이 프로젝트는 사무엘 로버츠 노블 재단에 의해 후원되었다. 저자는 회원국 감사합니다. 제니 갤로 웨이와 콜린이 우수한 식물 관리를위한 Elles, 그리고 작품에 대한 양 케이티 브라운. 우리는 또한 회원국에게 감사의 말씀을 전합니다. 트리 나 코트렐, 푸자 Uppalapati, Moumita 사하구, Swetha Vinukonda이 프로토콜을 설정하는 동안 기술 지원을위한 씨 이삭 Greenhut.

1. 식물 성장 및 타겟 유전자 침묵 <ol><li> 식물의 성장 조건 : <ol><li> N.를 뿌리다 토양 덜 포팅 혼합물 메트로 믹스 350 성장 챔버에서 씨앗을 발아에 benthamiana 씨. 다른 토양 토양 적은 매체는 메트로 - 믹스 대신 사용할 수 있습니다. </li><li> 이식 3 주 오래된 개별 화분에 모종 21 유지 온실에서 그들을 성장 ± 2 ° C 이전의 문헌 12에 설명 된 다른 성장 조건과 함께. 두 사흘 이식 후, 식물 TRV 접종에 사용할 수 있습니다. </li></ol></li><li> TRV2 클론을 성장 : TRV는 양자 바이러스 및 게놈 RNA1 및 RNA2으로 구성되어 있습니다. RNA1는 RNA 의존 RNA 중합 효소와 운동 단백질 20,21 인코딩합니다. RNA2는 외피 단백질 (CP) 및 subgenomic RNA를 21 개의 비 구조 단백질을 인코딩합니다. RNA1 및 RNA2 모두 성숙 비르의 형성에 필요한우리 입자들의 확산 20,21. TRV2 벡터의 cDNA를 라이브러리 건설 이전의 문학 22,23에 설명되어 있습니다. 간단히, 본 연구에서 사용 VIGS 라이브러리는 다양한 생물과 비 생물 적 elicitors에 노출 된 잎 조직에서 추출한 RNA에서 건설되었다. <ol><li> 냉장고에서 TRV2 벡터의 cDNA를 클론 (96 - 웰 플레이트)가 포함 된 아그로 박테 리움을 (GV2260 변형) 꺼냅니다. 점차적를 해동하고 문화가 실내 온도에 도달 한 후, 96 핀 Replicator를 사용하여 리팜피신 (10 ㎍ / ㎖) 및 카나마이신 (50 ㎍ / ㎖)과 루리아 - 베르 타니 (LB) 한천 배지에 각각의 아그로 박테 리움 문화를 접종. </li><li> 이틀 동안 28 ° C에서 번호판을 품어. 그 적절한 아그로 박테 리움의 접종이 두 식물의 찌르기 접종 사용할 수 있도록 우리는 일반적으로 각 복제에 대한 네 가지 복제 식민지를 성장. 무균 조건 하에서 모든 단계를 수행합니다. </li></ol></li><li> VIGS : <ol><li> 성장28에 TRV1을 들고 아그로 박테 리움 (GV2260) ° 위에서 언급 한 항생제와 LB 액체 배지에서 C. 하룻밤 성장 문화에서 원심 분리하여 수확 세포는 (10 MM MES, 산도 5.5, 200 μM의 acetosyringone) 접종 버퍼에 다시 일시 중지, 50 rpm으로 진탕, 실온에서 3 시간 동안 배양한다. </li><li> 원심 분리하여 세포를 수확하고 5 밀리미터 MES 버퍼 (산도 5.5) 및 접종 (OD 600 = 0.3)에 다시 일시 중지합니다 3-4 N.의 배축면에 benthamiana는 needleless 주사기를 사용 둡니다. 자세한 접종 절차는 이전의 문헌 24에 나와 있습니다. 나중에 TRV1 접종의 사이트에서, 이쑤시개와 잎을 찔러서 각각의 TRV2 식민지를 접종. </li><li> 활발한 성장을 효율적으로 VIGS 12 중요하기 ​​때문에 충분한 영양과 식물을 유지합니다. 2 주간 포스트 접종에 대한 표적 유전자의 전사가 감소하기 시작하고 식물 병원균 INOC을위한 준비TRV 접종 후 3 주에 ulation. </li></ol></li></ol> 2. Nonhost 병원체 문화 및 식물 접종의 준비 <ol><li> 본 연구에 사용 된 병원균의 세부 사항 : 모나스 syringae pv를. tabaci, P. syringae pv를. 토마토 T1, P. syringae pv를. glycinea과 크 산토 모나스 (Xanthomonas) campestris pv를. vesicatoria 본 연구에 사용됩니다. P. 