פרויקט זה מומן על ידי קרן נובל סמואל רוברטס. מחברים מודים למיז. Elles ג&#39;ייני Gallaway וקולין לטיפול בצמח מצוין, והגב &#39;קייטי בראון ליצירות אמנות. כמו כן, אנו רוצים להודות למיז. טרינה קוטרל, פוג&#39;ה Uppalapati, Moumita סאהה, Swetha Vinukonda ומר יצחק גרינהוט לעזרה טכנית בהקמתה של פרוטוקול זה.

1. גידול צמחים והשתקת גני יעד <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תנאי גידול צמחים: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> נ &#39;תזרע זרעי benthamiana על אדמה פחות תערובת שתילה, מטרו-Mix 350 ואת הזרעים לנבוט בתא גידול. כל אדמה אחרת או אדמה פחות בינונית יכולה לשמש גם במקום מטרו-Mix. </li><li style=";text-align:right;direction:rtl"> השתלת שלושה בשבוע שתילים ישנים לתוך סירים בודדים ולגדל אותם בחממה המתנהלת ב21 ± 2 ° C יחד עם תנאי גידול אחרים, כמפורט בספרות קודמת 12. שניים עד שלושה ימים לאחר ההשתלה, צמחים יכולים לשמש לTRV חיסון. </li></ol></li><li style=";text-align:right;direction:rtl"> גידול TRV2 שיבוטים: TRV הוא וירוס bipartite והגנום שלו מורכב מRNA1 וRNA2. RNA1 מקודד RNA פולימראז RNA תלוי וחלבון תנועת 20,21. RNA2 מקודד חלבון מעיל (CP) ושני חלבוני nonstructural מRNAs subgenomic 21. שניהם RNA1 וRNA2 נדרשים להיווצרות של vir התבגרשלנו חלקיקים והתפשטותם 20,21. בניית ספריית cDNA בוקטור TRV2 מתוארת בספרות קודמת 22,23. בקצרה, ספריית VIGS השתמשה במחקר זה נבנתה מRNA חילוץ מרקמות עלים החשופים לelicitors יוטיים ואביוטי שונים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> קח את Agrobacterium (GV2260 זן) המכיל את השיבוטים cDNA בוקטור TRV2 (96 גם צלחת) מהמקפיא. בהדרגה להפשיר אותם ואחרי התרבויות להגיע לטמפרטורת חדר, לחסן את תרבות Agrobacterium פרט על צלחת אגר לוריא-Bertani (LB) עם ריפאמפיצין (10 מיקרוגרם / מ&quot;ל) וkanamycin (50 מיקרוגרם / מ&quot;ל) באמצעות משכפל 96 פינים. </li><li style=";text-align:right;direction:rtl"> דגירה הצלחות על 28 מעלות צלזיוס במשך יומיים. בדרך כלל אנחנו גדלים ארבע מושבות לשכפל לכל שיבוט, כך שבידוד Agrobacterium נאות זמין עבור חיסון זין של שני מפעלים. לבצע את כל השלבים בתנאים סטריליים. </li></ol></li><li style=";text-align:right;direction:rtl"> VIGS: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לגדולAgrobacterium (GV2260) נשא TRV1 על 28 מעלות צלזיוס במדיום נוזלי LB עם אנטיביוטיקה שהוזכר לעיל. קציר תאים על ידי צנטריפוגה מתרבויות גדלו לילה, מחדש להשעות בחיץ החיסון (10 מ&quot;מ MES, pH 5.5; acetosyringone מיקרומטר 200), ו דגירה במשך 3 שעות בטמפרטורת חדר על שייקר ב50 סל&quot;ד. </li><li style=";text-align:right;direction:rtl"> קציר התאים על ידי צנטריפוגה מחדש להשעות ב5 מ&quot;מ MES חיץ (pH 5.5) ולחסן (OD 600 = 0.3) לצד abaxial של 3-4 נ benthamiana משאיר באמצעות מזרק מחטים. הליך חיסון מפורט בא לידי ביטוי בספרות קודמת 24. מאוחר יותר, באתר של TRV1 חיסון, לחסן TRV2 מושבות בהתאמה ידי לדקור את העלים עם קיסם. </li><li style=";text-align:right;direction:rtl"> לשמור על הצמחים עם תזונה נאותה כצמיחה נמרצת חשובה לVIGS יעיל 12. כשני שבועות חיסון הודעה את תעתיקי גנים ממוקדים יתחילו להפחית את הצמחים והם מוכנים לחנ&quot;ל הפתוגןulation בשלושה שבועות לאחר TRV חיסון. </li></ol></li></ol> 2. הכנת תרבויות הפתוגן Nonhost וחיסון צמח <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פרטים של פתוגנים השתמשו במחקר זה: Pseudomonas syringae PV. Tabaci, פ syringae PV. עגבניות T1, פ syringae PV. glycinea וXanthomonas campestris PV. סיקטור משמשים במחקר זה. לגדול פ זני syringae בB של המלך (KB) מדיום הנוזלי בתוספת ריפאמפיצין (10 מיקרוגרם / מ&quot;ל), kanamycin (50 מיקרוגרם / מ&quot;ל) ב 28 מעלות צלזיוס למשך 12 שעות. לגדול X. campestris PV. סיקטור במדיום נוזלי