This project was funded by The Samuel Roberts Noble Foundation. Authors thank Mss. Janie Gallaway and Colleen Elles for excellent plant care; and Ms. Katie Brown for artwork. We also would like to thank Mss. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda and Mr. Isaac Greenhut for technical help during establishment of this protocol.

1. Plant Growth and Target Gene Silencing
<ol>
	<li>
		Plant growth conditions:
		<ol>
			<li>
				Sow N. benthamiana seeds on soil-less potting mixture, Metro-Mix 350 and germinate the seeds in a growth chamber. Any other soil or soil-less medium can also be used instead of Metro-Mix.</li>
			<li>
				Transplant three-week old seedlings into individual pots and grow them in a greenhouse maintained at 21&plusmn;2 &deg;C along with other growth conditions as detailed in previous literature12. Two to three days after transplanting, plants can be used for TRV inoculation.</li>
		</ol>
	</li>
	<li>
		Growing TRV2 clones: 
		TRV is a bipartite virus and its genome consists of RNA1 and RNA2. RNA1 encodes an RNA-dependent RNA polymerase and a movement protein20,21. RNA2 encodes a coat protein (CP) and two nonstructural proteins from the subgenomic RNAs21. Both RNA1 and RNA2 are required for the formation of matured virus particles and their spread20,21. cDNA library construction in TRV2 vector is described in previous literature22,23. Briefly, VIGS library used in this study was constructed from the RNA extracted from leaf tissues exposed to various biotic and abiotic elicitors.
		<ol>
			<li>
				Take out Agrobacterium (GV2260 strain) containing the cDNA clones in TRV2 vector (a 96-well plate) from the freezer. Gradually thaw them and after the cultures reach room temperature, inoculate the individual Agrobacterium culture onto Luria-Bertani (LB) agar plate with rifampicin (10 &mu;g/ml) and kanamycin (50 &mu;g/ml) using a 96-pin replicator.</li>
			<li>
				Incubate the plates at 28 &deg;C for two days. We usually grow four replicate colonies for each clone so that adequate Agrobacterium inoculum is available for prick inoculation of two plants. Perform all the steps under sterile conditions.</li>
		</ol>
	</li>
	<li>
		VIGS:
		<ol>
			<li>
				Grow Agrobacterium (GV2260) carrying TRV1 at 28 &deg;C in LB liquid medium with antibiotics mentioned above. Harvest cells by centrifugation from overnight grown cultures, re-suspend in the inoculation buffer (10 mM MES, pH 5.5; 200 &mu;M acetosyringone), and incubate for 3 hr at room temperature on a shaker at 50 rpm.</li>
			<li>
				Harvest the cells by centrifugation and re-suspend in 5 mM MES buffer (pH 5.5) and inoculate (OD600 = 0.3) into abaxial side of 3-4 N. benthamiana leaves using a needleless syringe. Detailed inoculation procedure is demonstrated in previous literature24. Later, at the site of TRV1 inoculation, inoculate respective TRV2 colonies by pricking the leaves with a toothpick.</li>
			<li>
				Maintain the plants with adequate nutrition as vigorous growth is important for efficient VIGS12. About two weeks post inoculation the transcripts of targeted genes will begin to reduce and the plants are ready for pathogen inoculation at three weeks after TRV inoculation.</li>
		</ol>
	</li>
</ol>

	2. Preparation of Nonhost Pathogen Cultures and Plant Inoculation
<ol>
	<li>
		Details of pathogens used in this study: 
		Pseudomonas syringae pv. tabaci, P. syringae pv. tomato T1, P. syringae pv. glycinea and Xanthomonas campestris pv. vesicatoria are used in this study. Grow P. syringae strains in King&#39;s B (KB) liquid medium supplemented with rifampicin (10 &mu;g/ml), kanamycin (50 &mu;g/ml) at 28 &deg;C for 12 hr. Grow X. campestris pv. vesicatoria in LB liquid medium for 16 hr. All pathogens harbor a plasmid that can express GFPuv as described in previous literature19.</li>
	<li>
		Preparation of pathogen cultures for plant inoculation:
		<ol>
			<li>
				Harvest bacterial cells by centrifugation and confirm the presence of green fluorescence using long wavelength UV lamp in the dark. Wash the cells twice with sterile water and re-suspend them to the desired concentration using sterile water.</li>
			<li>
				Inoculate the respective pathogen(s) on to abaxial side of target gene silenced leaves (5th to 8th) as spots (about 1.5 cm diameters). Several nonhost pathogens can be simultaneously tested for their growth in the target gene silenced plants. Simultaneously inoculate the host pathogen as this can be used as a positive control for viewing in planta bacterial growth. Also inoculate vector control (TRV::00) plants.</li>
		</ol>
	</li>
</ol>

