align:right;direction:rtl"> לאסוף PBMCs ולהעביר לחרוטי 50ml חדשים. לשטוף 2x עם 45 RPMI מיליליטר 1640 בתוספת 50 IU פניצילין, 50 מיקרוגרם / מיליליטר סטרפטומיצין, 2 מ&quot;מ L-גלוטמין, וHEPES 1% על ידי ספינינג 10 דקות ב 340 RCF. </li></ol> 2. מצור נוגדנים וגירוי אנטיגן ספציפי של תאים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תאי resuspend ב2x10 6 לכל מצב בRPMI 1640 מכיל 10% סרום אדם בתוספת 50 IU פניצילין, 50 מיקרוגרם / מיליליטר סטרפטומיצין, 2 מ&quot;מ L-גלוטמין, ו -1% HEPES,היווה 500 μl לכל מצב. </li><li style=";text-align:right;direction:rtl"> Aliquot 500 μl של תא השעיה לכל צינור FACS. </li><li style=";text-align:right;direction:rtl"> בהתאם למסלול שנחקר, להוסיף PD-L1, IL-10Rα חסימת נוגדנים ו / או בקרות אלוטיפ ב10 מיקרוגרם / מיליליטר ו דגירה במשך 15 דקות ב37 מעלות צלזיוס, 5% CO 2. </li><li style=";text-align:right;direction:rtl"> לעורר תאים עם בריכת פפטיד HIV-1 Gag בריכוז סופי 1 מיקרוגרם / מיליליטר / פפטיד. כמו כן כולל שליטת &quot;אין גירוי&quot; לכל מצב חסימה. לדגור על 37 מעלות צלזיוס, 5% CO 2 למשך 48 שעות. </li></ol> 3. איסוף וניתוח של supernatant <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאחר 48 שעות, ספין למטה צינורות FACS ל7 דקות ב340 RCF. </li><li style=";text-align:right;direction:rtl"> לאסוף בזהירות 2 x 225 supernatant μl בצינורות Eppendorf עבור מערכי חרוז Luminex מבלי להפריע גלולה. </li><li style=";text-align:right;direction:rtl"> להשבית וירוס בsupernatant נאסף עם 25 μl 0.5% PBS-Tween לתת ריכוז סופי של 0.05% PBS-Tween. </li><li style=";text-align:right;direction:rtl"> supernatants חנות שנאסף שאינם immediately משמש ב-80 ° C במקפיא. </li><li style=";text-align:right;direction:rtl"> למדוד ריכוזים ציטוקינים רצויים באמצעות ערכת Millipore Luminex על פי הפרוטוקול של היצרן. </li></ol> 4. איסוף וניתוח פנוטיפי של תאים באמצעות cytometry הזרימה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאחר איסוף supernatant, לשטוף תאים ב-PBS 3ml. ספין תאים למשך 7 דקות ב340 RCF ולמזוג לשטוף עודף. </li><li style=";text-align:right;direction:rtl"> כתם לכדאיות באמצעות ערכת כתם תאים מתות בשידור חי / DEAD ניתן לתקן על פי הפרוטוקול של היצרן. </li><li style=";text-align:right;direction:rtl"> שטפו תאי PBS למשך 7 דקות ב340 RCF וב 4 ° C. Resuspend ב 100 μl FBS 1% PBS. </li><li style=";text-align:right;direction:rtl"> אם מכתים את מונוציטים או תאי המציגים אנטיגנים אחרים, קולטני Fc בלוק על ידי הוספת 1.4 μl של FCR חסימה מגיב ומערבולת לערבב. </li><li style=";text-align:right;direction:rtl"> דגירה של 10 דקות ב 4 ° C. </li><li style=";text-align:right;direction:rtl"> הוספת נוגדני פני השטח, מערבולת, ו דגירה של 20 דקות ב 4 ° C בחושך. </li><li style=";text-align:right;direction:rtl"> שטוף תאים עם FBS 1% PBS, למזוג שטיפה עודפת, ולהוסיף 200 paraformaldehyde μl 4%. לדגורבטמפרטורת חדר למשך 20 דקות בחושך. </li><li style=";text-align:right;direction:rtl"> שטוף תאים עם FBS 1% PBS, resuspend ב 250 μl FBS 1% PBS, ולרכוש בmultilaser cytometer זרימה (לדוגמא BD LSRII או Fortessa). </li></ol> 5. ניתוח של תאים באמצעות qRT-PCR <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לתאים לא ניתח באמצעות cytometry זרימה: לאחר איסוף supernatant, תאי lyse ב300 μl RLT Qiagen המאגר המכיל 1% בטא mercaptoethanol. אם לא ממשיך בפרוטוקול, ניתן להקפיא תאים ב -80 ° C לאחר שלב זה. </li><li style=";text-align:right;direction:rtl"> בודד RNA באמצעות ערכת