성장 왕의 B (KB) 12 시간 동안 28 ° C에서 리팜피신 (10 ㎍ / ㎖), 카나마이신 (50 ㎍ / ㎖)를 첨가 액체 배지에 syringae 변종. X. 성장 16 시간 동안 LB 액체 배지에서 campestris pv를. vesicatoria. 모든 병원균 이전 문헌 19에서 설명한대로 GFPuv을 표현할 수있는 플라스미드를 항구. </li><li> 식물의 접종에 대한 병원체 배양의 준비 : <ol><li> 원심 분리하여 세균 세포를 수확 긴 주를 사용하여 녹색 형광의 존재를 확인어둠 속에서 velength UV 램프. 멸균 수로 두 번 세포를 씻으하고는 멸균 물을 사용하여 원하는 농도에 다시 일시 중지합니다. </li><li> 반점 (약 1.5 cm 직경)와 같은 표적 유전자 침묵 잎 (5 일 ~ 8 일)의 배축면에 각각의 병원체 (들)을 접종한다. 여러 nonhost 병원체를 동시에 표적 유전자 침묵 식물에서의 성장을위한 테스트 할 수 있습니다. 이것은 란타 박테리아의 성장에서 볼 수있는 양성 대조군으로 사용 할 수있는 동시에 호스트 병원체를 접종. 또한 접종 벡터 제어 (TRV :: 00) 식물. </li></ol></li></ol> 3. 세균성 병원균의 란타 성장의 관찰 <ol><li> 어둠 속에서 긴 파장 자외선에 접종 잎을 노출합니다. 세균성 식민지 잎 표면에서 방출되는 적색 형광 배경에 잎의 배축 측면에서 녹색 형광 점으로 볼 수 있습니다. </li><li> 병원균의 성장을 관찰이일 포스트 접종 (dpi)로부터 5 DPI. 이 시간 간격 동안 매일 관찰이 필요합니다. </li><li> 후 첫 번째 화면, 짧은 명단 침묵 하나 이상의 nonhost 병원체 (들)의 성장 결과 클론. </li><li> 선택한 클론 VIGS를 반복하고 다시 nonhost 병원체 (들) 유전자 침묵 식물의 반응을 테스트합니다. 심사의 두 번째 레벨은 첫 번째 화면 중에 얻은 잘못된 반응을 제거하기 위해 수행됩니다. </li></ol> 4. 변조 된 Nonhost 저항을 위해 선발 된 식물의 확인 <ol><li> 위에서 설명한대로 화면에서 선택의 cDNA 클론을 침묵. 5 분 - 0.01 % (v / v)의 Silwet L-77 3 진공 청소기로 청소하기 위하여 침수 식물을 복종과 각각의 병원체 문화와 식물을 잠수하여 nonhost 병원체 (들)과 전체 공장을 접종한다. 아래에 설명 된대로 기존의 성장 분석 6,18,19하여 박테리아의 성장을 계량. </li><li> 0 시간 후 접종 (HPI)에서,3 dpi로 5부터, 잎 펀치 (0.5 cm 2)를 사용하여 다섯 개의 생물 각 nonhost 병원체 (들) 복제 접종 잎에서 두 잎 샘플을 수집합니다. 잎 샘플 2 일 동안 28 ° C에서 적절한 항생제와 부화로 보충 KB 한천 배지에 시리얼 희석 판 수액을 갈기. 식민지 카운터를 사용하여 세균성 식민지를 계산하고 이전의 문헌 6에 설명 된 잎 박테리아의 성장을 계산합니다. </li><li> nonhost 병원체 (들)에 민감한 식물 벡터 제어에 비해 병원균의 성장의 높은 숫자를 표시해야합니다. </li></ol> 5. 대상 유전자의 삽입 및 확인을 시퀀싱 <ol><li> attB1 및 attB2 프라이머를 사용하거나 TRV2 벡터에 클로닝 사이트를 측면에서는 프라이머를 사용하여 선택한 복제에 대한 식민지 PCR을 수행합니다. 겔에 PCR 제품을 실행하고 단일 대역의 증폭을 확인합니다. </li><li> TRV2 벡터의 식물 유전자 삽입은 attB를 사용하여 염기 서열 할 수 있습니다프라이머하거나 복제 사이트를 측면에서는 프라이머. </li><li> 시퀀스를 사용하여 BLAST를 수행하고 유전자의 세부 사항을 확인합니다. </li><li> 유엔 번역 된 지역 (UTRs)와 함께 전체 길이 유전자 서열을 구하십시오. </li><li> 시퀀스의 세 가지 영역 300-400 bp의 단편을 선택하고 TRV2 벡터로 그들을 복제. 독립적 세 VIGS 구문을 사용하여 VIGS을 수행하고 세 가지 유전자 침묵 식물 nonhost 저항의 타협을 확인합니다. </li></ol>