LB עבור 16 שעות. כל הפתוגנים נמל פלסמיד שיכול להביע GFPuv כפי שמתואר בספרות קודמת 19. </li><li style=";text-align:right;direction:rtl"> הכנה של תרבויות פתוגן לחיסון צמח: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> קציר תאים חיידקיים על ידי צנטריפוגה ולאשר את קיומו של הקרינה ירוקה באמצעות ארוך waמנורת UV velength בחושך. לשטוף את התאים פעמיים עם מים סטריליים מחדש להשעות אותם לריכוז הרצוי להשתמש במים סטריליים. </li><li style=";text-align:right;direction:rtl"> לחסן הפתוגן בהתאמה (ים) לצד abaxial של עלים הושתקו גן המטרה (5 עד 8 ​​ה ה) כנקודות (כ -1.5 ס&quot;מ קוטר). פתוגנים nonhost כמה ניתן לבדוק בו זמנית לצמיחה שלהם במפעלים הושתקו גן המטרה. במקביל לחסן הפתוגן המארח כמו זה יכול לשמש כביקורת חיובית לצפייה בהתפתחות חיידקי planta. גם וקטור שליטה לחסן (TRV :: 00) צמחים. </li></ol></li></ol> 3. התבוננות בצמיחת planta של חיידקים פתוגנים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחשוף את העלים מחוסן לאור UV אורך גל ארוך בחושך. ניתן לצפות במושבות חיידקים כנקודות ניאון ירוקות בצד abaxial של העלה ברקע של הקרינה הנפלטת על ידי אדום פני עלה. </li><li style=";text-align:right;direction:rtl"> שים לב לצמיחת הפתוגןמימים שלאחר חיסון 2 (dpi) עד 5 dpi. תצפית יומיומית במהלך פרק זמן זה היא הכרחית. </li><li style=";text-align:right;direction:rtl"> לאחר המסך הראשון, רשימה קצרה את תוצאות השיבוטים בצמיחה של פתוגן nonhost אחד או יותר (ים) השתקתם. </li><li style=";text-align:right;direction:rtl"> חזור על VIGS לשיבוטים הנבחרים ושוב לבדוק את התגובה של צמחי גן מושתקים לפתוגן nonhost (ים). רמה שנייה זה של הקרנה נעשה כדי להסיר את התוצאות החיוביות השגויות שהושגו במהלך המסך הראשון. </li></ol> 4. אישור על צמחי המועמדים להתנגדות Nonhost נפרצה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להשתיק את השיבוטים cDNA שנבחרו מתוך המסך כמתואר לעיל. לחסן את המפעל כולו עם הפתוגן nonhost (ים) על ידי השריית את הצמחים עם תרבויות פתוגן בהתאמה עם 0.01% (V / V) Silwet L-77 והעמדת צמחים השקועים לשאוב במשך 3 - 5 דקות. לכמת את התפתחות החיידקים על ידי assay גידול הקונבנציונלי 6,18,19 כפי שיתואר להלן. </li><li style=";text-align:right;direction:rtl"> בשעות שלאחר החיסון 0 (HPI),3 dpi ו5 dpi, לאסוף שתי דגימות עלים מחמישה עלים ביולוגיים משכפל עבור כל פתוגן nonhost (ים) מחוסן באמצעות אגרוף עלה (0.5 ס&quot;מ) 2. טוחנים את דגימות עלים, הסידורי לדלל וצלחת SAP במדיום אגר בייט בתוספת אנטיביוטיקה ודגירה מתאימות על 28 מעלות צלזיוס למשך 2 ימים. לספור את מושבות חיידקים באמצעות מונה מושבה ולחשב את התפתחות החיידקים בעלים כפי שמתוארים בספרות קודמת 6. </li><li style=";text-align:right;direction:rtl"> צמחים רגישים לפתוגן nonhost (ים) צריכים להראות מספר גבוה יותר של צמיחת הפתוגן בהשוואה לבקרת וקטור. </li></ol> 5. רצף הוספה וזיהוי גן המטרה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצע מושבה PCR לשיבוט שנבחר באמצעות attB1 וattB2 פריימרים או תוך שימוש בפריימרים איגוף אתר שיבוט בוקטור TRV2. הפעל את המוצר ה-PCR בג&#39;ל ולבדוק להגברה של להקה אחת. </li><li style=";text-align:right;direction:rtl"> הוספת צמח בגן וקטור TRV2 יכולה להיות רצף באמצעות attBפריימרים או primers איגוף אתר השיבוט. </li><li style=";text-align:right;direction:rtl"> בצע תפציץ באמצעות הרצף ולזהות פרטי הגן. </li><li style=";text-align:right;direction:rtl"> להשיג רצף גן באורך מלא יחד עם האזורים בלתי המתורגמים (UTRs). </li><li style=";text-align:right;direction:rtl"> בחר 300-400 ברים נ&quot;ב משלושה אזורים של הרצף שונים ולשכפל אותם לTRV2 וקטור. באופן עצמאי לבצע VIGS תוך שימוש בכל שלושת מבני VIGS ולאשר את הפשרה של התנגדות nonhost בכל שלושת הצמחים השתיקו גנים. </li></ol>