בידוד RNA הבאה הפרוטוקול של היצרן. </li><li style=";text-align:right;direction:rtl"> לסנתז cDNA מ-RNA באמצעות ערכת סינתזת cDNA הבאה הפרוטוקול של היצרן. </li><li style=";text-align:right;direction:rtl"> לבצע PCR כמותיים תוך שימוש בטכנולוגית SYBR ירוק. </li><li style=";text-align:right;direction:rtl"> ליצור תמהיל פריימר עבור כל צבע יסוד המשמש כוללים גנים משק בית (למשל IL-13, IL-10, IFN-γ, GAPDH) על ידי הוספת פריימרים לnuclease ללא מים לתת ריכוז סופי של 10מיקרומטר. שמור על קרח. </li><li style=";text-align:right;direction:rtl"> יצירת תערובת הורים עבור כל צבע יסוד על ידי הוספת מים 10.5 μl nuclease חינם, 12.5 ירוק SYBR μl, ותמהיל פריימר μl 1 לכל צלחת היטב. שמור על קרח. </li><li style=";text-align:right;direction:rtl"> פיפטה תערובת הורים 24 μl לבאר כל הצלחת שתשמש. </li><li style=";text-align:right;direction:rtl"> הוספת cDNA μl 1 היטב כל אחד על פי תבנית. </li><li style=";text-align:right;direction:rtl"> כובע בארות וצלחת צנטריפוגות במשך 3 דקות ב800 RCF. </li><li style=";text-align:right;direction:rtl"> הפעל צלחת על מכונה qRT-PCR, למשל מכשיר Stratagene MX3005P. </li></ol> 6. הסתגלות לתאית ציטוקין הכתמה ב48 שעות הוספת Brefeldin וMonensin 6 שעות לפני מכתים ציטוקינים תאיים. Brefeldin מתווסף בריכוז של 10 מיקרוגרם / מיליליטר בזמן Monensin מתווסף על פי הוראות יצרן. לנוחיותכם, ניתן להוסיף Brefeldin 12 שעה לפני להכתים בריכוז של 5 מיקרוגרם / מיליליטר. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> אחרי כתם פני השטח, לשטוף תאים עם FBS PBS 1% וכתם בציטוקינים tracellular כגון IL-12, IFN-γ, ו-TNF-α באמצעות ערכת קיבוע / permeabilization פתרון ופרוטוקול. </li><li style=";text-align:right;direction:rtl"> שטוף תאים, resuspend ב 250 μl FBS 1% PBS, ולהפעיל על multilaser cytometer זרימה (LSR למשל BD השני או Fortessa). </li></ol> 7. הסתגלות למיון תאים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> 16 שעות לאחר גירוי, כתם לכדאיות באמצעות ערכת כתם תאים מתות בשידור חי / DEAD ניתן לתקן על פי הפרוטוקול של היצרן. שמור את התאים על קרח במהלך ההליך כולו. </li><li style=";text-align:right;direction:rtl"> שטוף תאים עם PBS במשך 7 דקות ב340 RCF וב 4 ° C. Resuspend ב 100 μl FBS 1% PBS. </li><li style=";text-align:right;direction:rtl"> הוספת נוגדני פני השטח, מערבולת לערבב, ותאי דגירה על קרח בחושך עבור 20 דקות. </li><li style=";text-align:right;direction:rtl"> שטפו תאים עם FBS 1% PBS ב340 RCF וב 4 ° C ו resuspend ב 500 μl RPMI הקר 1640 המכיל 10% בסרום שור עוברי בתוספת 50 IU פניצילין, 50 מיקרוגרם / מיליליטר סטרפטומיצין, 2 מ&quot;מ L-גלוטמין, ו -1% HEPES. </li><li style=";text-align:right;direction:rtl"> תאי סינון באמצעות 5 מיליליטר פוליסטTube מסביב לתחתית רנה עם מכסה תא מסננת. </li><li style=";text-align:right;direction:rtl"> הכן צינורות איסוף למין על ידי הוספת 200 RPMI μl 1640 המכיל 10% בסרום שור עוברי בתוספת 50 IU פניצילין, 50 מיקרוגרם / מיליליטר סטרפטומיצין, 2 מ&quot;מ L-גלוטמין, וHEPES 1% לצינור אחד. שמור את כל הצינורות על קרח במהלך מיון. </li><li style=";text-align:right;direction:rtl"> בשידור חי למיין את תת התא של ריבית על מכשיר (לדוגמא BD FACS Aria II) ממוקם במתקן המצויד לחומרים ביולוגיים מסוכנים. </li><li style=";text-align:right;direction:rtl"> אחרי התאים מוינו, תאי מקום בחזרה בחממה לסכום רצוי של זמן ופעל עם ניתוח אוסף supernatant / Luminex וניתוח אוסף התא גלולה / ה-PCR. </li></ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