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

우리는 공개 아무것도 없어.

식물 면역 거의 또는 전혀 녹색 형광 벡터 제어 공장에서 방출되지 않는, 따라서 nonhost 병원균의 성장을 제한하고 장파장 자외선 (그림 3D)에 따라 nonhost 병원균 접종 둡니다. 그러나 nonhost 저항에 관련된 유전자가 침묵 할 때, 유전자 침묵 식물 nonhost 병원균과 녹색 형광의 성장 (그림 3E) 볼을 선호. 이것은이 논문에 설명 된 방법에 관련된 기본 원칙이다. 이 방법은 HR-기반?...

Nonhost 저항은 특정 병원체 1,2 인종에 대한 모든 식물 종의 저항이다. 이 넓은 스펙트럼과 식물 2,3 튼튼한 질병 저항을 부여. 그러나 특히 세균성 병원균에 대한 기전은 잘 4 이해되지 않습니다. 타협 nonhost 저항 및 nonhost 저항 5-9시 차등 발현 유전자의 식별을위한 높은 처리량 성적 프로파일은 이전 세균 nonhost 저항을 해부에 사용되는 두 가지 주요 방법임을 돌연변이 또는 침묵 식물 검사. nonhost 저항은 많은 유전자, 유전자 식별을위한 높은 처리량 기능 게놈 접근법의 참여와 복잡한 메커니즘 (들) 4에 의해 제어되기 때문에 nonhost 저항 메커니즘 (들)을보다 잘 이해 중요합니다. 바이러스에 의한 유전자 침묵 (VIGS)가 성공적으로 내생 식물 침묵하는 데 사용되었습니다많은 식물 종 10,11의 유전자.은 Nicotiana benthamiana는 VIGS 10,12하고 초안 게놈 시퀀스에 대한 가장 적합한 식물 중 하나입니다 지금 13 사용할 수 있습니다. 담배 딸랑이 바이러스 (TRV) 기반 VIGS 널리 역 유전학 도구로 사용되었다 nonhost 저항 2,4,14에 관련된 유전자의 특성을. 이 VIGS 벡터 및 파생 상품은 애기 장대 생물 자원 센터 (ABRC를 통해 지금 사용할 수 있습니다 <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html</a> ). VIGS는 식물의 면역 15-17, 특히 nonhost 저항 6,18에 관련된 유전자를 식별 앞으로 유전학 도구로 사용되었습니다. 과민 반응 (HR) 매개 특정 nonhost 병원균에 대한 식물에 의해 유도 된 세포 죽음을 평가하고 질병에 의한 세포 죽음을 평가하는 것은 주로 identifyin에 사용되는 두 가지 주요 분석입니다G 감수성 유전자는 식물을 침묵. 그러나 HR 세포의 죽음이 유일한 유형-II nonhost 병원균에 대한 유도가 아닌 타입-I nonhost 병원균 2에 대하여. 따라서, HR의 분석은 보편적 특히 타입 I nonhost 병원체의 넓은 범위에 식물에 의해 사용 nonhost 저항 전략을 파악하는 데 사용할 수 없습니다. 또한, 유전자 침묵 공장에서 nonhost 저항의 부분적인 손실이 항상 질병의 증상 6 따라서 질병 점수가 nonhost 저항을 저하 식물을 식별하는 데 사용할 수 없습니다 이어질하지 않습니다. 반면에, 유전자 침묵 식물 nonhost 병원균의 성장을 평가하는 유전자 침묵 식물 nonhost 저항의 손실을 공부하기위한 좋은 방법입니다. 기존의 성장 분석 6,19, 유전자 침묵 식물에 nonhost 박테리아의 성장을 평가하기위한 빠른 방법에 비해 앞으로 유전학 검사에 필요한 시간을 단축 할 수 있습니다. 우리는 이전에 박테리아를 관찰하는 방법을보고자외선 아래에서 육안으로 잎에 L 병원균의 성장 (UV)는 밝은 녹색 형광 단백질 (GFP) 19를 표현하는 박테리아를 사용하여. 이 논문에서 우리는 nonhost 저항을 손상하는 유전자 침묵 식물의 쉽게 식별 nonhost 세균성 병원체를 표현 GFPuv의 유용성을 보여줍니다. 이 방법은 감염 식물의 식별을위한 정확하고 높은 처리량 검사에 대한 의무이다.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent/equipment</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>96-well U-bottom plates</td>
 <td> Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td>
 <td> 35-3077</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>96-pin replicator stainless steel</td>
 <td> Nalge Nunc International (Naperville, IL, USA)</td>
 <td> 250520</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> High Intensity UV Inspection Lamps, Model B-100ap</td>
 <td> Thomas scientific (Swedesboro, NJ, USA)</td>
 <td> 6283K50</td>
 <td> Manufacturer ID 95-0127-01</td>
 </tr>
 <tr>
 <td> Stuart SC6 colony counter</td>
 <td> Bibby Scientific Limited, Staffordshire, UK</td>
 <td> SC6PLUS</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Soil-less potting mixture, Metro-Mix 350</td>
 <td> SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Primers: 
 attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) 
 attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td>
 <td> Integrated DNA Technologies, Inc (Coralville, IA, USA)</td>
 <td> Custom synthesized</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> MES, Monohydrate</td>
 <td> VWR international (Radnor, PA, USA)</td>
 <td> CAS No. 145224-94-8</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Acetosyringone (Dimethoxy-4'-hydroxyacetophenone)</td>
 <td> Sigma Aldrich (St. Louis, MO, USA)</td>
 <td> D134406</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Vac-In-Stuff (Silwet L-77)</td>
 <td> Lehle Seeds (Round Rock, TX, USA)</td>
 <td> VIS-30</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
</table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