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

יש לנו מה למסור.

חסינות צמח מגבילה את הצמיחה של פתוגנים nonhost ולכן, מעט או ללא הקרינה ירוקה נפלט ממפעל בקרת וקטור משאיר מחוסן עם הפתוגן nonhost תחת אור UV אורך גל ארוך (איור 3D). עם זאת, כאשר גן המעורב בהתנגדות nonhost מושתק, הצמחים השתיקו גנים להעדיף הצמיחה של הקרינה הפתוגן והירוקה nonhost נתפס (איור 3E). זהו העיקרון הבסיסי המעורב בשיטה המתוארת בכתב היד הזה. יש מתודולוגיה זו שני יתרונות גדולים על פני assay מבוסס משאבי אנוש. אחד, זיהוי של צמחים השתיקו רגישים לפתוגן nonhost ידי assay מבוסס GFPuv מגדיל את הדיוק כמו בצמיחת planta ניתן לצפות. שנית, שיטה זו מאפשרת זיהוי של גני המעורבים בשניהם 2,26 סוגי התנגדות nonhost (לא לגרום למוות של תאים גלויים) והתנגדות nonhost סוג II 2,26 (תוצאות במוות של תאים בתגובת רגישות יתר).לדוגמה, זיהינו שיבוט נקרא 6C8 והשתיקו את הצמחים היו רגישים לשני סוג 1 והסוג 2 פתוגנים 18 בעבר. כמו כן, זה אפשרי ששני אנשים או יותר שיבוטים עצמאיים המשמשים לVIGS הביאו צמחים הושתקו גן עם פנוטיפים דומים כפי שהם קורים כדי להשתיק גן מסוים. יתירות זו שימושית כפי שהוא מאשר את הפנוטיפ ההשתקה. מופע של חזרות כאלה תלויה בספרייה המשמשת להקרנה וסוג של גן (כחלק מהגנים באים לידי ביטוי ביותר ולכן מתרחשים שוב ושוב בספרייה). יתר על כן, כמעט בכל שיבוט גנים המקודדים על ידי נ הגנום benthamiana לתוך ספריית VIGS cDNA ולהשתיק אותם באופן עצמאי הוא אפשרי. על מנת ליישם את הקרנת הגנטיקה קדימה לזיהוי גני המעורבים בהתנגדות nonhost באמצעות VIGS אחרי assay הקרינה GFPuv ביעילות, בעצות הבאות הן שימושיות. על מנתלVIGS המוצלח, (1) שימוש 3 - 4 צמחי הבמה עלה לTRV חיסון; (2) אופטימלי TRV1 וTRV2 כייל הוא חשוב. מאז TRV2 כייל יכול להיות גורם מגביל לייזום של VIGS, לחסן לפחות 4 מושבות חיידקים שגדלו באופן מלא של Agrobacterium מחסה TRV2, וכן (3) לשמור על תנאי סביבה אופטימליים 12. טמפרטורה סביבתית משחקת תפקיד מרכזי בגרימת VIGS האופטימלי. שלבים קריטיים לאיתור יעיל של הקרינה ירוקה מפתוגנים כוללים: (1) משתמשים תמיד תרבויות פתוגן טריות שנקטפו בשלב גידול מעריכי ולא לאחסן אותם לפני החיסון, וכן (2) המוות של תאי HR יש להימנע ככל שהם יכולים אוטומטי לזרוח תחת UV האור ולהשפיע לרעה על התצפיות. זה חשוב במיוחד כאשר הפתוגן nonhost מסוג II (לדוגמה, פ syringae PV. עגבניות T1) משמש למחקר. השתמש בריכוז נמוך יותר של הפתוגן nonhost אם יש חשד HR המיקרוסקופי או EVidenced. פתרון בעיות: (1) חוסר עקביות בהשתקת גן ומופע של הפנוטיפ השתקה משתנה בין משכפל: שנת כפפות לכל שיבוט במהלך חיסון TRV. כמו כן, ודא שמושבת Agrobacterium TRV2 אינו מכילה שיבוטים מרובים על ידי המושבה PCR. אם המושבה PCR מגלה להקה יותר מפעם אחת, זה אפשרי, כי שיבוט אחד או יותר נמצא במושבה. על מנת להפריד את השיבוטים, פסם על הצלחת אגר LB והמסך את השיבוטים במושבת PCR. לאחר זיהוי של שיבוטים בודדים, לבצע באופן עצמאי VIGS לכל אחד מהם ולזהות את התנגדות nonhost להתפשר הצמח השתיק גן. (2) צמיחת פגמים חמורים בצמחים השתיקו: אם גן היעד השתיק (ים) מעורב בחילוף חומרים בסיסי של צמחים, פגמי צמיחה צפויים. עם זאת, חלק של הגן השתיק תכניתTS עשוי להראות כפל גבוה יותר של TRV בהשוואה לצמחי בקרת וקטור וזה עלול לגרום להשפעה נוספת על חומרת הפנוטיפ. ניתן לבצע assay הנגע מקומי 12 על צמחי amaranticolor אווז כדי לברר אם יש את הצמחים השתיקו כייל TRV גבוה יותר בהשוואה לצמחי בקרת וקטור. בנסיבות אלה, צמחים כ 4 שבועות ישנים יכולים לשמש לVIGS כדי להפחית את חומרת הפנוטיפ. (2) השתקת גנים מחוץ היעד: השתקת גן שאינו ספציפית, המכונה לעתים קרובות כהשתקה מחוץ ליעד יכולה להתרחש במהלך VIGS. המצב זה מתרחש כאשר הומולוגיה ברצף חלקי מאפשרת siRNA שנוצר לגן המטרה להכפיש mRNA לגנים שאינם מטרות ההשתקה המיועדות 27. השתמש ברצפי UTR כהוספה בוקטור TRV2. ללמוד downregulation גן אנדוגני של כל הגנים מחוץ היעד הצפוי ולוודא שתיקות לבנות גן יחיד של עניין. T<html> o להקל על זיהוי של גן עם שברי מינימום או אף את היעד, יכולים לשמש כלים לביואינפורמטיקה (לדוגמה, <a href="http://plantgrn.noble.org/pssRNAit/" target="_blank">http://plantgrn.noble.org/pssRNAit/).</a> (3) לא פלואורסצנטי ירוק ממושבות חיידקים בplanta: זו מתרחשת ככל הנראה על ידי השימוש של מעל תרבויות גדלו. סיבה נוספת יכולה להיות הבידוד חיידקים פחותים. למרות ריכוזי חיידקים ניתן למדוד באופן עקיף על ידי מדידת צפיפות אופטית OD 600, תאי חיידקים מתים יכולים לעשות עד קוטר חיצוני גבוה יותר. מומלץ לחשב ריכוז חיידקים אופטימלי המבוסס על הקמת יחידות מושבה (CFU) על ידי ספירת תאי חיים על הצלחת בינונית אגר בייט. יכולים להיות מותאמים המבוססים על ערכי OD CFU. כמו כן, הפתוגן לעתים קרובות ככל האפשר ממניות גליצרול פס, לגדל אותו על הצלחת אגר KB ולחסן מושבה אחת טרי להכנת תרבויות לחיסון. &quot;Jove_content&quot;&gt; (4) בעיות ברצף את הכנס: גורם המתרחש בדרך כלל אחד לקשיים עם רצף להכניס בTRV2 וקטור (על ידי המושבה-PCR) הוא נוכחותם של מושבות מרובות. כדי להתגבר על זה, שיבוטים מחסה מבנה TRV2 אדם צריכים להיות מבודדים כאמור לעיל (מס &#39;1). מגבלות של השיטה והדרכים להתגבר על GFPuv: פתוגנים עלולים לאבד GFPuv נושא פלסמיד בכפל ולכן, להשפיע לרעה על התצפיות. כמו כן, חלק מצמחי הגן המושתקים מציג תמונה מצהיבה והלבנה-עלים והעלים האלה פולטים הקרינה שונה (יותר מאדום). זה הופך את הקרינה הירוקה קשה לראות. אחת הדרכים להפחית את ההשפעה של הקרינה אוטומטית מן העלים הצהובים או לבנים הוא ללכוד תמונות של חיידקי הניאון הירוקים באמצעות מצלמה מצוידת במסננים שניתן להסיר או לצמצם את effe הרקעCT. תמונות יכולות לשמש כדי להסיק אם החיידקים גדלו או לא. תוכנות מסוימות (לדוגמה, Adobe Photoshop) יכולות לשמש כדי להפחית את אפקט הרקע במהלך הניתוח של תמונות כאלה. אמצעי זהירות בטיחות ביולוגית כמו לרשות המתאימה של חיידקים פתוגנים מהונדס צריך להיות אחריו במהלך ניסויים. כמו כן, יש להשתמש בעור מתאים ומגיני הגנה על עיניים בעת טיפול במנורת UV.