החוקרים מצהירים כי אין להם אינטרסים כלכליים מתחרים.

אוסף supernatant הוא חלק הכרחי של עיצוב ניסיוני זה. כאשר קצירת supernatants עבור assay Luminex, aliquots נעשו והמשיכו ב-80 ° C כדי למנוע פירוק חלבונים בשל ההפשרה להקפיא מחזורים. הקפאה והפשרה יכולה להיות תהליכים קשים לחלבונים, ועל ידי מזעור הקפאה מפשירה, אות תהיה מוגדלת במבחנים. לכן, קל יותר ל?...

במהלך זיהומים נגיפיים מתמשכים, תאים הספציפי-T וירוס לרכוש ליקויים תפקודיים בתהליך המכונה תשישות תא T. בשלב מוקדם במחקרי vivo במודל העכברי LCMV של זיהום נגיפי כרוני ציין כי תאי T ספציפי וירוס המותשים צמצמו פונקצית cytolytic כנגד תאים נגועים בנגיף, לאבד את היכולת שלהם להתרבות וצמצמו יכולת לייצר ציטוקינים כגון IL-2, TNF- α וIFN-γ 1,2. רשת מורכבת של מסלולי immunoregulatory, כגון PD-1 ו-IL-10, הם שהוגברו במהלך זיהומים כרוניים ותורמת לתפקוד תא T (הנסקרת ב 3,4). בvivo ממשל של חסימת נוגדנים נגד מסלולים מעכבים אלו בעכבר LCMV דגם משוחזר תפקוד של תאי T ספציפי וירוס מותשים וסליקה נגיפית משופרת, המציין כי תשישות תא T היא תופעה הפיכה באופן חלקי (הנסקרת ב 5). ממצאים על המודל LCMV דואר הוארך במהירות לדלקות ויראליות כרוניות אנושיות כמו HBV, HCV ו-HIV 5. בהידבקות ב-HIV-1 כרונית, PD-1 ו-IL-10 מסלוליהם הוגברו בנושאים נגועים ולתאם עם פרמטרים של התקדמות מחלה, באופן ישיר עם העומס הנגיפי והפכו עם CD4 לספור 6-8. מצור נוגדן של מסלולי PD-1 או IL-10 בהתפשטות מבחנה המשוחזרת של תאי CD4 ו CD8 T-HIV ספציפיים המצביעים על כך, בדומה למודל של עכברי LCMV, תשישות תא T בבני האדם היא תופעה הפיכה באופן חלקי. עם זאת, בשל האופי העדין של ניסויים על דגימות אנושיות, כמו גם מגבלות ברגישות של מבחני חוץ גופייה, חקירה יסודית של פרופילי השיקום התפקודי הושגו על ידי התערבויות אלה הוא בולטים נעדרו. מבחני למניעת הפצת נשק היו, עד כה, המבחנה assay אמין רק בנבדק במרבית המחקרים, אך יש חוסר מדהים של ראיות על ההשפעה של בין אלהventions על: 1) יכולת ההרג של תאי T ציטוטוקסיים, 2) השפעת נגיפים של תאי T על שכפול נגיפי, 3) פרופיל הפרשת ציטוקינים, ו4) ההשפעה על עזרה תא T מסוג CD4 בתת תא אחר. מכתים ציטוקינים תאיים (ICS) הוא זרימה מאוד שימושית ושימוש נרחב assay המבוסס cytometry המשמש לזיהוי ייצור של ציטוקינים בסוגי תאים שונים בשני עכברים ובני אדם. כמו כן, נעשה שימוש כדי לחקור את ההשפעה של מצור נוגדן של מסלולים מעכבים. במבחני ICS, הפרשת ציטוקינים חסומה על ידי התוספת של Brefeldin ו / או Monensin. ציטוקינים לכודים בתוך התאים ולאחר מכן זוהו עם נוגדני ניאון באמצעות cytometry זרימה צבעוני. משך assay הוא מוגבל בדרך כלל 6 או 12 שעות לאחר גירוי אנטיגן שכן הן Brefeldin וMonensin, אשר מתווספים בדרך כלל תוך 2 שעות של בנוסף אנטיגן, הם רעילים לתאים. ICS assay הוא טכניקה רבת עוצמה שהייתה לי שימושיn החקירה של ההשפעה של in vivo ממשל של חסימת התערבות נוגדנים בעכברים שבו תאים שהוצאו לאחר תקופה מסוימת של זמן לאחר חשיפת נוגדן 9. עם זאת, ישנן מספר מגבלות ליישום של גישה ניסויית זה כדי להעריך את ההשפעה של המצור על קולטנים מעכבים בדגימות אנושיות. בעת ביצוע התערבויות נוגדן של מסלולים מעכבים בגירוי 6 או 12 שעות במבחנה (בדרך כלל במקרה של דגימות אנושיות), המצור על קולטנים מעכבים ברוב המקרים אינו משנה את התדירות של תגובת תאי T אנטיגן הספציפי כפי שהיא נמדדת על ידי מבחני סטנדרטיים ICS 6, 7. מדידות של ייצור ציטוקינים לכל תא כפי שהיא נמדדת על ידי עוצמת הקרינה ממוצעת או החציוני נתנו תוצאות לא עקביות 6, 7, 10. מצד השני, כאשר ICS מתבצע בנקודת זמן מאוחר לאחר גירוי (כלומר שישה ימים), שינויים במספר ג מפרישי ציטוקיניםניתן לצפות אמות. ההבדלים הם השפעה משולבת של התפשטות שהשתנתה, הישרדות, ושינויים בתפקוד מפעיל המצטברים על פני תקופת הזמן המוגדרת 6. דרך אחת להתגבר באופן חלקי על המגבלות האלה היא כדי לדגור במשך תקופות זמן ארוכות יותר (36 שעה למשל, 60 שעה, וכו &#39;.) עם האנטיגן לפני התוספת של חוסם הפרשת ציטוקינים מבלי להמתין ללהתרחש התפשטות. אנחנו השתמשנו בהצלחה בשיטה זו כדי לקבוע את קינטיקה של הפרשת ציטוקינים על ידי תאי CD4 ו CD8 T-HIV הספציפיים 11,12, עם זאת, גישה זו אינה מסוגלת לזהות את תגובות קטנות ולא תיתן תוצאה משולבת של סך הפרשת ציטוקינים המתרחשת מאז גירוי. לכן, ICS הוא לא מספיק שיטה רגישה כדי לזהות את ההשפעה של מצור של מסלולים מעכבים על הכמות של ציטוקינים המיוצרת על ידי תאי T מופעלים לעומת quantitation ציטוקינים mRNA או מדידות של הפרשת ציטוקינים בsupernatanלא באותן נקודות