세균성 병원균에 대한 식물의 Nonhost 질병 저항은 복잡한 방어 경로에 의해 제어됩니다. 이 메커니즘을 이해하는 것은 병원균의 넓은 범위에 대한 내구성이 질병 저항성 식물 개발을위한 중요합니다. 바이러스에 의한 유전자 침묵 (VIGS) 기반의 앞으로 유전학 검사는 nonhost 저항을 부여 식물의 방어 유전자의 식별을위한 유용한 방법입니다. 담배 딸랑이 바이러스 (TRV) 기반 VIGS 벡터 날짜에 가장 효율적인 VIGS 벡터이며가 효율적으로 사용되었습니다 은 Nicotiana benthamiana에서 내생 대상 유전자를 침묵합니다. 이 논문에서, 우리는 N.에서의 cDNA 라이브러리에서 개별 클론의 침묵에 대해 앞으로 유전학 검사 방식을 보여 benthamiana와 nonhost 병원균에 대한 노출 nonhost 저항을 유전자 침묵 식물의 반응을 평가, 모나스 syringae pv를. 토마토 T1, P. syringae pv를. GLYCinea, 그리고 X. campestris pv를. vesicatoria. 이러한 세균성 병원균 표현 GFPuv 단백질을 설계하고 침묵 표적 유전자가 nonhost 저항을 부여에 관여하는 경우 그들의 녹색 형광 식민지가 nonhost 병원균 접종 공장에서 UV 빛의 밑에 육안으로 볼 수 있습니다. 이 nonhost 병원균에 감염 유전자 침묵 식물의 믿을 수있는 빠른 식별을 용이하게합니다. 또한, 유망 후보 유전자 정보는 TRV 벡터 식물 유전자 삽입 순서에 의해 알 수있다. 여기에 우리가 nonhost 저항성에 관련된 유전자를 식별하는 VIGS 매개 앞으로 유전학의 높은 처리 능력을 보여줍니다. 약 100 cDNA를 개별적 이후 주에서 공부 할 수있는 약 2~3주 여러 nonhost 세균성 병원균에 대한 nonhost 저항의 관련성에 침묵 할 수 있습니다. 이 논문에서, 우리는이 검사에 관련된 자세한 단계를 열거합니다. VIGS 매개 앞으로 유전학 screeniNG 접근 방식은 nonhost 저항에 관여 식별 유전자뿐만 아니라 다양한 식물 종의 다양한 생물과 비 생물 적 스트레스 공차를 부여 유전자를 공부하는뿐만 아니라 확장 할 수 있습니다.