התנגדות Nonhost היא ההתנגדות של כל מיני צמחים נגד גזעים של 1,2 הפתוגן מסוים. זה מקנה קשת רחבה ועמידות למחלות בצמחים עמידים 2,3. עם זאת, המנגנון שלה, במיוחד נגד חיידקים פתוגנים, אינו מובן היטב 4. הקרנה למוטציות או צמחים השתיקו כי התנגדות nonhost פשרה, ואפיון תמליל תפוקה גבוהה לזיהוי של גנים באופן דיפרנציאלי לידי ביטוי במהלך nonhost התנגדות 5-9 שתי גישות עיקריות המשמשות בעבר להתנגדות לנתח nonhost חיידקים. בגלל התנגדות nonhost נשלטת על ידי מנגנון מורכב (ים) 4 עם המעורבות של גנים רבים, גישה פונקציונלי תפוקה גבוהה גנומי לזיהוי גן הוא קריטי להבנת מנגנון התנגדות nonhost (ים) טובה יותר. וירוס-Induced השתקת גן (VIGS) שימש בהצלחה להשתיק צמח אנדוגניהגנים במיני צמחים רבים 10,11. ניקוטיאנה benthamiana הוא אחד הצמחים המתאימים ביותר עבור VIGS 10,12 וטיוטת רצף הגנום שלו זמין כעת 13. וירוס רעשן טבק (TRV) מבוסס VIGS כבר בשימוש נרחב ככלי גנטיקה הפוך כדי לאפיין את הגנים מעורבים בnonhost התנגדות 2,4,14. וקטורים ונגזרים VIGS זה זמינים כעת דרך מרכז משאבים ביולוגי ארבידופסיס (ABRC, <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html).</a> VIGS שימש גם ככלי לזיהוי גנטיקה קדימה גני המעורבים בחסינות צמח 15-17, התנגדות nonhost במיוחד 6,18. הערכת תגובת רגישות יתר (HR) בתיווך מוות של תאים הנגרם על ידי צמחים נגד הפתוגן nonhost ספציפי והערכת המוות של תאים הנגרם המחלה הן שני מבחני עיקריים המשמשים בעיקר לidentifyinגן רגיש גרם השתיק צמחים. עם זאת, המוות של תאי HR מושרה רק נגד פתוגנים nonhost מסוג II ולא נגד סוג I-nonhost פתוגנים 2. לפיכך, מבחני HR לא ניתן להשתמש באופן אוניברסלי לזהות אסטרטגיות התנגדות nonhost בשימוש על ידי צמחים, במיוחד נגד מגוון רחב של סוג I-פתוגנים nonhost. כמו כן, אובדן חלקי של התנגדות nonhost במפעל הושתק גן לא תמיד להוביל למחלות סימפטומים 6 ולכן ניקוד מחלה לא יכול לשמש לזיהוי צמחים להתפשר התנגדות nonhost. בניגוד, בהערכת הצמיחה של פתוגנים nonhost במפעלי גנים המושתקים היא שיטה טובה יותר ללימוד הפסד של התנגדות nonhost בצמחי גנים מושתקים. בהשוואה לגידול קונבנציונלי assay 6,19, שיטה מהירה יותר להערכת התפתחות חיידקי nonhost על צמחי הגן המושתקים יכול לקצר את הזמן הנדרש להקרנת גנטיקה קדימה. מוקדם יותר דיווחו לנו שיטה להתבוננות חיידקיםצמיחת הפתוגן לשמאל על ידי עלים עין בלתי מזוינת באולטרה סגול (UV) אור באמצעות חיידקים לבטא חלבון (GFP) 19 ניאון ירוק. בכתב היד הזה אנחנו מדגימים את השימושיות של GFPuv להביע חיידקים פתוגנים nonhost לזיהוי קל של צמחי גנים מושתקים שנפרצו להתנגדות nonhost. מתודולוגיה זו היא מדויקת לזיהוי של צמחים רגישים ונוחה להקרנת תפוקה גבוהה.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent/equipment</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>96-well U-bottom plates</td>
 <td> Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td>
 <td> 35-3077</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>96-pin replicator stainless steel</td>
 <td> Nalge Nunc International (Naperville, IL, USA)</td>
 <td> 250520</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> High Intensity UV Inspection Lamps, Model B-100ap</td>
 <td> Thomas scientific (Swedesboro, NJ, USA)</td>
 <td> 6283K50</td>
 <td> Manufacturer ID 95-0127-01</td>
 </tr>
 <tr>
 <td> Stuart SC6 colony counter</td>
 <td> Bibby Scientific Limited, Staffordshire, UK</td>
 <td> SC6PLUS</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Soil-less potting mixture, Metro-Mix 350</td>
 <td> SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Primers: 
 attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) 
 attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td>
 <td> Integrated DNA Technologies, Inc (Coralville, IA, USA)</td>
 <td> Custom synthesized</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> MES, Monohydrate</td>
 <td> VWR international (Radnor, PA, USA)</td>
 <td> CAS No. 145224-94-8</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Acetosyringone (Dimethoxy-4'-hydroxyacetophenone)</td>
 <td> Sigma Aldrich (St. Louis, MO, USA)</td>
 <td> D134406</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Vac-In-Stuff (Silwet L-77)</td>
 <td> Lehle Seeds (Round Rock, TX, USA)</td>
 <td> VIS-30</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
</table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