הזמן. בנוסף, רוב ציטוקינים המיוצרים על ידי תאי T מופעלים לפעול באופנה autocrine על ידי תרומה למשוב חיובי או שלילי לולאות באמצעות אינטראקציה עם תאי המציגים אנטיגנים. לכן, תוספת של Brefeldin או Monensin במהלך assay ICS מונעת הפרשת ציטוקינים וכך הגירוי של תאי T הוא לא אופטימלי. לבסוף, זיהוי של ציטוקינים מרובים עם ICS הוא מוגבל על ידי זמינה והרגישות של נוגדנים לזיהוי של ציטוקינים עם cytometry זרימה, כמו גם מאילוצים במספר fluorochromes, שניתן להשתמש בו זמנית בכל פנל נתון. פיתחנו במבחנה גישה ניסויית רגישה מאוד כדי להעריך את ההשפעה של מסלולי immunoregulatory בויסות הפרשת ציטוקינים על ידי תאי T מסוג CD4 HIV-ספציפיים ולאחר מכן עזרה CD4 לאנטיגן הצגת תאים (נגמ&quot;שים) ותאי הרג טבעי (תאי NK). גם בשיטה זו ניתן להשתמש כדי להעריך את סבלנותct של מצור של מולקולות מעכבות על תפקוד תאי CD8 T על ידי depleting תאי T מסוג CD4 מPBMCs או על ידי גירוי עם פפטידים אופטימליים שמוכרים רק על ידי תאי CD8 T. בניגוד למבחני מכתים ציטוקינים תאיים, החלטנו שלא להתערב בהפרשת ציטוקינים על ידי תאי T מסוג CD4 HIV-ספציפיים על מנת להיות מסוגל: 1) לבצע כימות מדויק יותר של רמות ציטוקינים המיוצרים; 2) לחקור פנל רחב יותר של ציטוקינים או מולקולות מפעיל: 3) להעריך את ההשפעה של ציטוקינים המיוצרים על ידי תאי T מסוג CD4 HIV-ספציפיים על תת תא אחר. אנו לעורר PBMCs המדולדלת CD8 עם בריכת פפטיד Gag-HIV-1 בנוכחות חסימת נוגדנים למסלול immunoregulatory של עניין. לאחר הזמן הרצוי של דגירה, בדרך כלל 48 שעות, אנו אוספים supernatants למדוד הפרשת ציטוקינים עם מערכי חרוז ולאסוף את כדורי תא או לניתוח פנוטיפי של תת תא אחר או לניתוח תעתיק. של לב, בזמן t48 נקודת זמן שעות שלו, אנחנו לא לזהות אוכלוסייה משמעותית של תאים מתרבים T 12. זוהי גישה גמישה וכמה עיבודים של עיצוב זה יכול להיות מיושמים לטיפול בהשערות שונות. לדוגמא, תת תאים הבודדים (כגון תאי HIV-ספציפיים T מסוג CD4 או PD-1 תאי T מסוג CD4 גבוהים, וכו &#39;.) ניתן למיין לאחר 12 שעות של דגירה לפני דגירה נוספת ל36 שעה אחריו אוסף של supernatants וכדורי תא כדי לחקור באופן ספציפי יותר את ההשפעה של התערבויות מצור על הפרשת ציטוקינים על ידי אוכלוסיות מוגדרות של PBMCs.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		 </tr>
		 <tr>
			<td>Hanks Balanced Salt Solution without Ca2+ or Mg2+</td>
			<td>Sigma</td>
			<td>H9394</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RPMI 1640</td>
			<td>Sigma</td>
			<td>R0883</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Histopaque-1077</td>
			<td>Sigma</td>
			<td>10771</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Human Serum AB</td>
			<td>Gemini BioProducts</td>
			<td>100-512</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Penicillin/Streptomycin</td>
			<td>Mediatech</td>
			<td>30 001 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>L-glutamine</td>
			<td>Mediatech</td>
			<td>25 005 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>HEPES buffer</td>
			<td>Mediatech</td>
			<td>25060CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>FcR blocking reagent, human</td>
			<td>Miltenyi</td>
			<td>130-059-901</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RosetteSep Human CD8+ Depletion Cocktail </td>
			<td>Stem Cell </td>
			<td>15663</td>
			<td></td>
		 </tr>
		 <tr>
			<td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td>
			<td>Invitrogen</td>
			<td>L23105</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Rneasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Improm-II Reverse Transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Brilliant II SYBR qPCR Low Rox Master Mix</td>
			<td>Agilent</td>
			<td>600830</td>
			<td></td>
		 </tr>
		 <tr>
			<td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td>
			<td>BD</td>
			<td>554714</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Tween-20</td>
			<td>Fisher</td>
			<td>BP337100</td>
			<td></td>
		 </tr>
		 <tr>
			<td>IFN-&gamma; primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td>
		 </tr>
		 <tr>
			<td>GAPDH primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td>
		 </tr>
		</tbody>
 </table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