본 연구의 주요 목적은 N. 침묵을 지켰 유전자의 쉽고 정확하게 식별하는 방법을 보여주는 것입니다 nonhost 저항을 손상하는 benthamiana 공장. 이 방법의 네 가지 주요 단계가 있습니다. 첫 번째 단계는 개별적으로 TRV-VIGS를 사용하여 유전자의 다수를 침묵하는 것입니다. 우리는 그림 1에 묘사 된 프로토콜을 사용하여 약 1.5 년의 기간 동안 약 5,000 유전자에게 6,18 침묵을</...

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

바이러스에 의한 유전자 침묵은 식물의 nonhost 저항성에 관련된 유전자를 식별하기위한 유용한 도구입니다. 우리는 nonhost 병원균에 감염 유전자 침묵 식물을 식별 GFPuv을 표현 세균성 병원체의 사용을 보여줍니다. 이 방법은 빠르고, 간단하고 대규모 검사와 유사한 프로토콜이 다양한 식물 미생물 상호 작용을 연구에 적용 할 수있는 용이하게합니다.

유전자의 식별을위한 VIGS - 중재 앞으로 유전학 검사는 Nonhost 저항에 참여


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

vigs-mediated-forward-genetics-screening-for-identification-genes

Research

JoVE Journal

Immunology and Infection

16.9K 조회수.  The Samuel Roberts Noble Foundation.  바이러스에 의한 유전자 침묵은 식물의 nonhost 저항성에 관련된 유전자를 식별하기위한 유용한 도구입니다. 우리는 nonhost 병원균에 감염 유전자 침묵 식물을 식별 GFPuv을 표현 세균성 병원체의 사용을 보여줍니다. 이 방법은 빠르고, 간단하고 대규모 검사와 유사한 프로토콜이 다양한 식물 미생물 상호 작용을 연구에 적용 할 수있는 용이하게합니다. 

비디오: VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response following an infection. Despite efforts to identify unique surface marker on Tregs, the only unique feature is their ability to suppress the proliferation and function of effector T cells. While it is clear that only in vitro assays can be used in assessing human Treg function, this becomes problematic when assessing the results from cross-sectional studies where healthy cells and cells isolated from subjects with autoimmune diseases (like Type 1 Diabetes-T1D) need to be compared. There is a great variability among laboratories in the number and type of responder T cells, nature and strength of stimulation, Treg:responder ratios and the number and type of antigen-presenting cells (APC) used in human in vitro suppression assays. This variability makes comparison between studies measuring Treg function difficult. The Treg field needs a standardized suppression assay that will work well with both healthy subjects and those with autoimmune diseases. We have developed an in vitro suppression assay that shows very little intra-assay variability in the stimulation of T cells isolated from healthy volunteers compared to subjects with underlying autoimmune destruction of pancreatic &beta;-cells. The main goal of this piece is to describe an in vitro human suppression assay that allows comparison between different subject groups. Additionally, this assay has the potential to delineate a small loss in nTreg function and anticipate further loss in the future, thus identifying subjects who could benefit from preventive immunomodulatory therapy1. Below, we provide thorough description of the steps involved in this procedure. We hope to contribute to the standardization of the in vitro suppression assay used to measure Treg function. In addition, we offer this assay as a tool to recognize an early state of immune imbalance and a potential functional biomarker for T1D.

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Tregs are potent suppressors of the immune system. There is a lack of unique surface markers to define them, hence, definitions of Tregs are primarily functional. Here we describe an optimized in vitro assay capable of identifying immune imbalance in subjects at risk to develop T1D.