עמידות למחלות של צמחי Nonhost נגד חיידקים פתוגנים נשלטת על ידי מסלולים הבטחוני מורכבים. הבנת מנגנון זה היא חשובה לפיתוח צמחים עמידים למחלה עמידות כנגד מגוון רחב של פתוגנים. וירוס-Induced השתקת גן (VIGS) הקרנה מבוססת קדימה גנטיקה היא גישה שימושית לזיהוי של גנים להגנת צמחים הקניית התנגדות nonhost. וירוס רעשן טבק (TRV) וקטור VIGS הוא וקטור VIGS יעיל ביותר עד כה, וכבר בשימוש על בסיס יעילות כדי להשתיק גני המטרה אנדוגניים בניקוטיאנה benthamiana. בכתב היד הזה, אנחנו מדגימים את גישת הקרנת גנטיקה קדימה להשתקה של שיבוטים בודדים מספריית cDNA בנ benthamiana והערכת התגובה של צמחים הושתקו גן לנפרץ התנגדות nonhost נגד פתוגנים nonhost, Pseudomonas syringae PV. עגבניות T1, פ syringae PV. glycinea, וX. campestris PV. סיקטור. חיידקים פתוגנים אלה מהונדסים לחלבון GFPuv המפורש וניתן לראות על ידי עין בלתי מזוינת מושבות fluorescing הירוקות שלהם תחת אור UV בצמחים מחוסן הפתוגן nonhost אם גן היעד השתיק מעורבת בהקניית עמידות nonhost. זה מאפשר זיהוי אמין ומהיר של גנים מושתקים צמחים רגישים לפתוגנים nonhost. יתר על כן, מידע גן המועמד מבטיח יכול להיות מוכר על ידי הוספת רצף גן הצמח בTRV וקטור. כאן אנו מדגימים את יכולת התפוקה הגבוהה של גנטיקה קדימה VIGS בתיווך לזהות גני המעורבים בהתנגדות nonhost. כ, 100 cDNAs יכול להיות מושתק באופן אישי בכ שבועות עד שלושה שבועות ואת הרלוונטיות שלהם בהתנגדות nonhost נגד מספר חיידקים פתוגנים nonhost ניתן ללמוד בשבוע שלאחר מכן. בכתב היד הזה, אנו למנות מעורבים בהקרנה זו את הצעדים המפורטים. VIGS בתיווך קדימה הגנטיקה screeniגישת ng ניתן להרחיב לא רק לגנים מעורבים בזיהוי התנגדות nonhost אלא גם כדי ללמוד כמה גני הקניית העמידות מתח יוטיים ואביוטי במינים צמחים שונים.