תשישות תא T היא גורם מרכזי בסילוק הפתוגן נכשל במהלך זיהומים נגיפיים כרוניים. מסלולי immunoregulatory, כגון PD-1 ו-IL-10, הם שהוגברו בחשיפה אנטיגן המתמשכת הזה ולתרום לירידה של התפשטות, פונקצית cytolytic מופחתת, ולקויי ייצור ציטוקינים על ידי תאי CD4 ו CD8 T. במודל העכברי של זיהום LCMV, מנהלה של חסימת נוגדנים כנגד שני מסלולים אלה בתוספת תגובות תא T. עם זאת, אין כיום assay במבחנה כדי למדוד את ההשפעה של מצור כזה על הפרשת ציטוקינים בתאים מדגימות אנושיות. הפרוטוקול והגישה ניסויית שלנו מאפשרים לנו באופן מדויק ויעיל לכמת את השיקום של ייצור ציטוקינים על ידי תאי T מסוג CD4 HIV-ספציפיים מנבדקים נגועים ב-HIV. כאן, אנו מתארים במבחנה עיצוב ניסיוני המאפשר מדידות של הפרשת ציטוקינים על ידי תאי T מסוג CD4 HIV-ספציפיים ואת השפעתן על cel האחרתת ליטר. תאי CD8 T היו מתרוקנים מכל הדם וPBMCs שנותרה היו מבודדות באמצעות שיטת הפרדת Ficoll. PBMCs המדולדלת CD8 אז הודגרו עם חסימת נוגדנים כנגד PD-L1 ו / או IL-10Rα, ולאחר גירוי עם בריכת פפטיד Gag-HIV-1, תאים הודגרו על 37 מעלות צלזיוס, 5% CO 2. לאחר 48 שעה, supernatant נאסף לניתוח ציטוקינים על ידי מערכי חרוזים וכדורי תא נאספו גם עבור ניתוח פנוטיפי באמצעות cytometry זרימה או ניתוח תעתיק באמצעות qRT-PCR. לניתוח מפורט יותר, אוכלוסיות תאים שונות התקבלו על ידי דלדול משנה סלקטיבית מPBMCs או על ידי מיון באמצעות cytometry זרימה לפני שהוערך באותה מבחני. שיטות אלה מספקות גישה רגישה וספציפית מאוד על מנת לקבוע את האפנון של ייצור ציטוקינים על ידי תאי T-helper אנטיגן הספציפי ולקבוע יחסי גומלין פונקציונליים בין אוכלוסיות השונות של תאים חיסוניים.