사람의 체외에서</em면역 불균형의 초기 국가의 인정을위한 심사 도구를> 억제

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

연구

면역학 및 감염병학

Reverse Genetics Mediated Recovery of Infectious Murine Norovirus

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close person-to-person contact cannot be avoided 1, 2. During the last few years an increase in the incidence of outbreaks in hospitals has been reported, causing significant disruptions to their operational capacity as well as large economic losses. The identification of new antiviral approaches has been limited due to the inability of human noroviruses to complete a productive infection in cell culture 3. The recent isolation of a murine norovirus (MNV), closely related to human norovirus 4 but which can be propagated in cells 5 has opened new avenues for the investigation of these pathogens 6, 7. 
MNV replication results in the synthesis of new positive sense genomic and subgenomic RNA molecules, the latter of which corresponds to the last third of the viral genome (Figure 1). MNV contains four different open reading frames (ORFs), of which ORF1 occupies most of the genome and encodes seven non-structural proteins (NS1-7) released from a polyprotein precursor. ORF2 and ORF3 are contained within the subgenomic RNA region and encode the capsid proteins (VP1 and VP2, respectively) (Figure 1). Recently, we have identified that additional ORF4 overlapping ORF2 but in a different reading frame is functional and encodes for a mitochondrial localised virulence factor (VF1) 8.
Replication for positive sense RNA viruses, including noroviruses, takes place in the cytoplasm resulting in the synthesis of new uncapped RNA genomes. To promote viral translation, viruses exploit different strategies aimed at recruiting the cellular protein synthesis machinery 9-11. Interestingly, norovirus translation is driven by the multifunctional viral protein-primer VPg covalently linked to the 5' end of both genomic and subgenomic RNAs 12-14. This sophisticated mechanism of translation is likely to be a major factor in the limited efficiency of viral recovery by conventional reverse genetics approaches. 
Here we report two different strategies based on the generation of murine norovirus-1 (referred to as MNV herewith) transcripts capped at the 5' end. One of the methods involves both in vitro synthesis and capping of viral RNA, whereas the second approach entails the transcription of MNV cDNA in cells expressing T7 RNA polymerase. The availability of these reverse genetics systems for the study of MNV and a small animal model has provided an unprecedented ability to dissect the role of viral sequences in replication and pathogenesis 15-17.

Noroviruses are a major cause of gastroenteritis yet molecular techniques for their characterisation are still relatively new. Here we report two different reverse genetics approaches for the efficient recovery of murine norovirus (MNV), the only member of this genus which can be propagated in cell culture.

감염성 Murine 노로 바이러스의 역방향 유전학 중재 복구

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close ...

Forward Genetic Approaches in Chlamydia trachomatis

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its intractability to experimental transformation with recombinant DNA. We developed an approach to perform genetic analysis in C. trachomatis&#160;despite the lack of molecular genetic tools. Our method involves: i.) chemical mutagenesis to rapidly generate comprehensive libraries of genetically-defined mutants with distinct phenotypes; ii.) whole-genome sequencing (WGS) to map the underlying genetic lesions and to find associations between mutated gene(s) and a common phenotype; iii.) generation of recombinant strains through co-infection of mammalian cells with mutant and wild type bacteria. Accordingly, we were able to establish causal relationships between genotypes and phenotypes. The coupling of chemically-induced gene variation and WGS to establish correlative genotype&#8211;phenotype associations should be broadly applicable to the large list of medically and environmentally important microorganisms currently intractable to genetic analysis.

Forward Genetic Approaches in Chlamydia trachomatis

We describe a methodology to perform genetic analysis in Chlamydia based on chemical mutagenesis and whole genome sequencing. In addition, a system for DNA exchange within infected cells is described that can be used for genetic mapping. This method may be broadly applicable to microbial systems lacking transformation systems and molecular genetic tools.

앞으로 유전 접근<em&gt; 클라미디아의 trachomatis</em

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

마우스 대 식세포의 타고난 면역 반응을 조사하기 위해 RNA 간섭을 사용하여

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial pathogen which establishes chronic pulmonary infections in patients with cystic fibrosis (CF). The overproduction of a capsular polysaccharide called alginate, also known as mucoidy, promotes the formation of mucoid biofilms which are more resistant than planktonic cells to antibiotic chemotherapy and host defenses. Additionally, the conversion from the nonmucoid to mucoid phenotype is a clinical marker for the onset of chronic infection in CF. Alginate overproduction by P. aeruginosa is an endergonic process which heavily taxes cellular energy. Therefore, alginate production is highly regulated in P. aeruginosa. To better understand alginate regulation, we describe a protocol using the mini-himar1 transposon mutagenesis for the identification of novel alginate regulators in a prototypic strain PAO1. The procedure consists of two basic steps. First, we transferred the mini-himar1 transposon (pFAC) from host E. coli SM10/&#955;pir into recipient P. aeruginosa PAO1 via biparental conjugation to create a high-density insertion mutant library, which were selected on Pseudomonas isolation agar plates supplemented with gentamycin. Secondly, we screened and isolated the mucoid colonies to map the insertion site through inverse PCR using DNA primers pointing outward from the gentamycin cassette and DNA sequencing. Using this protocol, we have identified two novel alginate regulators, mucE (PA4033) and kinB (PA5484), in strain PAO1 with a wild-type mucA encoding the anti-sigma factor MucA for the master alginate regulator AlgU (AlgT, &#963;22). This high-throughput mutagenesis protocol can be modified for the identification of other virulence-related genes causing change in colony morphology.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Here we describe a protocol using the mini-himar1 mariner transposon-mediated mutagenesis for generating a high-density insertion mutant library to screen, isolate and identify novel alginate regulators in the prototypic Pseudomonas aeruginosa strain PAO1.