	3. Observation of in planta Growth of Bacterial Pathogens
<ol>
	<li>
		Expose the inoculated leaves to a long wavelength UV light in the dark. Bacterial colonies can be viewed as green fluorescent dots in the abaxial side of the leaf in the background of red fluorescence emitted by leaf surface.</li>
	<li>
		Observe pathogen growth from 2 days post inoculation (dpi) to 5 dpi. Everyday observation during this time interval is necessary.</li>
	<li>
		After the first screen, short list the clones whose silencing results in growth of one or more nonhost pathogen(s).</li>
	<li>
		Repeat VIGS for the selected clones and again test the response of gene silenced plants to nonhost pathogen(s). This second level of screening is done to remove the false positives obtained during the first screen.</li>
</ol>

	4. Confirmation of Shortlisted Plants for Compromised Nonhost Resistance
<ol>
	<li>
		Silence the cDNA clones selected from the screen as described above. Inoculate the whole plant with nonhost pathogen(s) by submerging the plants with respective pathogen cultures with 0.01% (v/v) Silwet L-77 and subjecting the submerged plants to vacuum for 3 - 5 min. Quantify the bacterial growth by conventional growth assay6,18,19 as described below.</li>
	<li>
		At 0 hr post inoculation (hpi), 3 dpi and 5 dpi, collect two leaf samples from five biological replicates for each nonhost pathogen(s) inoculated leaves using a leaf punch (0.5 cm2). Grind the leaf samples, serial dilute and plate the sap on KB agar medium supplemented with appropriate antibiotics and incubate at 28 &deg;C for 2 days. Count the bacterial colonies using a colony counter and calculate the bacterial growth in the leaves as described in previous literature6.</li>
	<li>
		Plants susceptible to nonhost pathogen(s) should show higher number of pathogen growth compared to vector control.</li>
</ol>

	5. Sequencing the Insert and Identification of Target Gene
<ol>
	<li>
		Perform colony PCR for the selected clone using attB1 and attB2 primers or using the primers flanking the cloning site in the TRV2 vector. Run the PCR product on the gel and check for amplification of the single band.</li>
	<li>
		Plant gene insert in the TRV2 vector can be sequenced using attB primers or primers flanking the cloning site.</li>
	<li>
		Perform BLAST using the sequence and identify the gene details.</li>
	<li>
		Obtain full length gene sequence along with the un-translated regions (UTRs).</li>
	<li>
		Select 300-400 bp fragments from three different regions of the sequence and clone them into TRV2 vector. Independently perform VIGS using all three VIGS constructs and confirm the compromise of nonhost resistance in all three gene silenced plants.</li>
</ol>

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

We have nothing to disclose.

Plant immunity limits the growth of nonhost pathogens and hence, little or no green fluorescence is emitted from vector control plant leaves inoculated with nonhost pathogen under long wavelength UV light (Figure 3D). However, when a gene involved in nonhost resistance is silenced, the gene silenced plants favor the growth of nonhost pathogen and green fluorescence is seen (Figure 3E). This is the basic principle involved in the method described in this manuscript. This methodology has...