בעת ביצוע מדידות ציטוקינים באמצעות מערכת זו במבחנה, זה הכרחי כדי להיות מסוגל להבחין בין תגובות אנטיגן הספציפי בהשוואה לשום שליטת גירוי. באופן כללי, אנחנו נחשבים לתגובות חיוביות כמו כל ערכים של גירוי אנטיגני שנותנות עלייה לפחות פי שלוש ברמות ציטוקינים בהשוואה ל?...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

פיתחנו assay במבחנה כדי לחקור את התפקיד של מסלולי immunoregulatory בויסות הפרשת ציטוקינים על ידי תאי T מסוג CD4 HIV-ספציפיים.

במבחנה Assay כדי להעריך את ההשפעה של immunoregulatory מסלולים על פונקצית Effector הנייד HIV-ספציפית T מסוג CD4

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Research

JoVE Journal

Immunology and Infection

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

14.0K Views.  The Ragon Institute of MGH, MIT and Harvard.  פיתחנו assay במבחנה כדי לחקור את התפקיד של מסלולי immunoregulatory בויסות הפרשת ציטוקינים על ידי תאי T מסוג CD4 HIV-ספציפיים. 

Video: In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&amp;#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

בידוד ובידול של Th17 הנאיביים T מסוג CD4 לימפוציטים

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Transplantation of Tail Skin to Study Allogeneic CD4 T Cell Responses in Mice

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and host T cells, to easily monitor the graft, and to adapt the system in order to answer different immunological questions. Medawar and colleagues established allogeneic tail-skin transplantation in mice in 1955. Since then, the skin transplantation model has been continuously modified and adapted to answer specific questions. The use of tail-skin renders this model easy to score for graft rejection, requires neither extensive preparation nor deep anesthesia, is applicable to animals of all genetic background, discourages ischemic necrosis, and permits chemical and biological intervention. 
In general, both CD4+ and CD8+ allogeneic T cells are responsible for the rejection of allografts since they recognize mismatched major histocompatibility antigens from different mouse strains. Several models have been described for activating allogeneic T cells in skin-transplanted mice. The identification of major histocompatibility complex (MHC) class I and II molecules in different mouse strains including C57BL/6 mice was an important step toward understanding and studying T cell-mediated alloresponses. In the tail-skin transplantation model described here, a three-point mutation (I-Abm12) in the antigen-presenting groove of the MHC-class II (I-Ab) molecule is sufficient to induce strong allogeneic CD4+ T cell activation in C57BL/6 mice. Skin grafts from I-Abm12 mice on C57BL/6 mice are rejected within 12-15 days, while syngeneic grafts are accepted for up to 100 days. The absence of T cells (CD3-/- and Rag2-/- mice) allows skin graft acceptance up to 100 days, which can be overcome by transferring 2 x 104 wild type or transgenic T cells. Adoptively transferred T cells proliferate and produce IFN-&#947; in I-Abm12-transplanted Rag2-/- mice.

Tail-skin transplantation is a powerful model for studying T cell-dependent rejection and tolerance induction during allogeneic immune responses in mice. The advantages of this protocol are minor invasive surgery, and ease of monitoring with no need to sacrifice the recipient mouse.

השתלה של עור זנב לחקר תגובות תא Allogeneic T מסוג CD4 בעכברים

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and ...