에 알긴산 생산과 관련된 새로운 유전자의 식별<em&gt; 녹농균</em&gt; 사용 미니<em&gt; himar1</em&gt; 마리너 트랜스포존 매개 돌연변이 유발

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify new compounds that can inhibit infection by the common drug resistant HIV-1 strains with minimal toxicity. Here we describe an efficient assay that can be used to rapidly determine the cellular cytotoxicity and efficacy of a compound against WT and mutant viral strains.
The desired target cell line is seeded in a 96-well plate and, after a 24 hr incubation, serially dilutions of the compounds to be tested are added. No further manipulations are necessary for cellular cytotoxicity assays; for anti HIV assays a predetermined amount of either a WT or drug resistant HIV-1 vector that expresses luciferase is added to the cells. Cytotoxicity is measured by using an ATP dependent luminescence assay and the impact of the compounds on infectivity is measured by determining the amount of luciferase in the presence or the absence of the putative inhibitors.
This screening assay takes 4 days to complete and multiple compounds can be screened in parallel. Compounds are screened in triplicate and the data are normalized to the infectivity/ATP levels in absence of target compounds. This technique provides a quick and accurate measurement of the efficacy and toxicity of potential anti HIV compounds.

Here we describe cellular cytotoxicity and single round infectivity assays that allow for the rapid and accurate screening of compounds to determine their cellular cytotoxicity (CC50) and IC50 values against WT and drug resistant HIV-1.

HIV 역전사 및 인테그라 제 억제제의 빠른 검사

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

Rapid Identification of Gram Negative Bacteria from Blood Culture Broth Using MALDI-TOF Mass Spectrometry

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional identification requires the sub-culture of signaled blood culture broth with identification available only after colonies on solid agar have matured. MALDI-TOF MS is a reliable, rapid method for identification of the majority of clinically relevant bacteria when applied to colonies on solid media. The application of MALDI-TOF MS directly to blood culture broth is an attractive approach as it has potential to accelerate species identification of bacteria and improve clinical management. However, an important problem to overcome is the pre-analysis removal of interfering resins, proteins and hemoglobin&#160;contained in blood culture specimens which, if not removed, interfere with the MS spectra and can result in insufficient or low discrimination identification scores. In addition it is necessary to concentrate bacteria to develop spectra of sufficient quality. The presented method describes the concentration, purification, and extraction of Gram negative bacteria allowing for the early identification of bacteria from a signaled blood culture broth.

The application of matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry (MS) directly to blood culture broth expedites the identification of bacteria. The presented method is a rapid and reliable method for identification of Gram negative bacteria directly from blood culture broth.

MALDI-TOF 질량 분석기를 사용하여 혈액 배양액에서 그람 음성 박테리아의 빠른 확인

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional ...

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependent-innate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in na&#239;ve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified parasite gene to establishment of chronic infection.

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&amp;#947;-Dependent Cell Autonomous Immunity

Forward genetics is a powerful approach to identify genes in intracellular pathogens important for resistance to cell autonomous immunity. The current approach uses innate immune cells, specifically macrophages, to identify novel Toxoplasma gondii genes important for immune evasion.

앞으로 유전학 식별하는 대 식세포를 사용하여 화면<em&gt; 톡소 포자충</em&gt; 유전자 중요 저항이하는 IFN-γ 의존 세포 자치 내성

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

에 참여 호스트 요인의 높은 처리량 검사에 대한 현미경 기반 분석 실험<em&gt; 브루셀라</em&gt; HeLa 세포의 감염

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.