Konakçı olmayan direnç belirli bir patojen 1,2 yarışları karşı tüm bitki türlerinin direncidir. Bu geniş spektrum ve bitkiler 2,3 dayanıklı hastalık direnci verir. Bununla birlikte, özellikle de bakteriyel patojenlere karşı mekanizması, iyi 4 anlaşılmış değildir. Uzlaşma konakçı olmayan direnç ve konakçı olmayan direnç 5-9 sırasında farklı şekilde ifade genlerin tanımlanması için yüksek verimlilik transkript profil daha önce bakteriyel konakçı olmayan direnç diseksiyon için kullanılan iki ana yaklaşım olduğunu mutantlar veya susturulması bitkiler için tarama. Konakçı olmayan direnç birçok gen, gen tanımlama için bir yüksek verimlilik fonksiyonel genomik yaklaşım katılımı ile karmaşık bir mekanizma (lar) 4 tarafından kontrol edildiği için konakçı olmayan direnç mekanizması (ler) daha iyi anlamasını önemlidir. Virüs kaynaklı gen susturulması (VIGS) başarıyla endojen bitki susturmak için kullanılmıştırBirçok bitki türünün 10,11 genlerin. Nicotiana benthamiana VIGS 10,12 ve taslak genom dizisi için en uygun tesislerinden biri şimdi 13 kullanılabilir. Tütün çıngırak virüsü (TRV) tabanlı VIGS yaygın olarak ters genetik aracı olarak kullanılmıştır konakçı olmayan direnç 2,4,14 ilgili genler karakterize etmek. Bu VIGS vektörler ve türevleri Arabidopsis Biyolojik Kaynak Merkezi (ABRC aracılığıyla mevcuttur <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html</a> ). VIGS da bitki bağışıklık 15-17, özellikle konakçı olmayan direnç 6,18 katılan genlerin belirlenmesi için ileri genetik aracı olarak kullanılmıştır. Hiperduyarlı cevap (İK)-aracılık ettiği özel bir konakçı olmayan patojene karşı bitkileri kaynaklı hücre ölümü değerlendirilmesi ve hastalığa bağlı hücre ölümü değerlendirmek özellikle TANIMLAMA için kullanılan iki ana tahlillerdirg duyarlı gen bitkiler susturuldu. Ancak, İK hücre ölümü tek tip-II konakçı olmayan patojenlere karşı indüklenir değil, tip I konakçı olmayan patojenler 2 karşı. Bu nedenle, İK deneyleri evrensel özellikle tip-I konakçı olmayan patojenlerin geniş bir karşı, bitkiler tarafından kullanılan konakçı olmayan direnç stratejilerini belirlemek için kullanılamaz. Ayrıca, bir genin susturulması bitki konakçı olmayan direnç kısmi kaybı her zaman hastalık belirtileri 6 ve dolayısıyla hastalık puanlama konakçı olmayan direnç ödün bitkilerin belirlenmesi için kullanılamaz yol açmaz. Aksine, genin susturulması konakçı olmayan bitkilerde patojen büyüme değerlendirilmesi genin susturulması konakçı olmayan bitkilerde direnç kaybı eğitim için daha iyi bir yöntemdir. Geleneksel büyüme deneyi 6,19, genin susturulması konakçı olmayan bitkilerde bakteri üremesi değerlendirmek için hızlı bir yöntem ile karşılaştırıldığında, ileri genetik taraması için gereken zamanı kısaltır. Daha önce bakteri gözlemlemek için bir yöntem raporultraviyole altında çıplak gözle yapraklarda l patojen büyüme (UV) açık yeşil floresan proteininin (GFP) 19 ifade bakteri kullanarak. Bu yazıda biz konakçı olmayan direnci için tehlikeye gen susturulması bitki kolay tanımlama için konakçı olmayan bakteriyel patojenler ifade GFPuv yararlılığını göstermektedir. Bu metodoloji duyarlı bitkilerin belirlenmesi için doğru ve yüksek verimli görüntüleme için müsait.

<table><tbody><tr><td>96-well U-bottom plates</td><td>Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td><td>35-3077</td><td></td></tr><tr><td>96-pin replicator stainless steel</td><td>Nalge Nunc International (Naperville, IL, USA)</td><td>250520</td><td></td></tr><tr><td>High Intensity UV Inspection Lamps, Model B-100ap</td><td>Thomas scientific (Swedesboro, NJ, USA)</td><td>6283K50</td><td>Manufacturer ID 95-0127-01 </td></tr><tr><td>Stuart SC6 colony counter</td><td>Bibby Scientific Limited, Staffordshire, UK</td><td>SC6PLUS</td><td></td></tr><tr><td>Soil-less potting mixture, Metro-Mix 350</td><td>SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td><td></td><td></td></tr><tr><td>Primers:&lt;br/&gt; attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)&lt;br/&gt; attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td><td>Integrated DNA Technologies, Inc (Coralville, IA, USA)</td><td>Custom synthesized</td><td></td></tr><tr><td>MES, Monohydrate </td><td>VWR international (Radnor, PA, USA)</td><td>CAS No. 145224-94-8</td><td></td></tr><tr><td>Acetosyringone (Dimethoxy-4&amp;rsquo;-hydroxyacetophenone) </td><td>Sigma Aldrich (St. Louis, MO, USA)</td><td>D134406</td><td></td></tr><tr><td>Vac-In-Stuff (Silwet L-77)</td><td>Lehle Seeds (Round Rock, TX, USA)</td><td>VIS-30</td><td></td></tr></tbody></table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