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte function, in general these are limited in terms of the information they can provide. For example, most existing assays merely provide a percentage of how many granulocytes are activated following a single, fixed length incubation. Complicating matters, most assays focus on only one aspect of function due to limitations in detection technology. This report demonstrates a technique for simultaneous measurement of granulocyte phagocytosis of bacteria and oxidative burst. By measuring both of these functions at the same time, three unique phenotypes of activated granulocytes were identified: 1) Low Activation (minimal phagocytosis, no oxidative burst), 2) Moderate Activation (moderate phagocytosis, some oxidative burst, but no co-localization of the two functional events), and 3) High Activation (high phagocytosis, high oxidative burst, co-localization of phagocytosis and oxidative burst). A fourth population that consisted of inactivated granulocytes was also identified. Using assay incubations of 10, 20, and 40-min the effect of assay incubation duration on the redistribution of activated granulocyte phenotypes was assessed. A fourth incubation was completed on ice as a control. By using serial time incubations, the assay may be able to able to detect how a treatment spatially affects granulocyte function. All samples were measured using an image-based flow cytometer equipped with a quantitative imaging (QI) option, autosampler, and multiple lasers (488, 642, and 785 nm).

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

This method demonstrates a technique for assessing granulocyte function by simultaneously measuring phagocytosis of bacteria and oxidative burst. Image-based flow cytometry allowed for the identification of three distinct subsets of activated granulocytes that all differed in their relative functional capacity.

טכניקת cytometry הזרימה מבוססת תמונה כדי להעריך את השינויים בפונקצית granulocyte<em&gt; במבחנה</em

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

אינדוקציה של Murine דלקת מעיים על ידי העברת המאמצת של מפעיל CD4<sup&gt; +</sup&gt; CD45RB<sup&gt; גבוה</sup&gt; תאי T לעכברי immunodeficient

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition of cognate antigen presented on MHC class II. The cytokine signals present in the environment at the time of TCR activation are a major factor in determining the effector fate of a na&#239;ve CD4+ T cell. Although the cytokine environment during na&#239;ve T cell activation may be complex and involve both redundant and opposing signals in vivo, the addition of various cytokine combinations during naive CD4+ T cell activation in vitro can readily promote the establishment of effector T helper lineages with hallmark cytokine and transcription factor expression. Such differentiation experiments are commonly used as a first step for the evaluation of targets believed to promote or inhibit the development of certain CD4+ T helper subsets. The addition of mediators, such as signaling agonists, antagonists, or other cytokines, during the differentiation process can also be used to study the influence of a particular target on T cell differentiation. Here, we describe a basic protocol for the isolation of na&#239;ve T cells from mouse and the subsequent steps necessary for polarizing na&#239;ve cells to various T helper effector lineages in vitro.

Mouse Na&amp;#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Na&#239;ve CD4+ T cells polarize to various subsets depending on the environment at the time of activation. The differentiation of na&#239;ve CD4+ T cells to various effector subsets can be achieved in vitro through the addition of T cell receptor stimuli and specific cytokine signals.

העכבר נאיבי CD4<sup&gt; +</supו&gt; בידוד תא T<em&gt; במבחנה</em&gt; בידול לתוך תת תא T

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Application of Long-term cultured Interferon-&#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is controlled up to 95 % of the T cells generated during the expansion phase are eliminated (i.e., contraction phase) and memory T cells remain, sometimes for a lifetime. In humans, two functionally distinct subsets of memory T cells have been described based on the expression of lymph node homing receptors. Central memory T cells express C-C chemokine receptor 7 and CD45RO and are mainly located in T-cell areas of secondary lymphoid organs. Effector memory T cells express CD45RO, lack CCR7 and display receptors associated with lymphocyte homing to peripheral or inflamed tissues. Effector T cells do not express either CCR7 or CD45RO but upon encounter with antigen produce effector cytokines, such as interferon-&#947;. Interferon-&#947; release assays are used for the diagnosis of bovine and human tuberculosis and detect primarily effector and effector memory T cell responses. Central memory T cell responses by CD4+ T cells to vaccination, on the other hand, may be used to predict vaccine efficacy, as demonstrated with simian immunodeficiency virus infection of non-human primates, tuberculosis in mice, and malaria in humans. Several studies with mice and humans as well as unpublished data on cattle, have demonstrated that interferon-&#947; ELISPOT assays measure central memory T cell responses. With this assay, peripheral blood mononuclear cells are cultured in decreasing concentration of antigen for 10 to 14 days (long-term culture), allowing effector responses to peak and wane; facilitating central memory T cells to differentiate and expand within the culture.

Application of Long-term cultured Interferon-&amp;#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Long-term cultured interferon-&#947; enzyme-linked immunospot assay is used as a measure of central memory responses and correlates with protective anti-mycobacterial vaccine responses. With this assay, peripheral blood mononuclear cells are stimulated with mycobacterial antigens and interleukin-2 for 14 days, enabling differentiation and expansion of central memory T cells.