מטרה העיקרית של מחקר זה היא להדגים שיטה לזיהוי קל ומדויק של הגן השתיק נ צמחי benthamiana שנפרצו להתנגדות nonhost. ישנם ארבעה שלבים עיקריים בשיטה זו. צעד הראשון הוא בנפרד כדי להשתיק מספר רב של גנים באמצעות TRV-VIGS. אנחנו השתקנו כ -5,000 גנים 6,18 על פני תקופה של כ -1.5 שנים באמצעות הפרוטוקול המתואר באיור 1. חלק מצמחי הגן המושתקים הראה שינויים פנוטיפי שונים, כולל עיכוב גדילה, מצהיב ותמונת הלבנת-פנוטיפים (איור 2). שלב שני הוא זיהוי של צמחי גן מושתקים מראים רגישות לפתוגן nonhost (ים). אנחנו השתמשנו חיידקים המבטאים GFPuv ומעקב הצמיחה שלהם בplanta (ציורי A3-C3). כדי להמחיש את התהליך של איתור הגן השתיק צמחים רגישים לnonhost עמ &#39;athogen (ים), השתמשנו בשלושה nonhost פתוגנים, פ syringae PV. עגבניות T1, פ syringae PV. glycinea וX. campestris PV. סיקטור. כצפוי, לא השתיק (וקטור שליטה) נ צמחי benthamiana מחוסן עם פתוגנים אלה לא גדלו כמו שהם לא יכולים להתגבר על חסינות הצמח. עם זאת, פ T1. עגבניות PV syringae הקים מושבות ניאון ירוקות על NbSGT1 גן (גן מעורב בהתנגדות nonhost 25) השתיקו צמחים (איור 3D). נתונים אלה מדגימים את התהליך של זיהוי צמחי גנים מושתקים שנפרצו להתנגדות nonhost. פרוטוקול זה יכול להיות מיושם באופן ישיר כדי להעביר הקרנת גנטיקה. לדוגמה, התוצאות המייצגות נלקחו מאחד הקודם קדימה הגנטיקה המסך שלנו (איור 4) ניתן לראות שני צמחים השתיקו גנים עצמאיים עם מידה שונה של פ PV צמיחת T1. עגבניות syringae (איור 5 </sטרונג&gt;). צעד שלישי הוא האישור של התפתחות חיידקים בצמחי גנים המושתקים שזוהו מהמסך על ידי כימותי התפתחות החיידקים. דוגמה להערכה בהתפתחות חיידקי planta בNbSGT1 צמחי הגן המושתק מוצגת באיור 3E. תוצאות מחקר הראה כי בצמיחת planta של פ syringae PV. עגבניות T1 היה גבוה הרבה יותר בNbSGT1 צמחים השתיקו בהשוואה לצמחי ביקורת שאינן מושתקים (TRV :: 00) (איור 3E). הפסד של התנגדות nonhost בשל השתקת גנים מסוימת יכול להיות חלקי או מלא. בהתאם לכך, היקף צמיחת הפתוגן nonhost על הצמחים השתיקו גנים יכול להשתנות. השלב הרביעי הוא רצף להכניס בTRV2 וקטור. תפציץ מתבצע באמצעות רצף זה כדי לזהות את הגן ואת פרטיו. <img alt="איור 1"src = &quot;/ files/ftp_upload/51033/51033fig1.jpg&quot; /&gt; איור 1. קריקטורה מראה המעורבות בהשתקת מספר רב של גנים באמצעות VIGS מבוסס TRV המדרגות. שלוש הזקן נ &#39;בשבוע צמחי benthamiana הם הושתלו סירים נפרדים ואפשרו לגדול לכמה ימים. Agrobacterium ביצוע TRV1 מבנה הוא שחדר לשלושה עד ארבעה עלים באמצעות מזרק מיותר. מאוחר יותר, 96 שיבוטים cDNA גדלו על צלחת אגר LB נלקחים בנפרד באמצעות קיסם ודקרו למקום מחוסן TRV1 של צמחים בהתאמה. כ 3 שבועות לאחר חיסון, השתקת גני היעד מתרחשת בעלים חדשים שגדלו העליונים שאינם מחוסן. עלים אלה (5 ​​עד 8 ​​ה ה) משמשים לבדיקת הצמיחה של פתוגן nonhost (ים). <img alt="איור 2" fo:content-width="4.25in" src="/files/ftp_upload/51033/51033fig2.jpg" /> איור 2. הקרנת גנטיקה קדימה VIGS בתיווךנ benthamiana מציג שינויים שונים בפנוטיפ הצמח. הזקן נ &#39;בת שלושה שבועות צמחי benthamiana מחוסן באופן עצמאי עם TRV המתאים מושגים שdescried באיור 1 כחלק ממסך גנטיקה קדימה מוצגים. תמונות צולמו ב 21 ימים לאחר TRV חיסון. <img alt="איור 3" fo:content-width="4.5in" src="/files/ftp_upload/51033/51033fig3.jpg" /> איור 3. ירוקה הקרינה מGFPuv להביע חיידקים פתוגנים ושימוש בו לצורך זיהוי של גני המעורבים בהתנגדות nonhost. Pseudomonas syringae PV. Tabaci, הפתוגן מארח, שנשא GFPuv לבנות מפוספסת על צלחת KB בינונית מציג פלואורסצנטי ירוק תחת אור UV גל ארוך בחושך ( א). חיידקים אלה גדלים על מדיום KB ומחדש תלויים במים (ב &#39;) ומחוסן לנ benthamiana </em&gt; עלים (צד abaxial, 1 x 10 4 CFU / מ&quot;ל). בגיל 3 ימים לאחר החיסון (dpi) מושבות חיידקים נתפסות ככתמים ירוקים ניאון על ידי עין בלתי מזוינת מצד abaxial של תאי אפידרמיס עלים (C, משמאל). אותו עלה תמונה תחת אור רגיל (בטווח נראה לעין) מוצג גם (C, מימין). GFPuv להביע פ syringae PV. tabaci שלוש nonhost פתוגנים (Pstab, 1 x 10 4 CFU / מ&quot;ל) ו, פ syringae PV. עגבניות T1 (PstT1, x 10 4 CFU 1 / מ&quot;ל), פ . Syringae PV glycinea (PSG, 3 x 10 5 CFU / מ&quot;ל) וXanthomonas campestris PV סיקטור (XCV, 3 x 10 4 CFU / מ&quot;ל) מחוסנים לצד abaxial של עלים מוקטור שליטה (TRV :: 00. ד &#39;, משמאל) וNbSGT1 צמחים השתיקו גן (ד&#39;, מימין). מושבות חיידקים של Pstab נתפסות על שני עלים ואלה של PstT1 נתפסים רק על NbSGT1 גן השתיק עלים. PstT1 צמיחה בNbSGT1 גן השתיק עלים לכמת ב 24, 24 ו -72 שעות לאחר חיסון (HPI, E) מוצג בגרף. <a href="https://www.jove.com/files/ftp_upload/51033/51033fig3large.jpg" target="_blank">לחץ כאן לצפייה בדמות גדולה.</a> <img alt="איור 4" fo:content-width="5in" src="/files/ftp_upload/51033/51033fig4.jpg" /> איור 4. סקירה כללית של פרוטוקול ואחריו להקרנת גנטיקה קדימה VIGS בתיווך לזיהוי גני המעורבים בהתנגדות nonhost. ספריית cDNA בוקטור TRV2 נבנה באמצעות RNA מן הפתוגן nonhost (ים) מחוסן נ עלים benthamiana יכולים לשמש להקרנה. שיבוטים בודדים מספריית cDNA מושתקים בנ benthamiana ידי TRV-VIGS. GFPuv בהתאמה להביע פתוגן חיידקי nonhost (ים) הוא מחוסן לעלי הצמח המושתקים גנים. בין 2 ל4 dpi הנקודות מחוסן הם נצפו באמצעות מנורת UV בחושך ואת הצמחים המראים צמיחת הפתוגן nonhost מזוהים. לאחר סינון ראשוני זה, השיבוטים שנבחרו שוב והשתיקו את צמיחת הפתוגן nonhost היא אושר. מסך רמה שני זה נעשה כדי להסיר את התוצאות החיוביות השגויות. מאוחר יותר, אישר שיבוטים מושתקים בפעם שלישית וצמיחת חיידקים בהתאמה מוערכת. הוספת של שיבוטים המתאימים בוקטור TRV2 הם רצף והמידע גנטי מזוהה. במקביל assay משאבי אנוש יכול גם להתבצע על צמחי הגן המושתקים לזיהוי גנים התורמים למשאבי אנוש מושרה נגד פתוגנים nonhost מסוג II. <img alt="איור 5" fo:content-width="5in" src="/files/ftp_upload/51033/51033fig5.jpg" /> איור 5. צמיחת Nonhost חיידקים פתוגנים בצמחי גנים מושתקים שזוהו כחלק ממסך גנטיקה קדימה. תמונות מforwarהקרנת הגנטיקה ד שהגנים שזוהו היו מעורבים בהתנגדות nonhost של נ &#39; צמחים נגד benthamiana PstT1, PSG וXCV. תמונות שצולמו לשני מפעלי גנים מושתקים יציגים ב3 dpi לאחר החיסון מוצגות כאן. ריכוזי חיידקים המשמשים לחיסון מתוארים באיור 3. 43D4 או 94C1 מציין את מספר 96 גם הצלחת ואחריו גם את המספר.

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

וירוס-Induced השתקת הגן היא כלי שימושי לזיהוי גני המעורבים בהתנגדות nonhost של צמחים. אנו מדגימים את השימוש בחיידקים פתוגנים המבטאים GFPuv בזיהוי גנים מושתקים צמחים רגישים לפתוגנים nonhost. גישה זו היא קלה, מהירה ומאפשרת הקרנה בקנה מידה גדולה ופרוטוקול דומה ניתן ליישם בחקר אינטראקציות צמח חיידק אחרים שונות.

הקרנת גנטיקה קדימה VIGS בתיווך לזיהוי גני המעורבים בהתנגדות Nonhost


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

vigs-mediated-forward-genetics-screening-for-identification-genes

Google

Research

JoVE Journal

Immunology and Infection

16.9K Views.  The Samuel Roberts Noble Foundation.  וירוס-Induced השתקת הגן היא כלי שימושי לזיהוי גני המעורבים בהתנגדות nonhost של צמחים. אנו מדגימים את השימוש בחיידקים פתוגנים המבטאים GFPuv בזיהוי גנים מושתקים צמחים רגישים לפתוגנים nonhost. גישה זו היא קלה, מהירה ומאפשרת הקרנה בקנה מידה גדולה ופרוטוקול דומה ניתן ?...

Video: VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

RNAi הקרנת עבור גורמים מארח מעורב Vaccinia וירוס זיהום באמצעות תסיסנית תאים

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response following an infection. Despite efforts to identify unique surface marker on Tregs, the only unique feature is their ability to suppress the proliferation and function of effector T cells. While it is clear that only in vitro assays can be used in assessing human Treg function, this becomes problematic when assessing the results from cross-sectional studies where healthy cells and cells isolated from subjects with autoimmune diseases (like Type 1 Diabetes-T1D) need to be compared. There is a great variability among laboratories in the number and type of responder T cells, nature and strength of stimulation, Treg:responder ratios and the number and type of antigen-presenting cells (APC) used in human in vitro suppression assays. This variability makes comparison between studies measuring Treg function difficult. The Treg field needs a standardized suppression assay that will work well with both healthy subjects and those with autoimmune diseases. We have developed an in vitro suppression assay that shows very little intra-assay variability in the stimulation of T cells isolated from healthy volunteers compared to subjects with underlying autoimmune destruction of pancreatic &beta;-cells. The main goal of this piece is to describe an in vitro human suppression assay that allows comparison between different subject groups. Additionally, this assay has the potential to delineate a small loss in nTreg function and anticipate further loss in the future, thus identifying subjects who could benefit from preventive immunomodulatory therapy1. Below, we provide thorough description of the steps involved in this procedure. We hope to contribute to the standardization of the in vitro suppression assay used to measure Treg function. In addition, we offer this assay as a tool to recognize an early state of immune imbalance and a potential functional biomarker for T1D.

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Tregs are potent suppressors of the immune system. There is a lack of unique surface markers to define them, hence, definitions of Tregs are primarily functional. Here we describe an optimized in vitro assay capable of identifying immune imbalance in subjects at risk to develop T1D.

אנושי במבחנה דיכוי ככלי מיון עבור הכרה של מדינת מוקדם של חוסר איזון החיסון

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

Reverse Genetics Mediated Recovery of Infectious Murine Norovirus

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close person-to-person contact cannot be avoided 1, 2. During the last few years an increase in the incidence of outbreaks in hospitals has been reported, causing significant disruptions to their operational capacity as well as large economic losses. The identification of new antiviral approaches has been limited due to the inability of human noroviruses to complete a productive infection in cell culture 3. The recent isolation of a murine norovirus (MNV), closely related to human norovirus 4 but which can be propagated in cells 5 has opened new avenues for the investigation of these pathogens 6, 7. 
MNV replication results in the synthesis of new positive sense genomic and subgenomic RNA molecules, the latter of which corresponds to the last third of the viral genome (Figure 1). MNV contains four different open reading frames (ORFs), of which ORF1 occupies most of the genome and encodes seven non-structural proteins (NS1-7) released from a polyprotein precursor. ORF2 and ORF3 are contained within the subgenomic RNA region and encode the capsid proteins (VP1 and VP2, respectively) (Figure 1). Recently, we have identified that additional ORF4 overlapping ORF2 but in a different reading frame is functional and encodes for a mitochondrial localised virulence factor (VF1) 8.
Replication for positive sense RNA viruses, including noroviruses, takes place in the cytoplasm resulting in the synthesis of new uncapped RNA genomes. To promote viral translation, viruses exploit different strategies aimed at recruiting the cellular protein synthesis machinery 9-11. Interestingly, norovirus translation is driven by the multifunctional viral protein-primer VPg covalently linked to the 5' end of both genomic and subgenomic RNAs 12-14. This sophisticated mechanism of translation is likely to be a major factor in the limited efficiency of viral recovery by conventional reverse genetics approaches. 
Here we report two different strategies based on the generation of murine norovirus-1 (referred to as MNV herewith) transcripts capped at the 5' end. One of the methods involves both in vitro synthesis and capping of viral RNA, whereas the second approach entails the transcription of MNV cDNA in cells expressing T7 RNA polymerase. The availability of these reverse genetics systems for the study of MNV and a small animal model has provided an unprecedented ability to dissect the role of viral sequences in replication and pathogenesis 15-17.