יישום של assay Immunospot לטווח ארוך אינטרפרון-γ התרבותי אנזים צמוד להערכת תגובות תא מפעיל וזיכרון T בבקר

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

הדמית תא CD4 T גירת ביניים בדרמיס המוסת

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

<em&gt; במבחנה</em&gt; דגם של מחסום דם-מוח באמצעות ספקטרוסקופיית עכבה: התמקדות T Cell-אנדותל אינטראקציה תא

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, including phagocytosis of damaged synapses or cells, debris, and/or invading pathogens. Impaired phagocytic function has been implicated in the pathogenesis of diseases such as Alzheimer's and age-related macular degeneration, where amyloid-&#946; plaque and drusen accumulate, respectively. Despite its importance, microglial phagocytosis has been challenging to assess in vivo. Here, we describe a simple, yet robust, technique for precisely monitoring and quantifying the in vivo phagocytic potential of retinal microglia. Previous methods have relied on immunohistochemical staining and imaging techniques. Our method uses flow cytometry to measure microglial uptake of fluorescently labeled particles after intravitreal delivery to the eye in live rodents. This method replaces conventional practices that involve laborious tissue sectioning, immunostaining, and imaging, allowing for more precise quantification of microglia phagocytic function in just under six hours. This procedure can also be adapted to test how various compounds alter microglial phagocytosis in physiological settings. While this technique was developed in the eye, its use is not limited to vision research.

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglial phagocytosis is critical for the maintenance of tissue homeostasis and inadequate phagocytic function has been implicated in pathology. However, assessing microglia function in vivo is technically challenging. We have developed a simple but robust technique for precisely monitoring and quantifying the phagocytic potential of microglia in a physiological setting.

להערכת תפקוד רשתית microglial Phagocytic<em&gt; In vivo</em&gt; שימוש cytometry זרימה מבוסס Assay

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, ...

In Vitro Differentiation of Human CD4+FOXP3+ Induced Regulatory T Cells (iTregs) from Na&#239;ve CD4+ T Cells Using a TGF-&#946;-containing Protocol

Regulatory T cells (Tregs) are an integral part of peripheral tolerance, suppressing immune reactions against self-structures and thus preventing autoimmune diseases. Clinical approaches to adoptively transfer Tregs, or to deplete Tregs in cancer, are underway with promising first outcomes. 
Because the number of naturally occurring Tregs (nTregs) is very limited, studying certain Treg features using in vitro induced Tregs (iTregs) can be advantageous. To date, the best although not absolutely specific protein marker to delineate Tregs is the transcription factor FOXP3. Despite the importance of Tregs including non-redundant roles of peripherally induced Tregs, the protocols to generate iTregs are currently controversial, particularly for human cells. This protocol therefore describes the in vitro differentiation of human CD4+FOXP3+ iTregs from human na&#239;ve T cells using a range of Treg-inducing factors (TGF-&#946; plus IL-2 only, or their combination with retinoic acid, rapamycin or butyrate) in parallel. It also describes the phenotyping of these cells by flow cytometry and qRT-PCR. 
These protocols result in reproducible expression of FOXP3 and other Treg signature genes and enable the study of general FOXP3-regulatory mechanisms as well as protocol-specific effects to delineate the impact of certain factors. iTregs can be utilized to study various phenotypic aspects as well as molecular mechanisms of Treg induction. Detailed molecular studies are facilitated by relatively large cell numbers that can be obtained. 
A limitation for the application of iTregs is the relative instability of FOXP3 expression in these cells compared to nTregs. iTregs generated by these protocols can also be used for functional assays such as studying their suppressive function, in which iTregs induced by TGF-&#946; plus retinoic acid and rapamycin display superior suppressive activity. However, the suppressive capacity of iTregs can differ from nTregs and the use of appropriate controls is crucial.

&lt;em&gt;In Vitro&lt;/em&gt; Differentiation of Human CD4&lt;sup&gt;+&lt;/sup&gt;FOXP3&lt;sup&gt;+&lt;/sup&gt; Induced Regulatory T Cells (iTregs) from Na&amp;#239;ve CD4&lt;sup&gt;+&lt;/sup&gt; T Cells Using a TGF-&amp;#946;-containing Protocol

This protocol describes the reproducible generation and phenotyping of human induced regulatory T cells (iTregs) from na&#239;ve CD4+ T cells in vitro. Different protocols for FOXP3 induction allow for the study of specific iTreg phenotypes obtained with respective protocols.

במבחנה בידול של האדם CD4 + FOXP3 + מושרה תקינה בתאי T (iTregs) מ נאיבית CD4 + T תאים באמצעות פרוטוקול TGF-β-המכיל