Noroviruses are a major cause of gastroenteritis yet molecular techniques for their characterisation are still relatively new. Here we report two different reverse genetics approaches for the efficient recovery of murine norovirus (MNV), the only member of this genus which can be propagated in cell culture.

שחזור הפוך גנטיקה מתווכת של norovirus Murine זיהומיות

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close ...

Forward Genetic Approaches in Chlamydia trachomatis

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its intractability to experimental transformation with recombinant DNA. We developed an approach to perform genetic analysis in C. trachomatis&#160;despite the lack of molecular genetic tools. Our method involves: i.) chemical mutagenesis to rapidly generate comprehensive libraries of genetically-defined mutants with distinct phenotypes; ii.) whole-genome sequencing (WGS) to map the underlying genetic lesions and to find associations between mutated gene(s) and a common phenotype; iii.) generation of recombinant strains through co-infection of mammalian cells with mutant and wild type bacteria. Accordingly, we were able to establish causal relationships between genotypes and phenotypes. The coupling of chemically-induced gene variation and WGS to establish correlative genotype&#8211;phenotype associations should be broadly applicable to the large list of medically and environmentally important microorganisms currently intractable to genetic analysis.

Forward Genetic Approaches in Chlamydia trachomatis

We describe a methodology to perform genetic analysis in Chlamydia based on chemical mutagenesis and whole genome sequencing. In addition, a system for DNA exchange within infected cells is described that can be used for genetic mapping. This method may be broadly applicable to microbial systems lacking transformation systems and molecular genetic tools.

גישות גנטיות בקדימה<em&gt; כלמידיה trachomatis</em

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

באמצעות RNA-התערבות לחקר התגובה החיסונית המולדת בהמקרופאגים עכבר

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial pathogen which establishes chronic pulmonary infections in patients with cystic fibrosis (CF). The overproduction of a capsular polysaccharide called alginate, also known as mucoidy, promotes the formation of mucoid biofilms which are more resistant than planktonic cells to antibiotic chemotherapy and host defenses. Additionally, the conversion from the nonmucoid to mucoid phenotype is a clinical marker for the onset of chronic infection in CF. Alginate overproduction by P. aeruginosa is an endergonic process which heavily taxes cellular energy. Therefore, alginate production is highly regulated in P. aeruginosa. To better understand alginate regulation, we describe a protocol using the mini-himar1 transposon mutagenesis for the identification of novel alginate regulators in a prototypic strain PAO1. The procedure consists of two basic steps. First, we transferred the mini-himar1 transposon (pFAC) from host E. coli SM10/&#955;pir into recipient P. aeruginosa PAO1 via biparental conjugation to create a high-density insertion mutant library, which were selected on Pseudomonas isolation agar plates supplemented with gentamycin. Secondly, we screened and isolated the mucoid colonies to map the insertion site through inverse PCR using DNA primers pointing outward from the gentamycin cassette and DNA sequencing. Using this protocol, we have identified two novel alginate regulators, mucE (PA4033) and kinB (PA5484), in strain PAO1 with a wild-type mucA encoding the anti-sigma factor MucA for the master alginate regulator AlgU (AlgT, &#963;22). This high-throughput mutagenesis protocol can be modified for the identification of other virulence-related genes causing change in colony morphology.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Here we describe a protocol using the mini-himar1 mariner transposon-mediated mutagenesis for generating a high-density insertion mutant library to screen, isolate and identify novel alginate regulators in the prototypic Pseudomonas aeruginosa strain PAO1.

זיהוי גנים הקשורים לרומן אלגינט ייצור ב<em&gt; Pseudomonas aeruginosa</em&gt; שימוש מיני<em&gt; Himar1</em&gt; Mutagenesis תיווך transposon מרינר

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify new compounds that can inhibit infection by the common drug resistant HIV-1 strains with minimal toxicity. Here we describe an efficient assay that can be used to rapidly determine the cellular cytotoxicity and efficacy of a compound against WT and mutant viral strains.
The desired target cell line is seeded in a 96-well plate and, after a 24 hr incubation, serially dilutions of the compounds to be tested are added. No further manipulations are necessary for cellular cytotoxicity assays; for anti HIV assays a predetermined amount of either a WT or drug resistant HIV-1 vector that expresses luciferase is added to the cells. Cytotoxicity is measured by using an ATP dependent luminescence assay and the impact of the compounds on infectivity is measured by determining the amount of luciferase in the presence or the absence of the putative inhibitors.
This screening assay takes 4 days to complete and multiple compounds can be screened in parallel. Compounds are screened in triplicate and the data are normalized to the infectivity/ATP levels in absence of target compounds. This technique provides a quick and accurate measurement of the efficacy and toxicity of potential anti HIV compounds.

Here we describe cellular cytotoxicity and single round infectivity assays that allow for the rapid and accurate screening of compounds to determine their cellular cytotoxicity (CC50) and IC50 values against WT and drug resistant HIV-1.

הקרנה מהירה של HIV ההפוך טרנסקריפטאז וintegrase המעכבים

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependent-innate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in na&#239;ve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified parasite gene to establishment of chronic infection.

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&amp;#947;-Dependent Cell Autonomous Immunity

Forward genetics is a powerful approach to identify genes in intracellular pathogens important for resistance to cell autonomous immunity. The current approach uses innate immune cells, specifically macrophages, to identify novel Toxoplasma gondii genes important for immune evasion.

קדימה גנטיקה מסכי שימוש המקרופאגים לזיהוי<em&gt; Toxoplasma gondii</emחסינות אוטונומית נייד להתנגדות לIFN-γ-Dependent&gt; גנים חשובים

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

מיקרוסקופי מבוססת מבחנים עבור הקרנת תפוקה גבוהה של גורמי מארח המעורבים<em&gt; Brucella</em&gt; זיהום של תאים הלה

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.