Bakteriyel patojenlere karşı bitkilerin konakçı olmayan hastalık direnci karmaşık bir savunma yollar ile kontrol edilir. Bu mekanizmanın anlaşılması patojenlerin geniş bir karşı dayanıklı hastalığa dirençli bitkilerin geliştirilmesi için önemlidir. Virüs kaynaklı gen susturulması (VIGS) tabanlı ileri genetik tarama konakçı olmayan direnç aktarmanın bitki savunma genlerin belirlenmesi için yararlı bir yaklaşımdır. Tütün çıngırak virüsü (TRV) tabanlı VIGS vektör bugüne kadar en verimli VIGS vektör ve verimli bir şekilde kullanılmaktadır Nicotiana benthamiana endojen hedef genlerin susturmak için. Bu yazıda, N. bir cDNA kütüphanesi tek tek klonların susturmak için bir ileri genetik tarama yaklaşımı göstermek benthamiana ve konakçı olmayan patojenlere karşı tehlikeye konakçı olmayan direnç için gen susturulması bitkilerin yanıt değerlendirilmesi, Pseudomonas syringae pv. domates T1, P. syringae pv. glycInea ve X campestris pv. vesicatoria. Bu bakteriyel patojenler ifade GFPuv proteine ​​tasarlanmıştır ve susturuldu hedef gen konakçı olmayan direnç aktarmanın söz konusu ise kendi yeşil Florasanl koloniler konakçı olmayan patojen aşılanmış bitkilerde UV ışık altında çıplak gözle görülebilir. Bu konakçı olmayan patojenlere duyarlı gen susturulması bitkilerin güvenilir ve daha hızlı kimlik kolaylaştırır. Bundan başka, umut verici bir aday gen bilgi TRV vektör bitki geni uç sıralanmasıyla bilinebilir. Burada konakçı olmayan direnç ile ilgili genleri tanımlamak için VIGS-aracılı ileri genetik yüksek verimlilik yeteneği göstermektedir. Yaklaşık, 100 cDNAs ayrı ayrı sonra bir hafta içinde incelenebilir yaklaşık iki üç hafta ve birkaç konakçı olmayan bakteriyel patojenler karşı konakçı olmayan direnç önemleri de susturulabilir. Bu yazıda, bu tarama ile ilgili ayrıntılı adımlar numaralandırmak. VIGS-aracılı ileri genetik Screening yaklaşım, konakçı olmayan direnç katılan genlerin belirlenmesi için değil, aynı zamanda, çeşitli bitki türlerinde çeşitli biyotik ve abiyotik stres tolerans kazandıran genler incelemek için sadece uzatılabilir.

Major aim of this study is to demonstrate a method for easy and accurate identification of gene silenced N. benthamiana plants that are compromised for nonhost resistance. There are four major steps in this methodology. First step is to individually silence large number of genes using TRV-VIGS. We had silenced about 5,000 genes6,18 over a period of about 1.5 years using the protocol depicted in Figure 1. Some of the gene silenced plants showed various phenotypic alterations includin...

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Virus-induced gene silencing is an useful tool for identifying genes involved in nonhost resistance of plants. We demonstrate the use of bacterial pathogens expressing GFPuv in identifying gene silenced plants susceptible to nonhost pathogens. This approach is easy, fast and facilitates large scale screening and similar protocol can be applied to studying various other plant-microbe interactions.

Genler belirlenmesi için VIGS-aracılığı ile İleri Genetik Tarama konakçı olmayan Direnç ilgilendim


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

vigs-mediated-forward-genetics-screening-for-identification-genes

Research

JoVE Journal

Immunology and Infection

16.9K Görüntüleme.  The Samuel Roberts Noble Foundation.  Virus-induced gene silencing is an useful tool for identifying genes involved in nonhost resistance of plants. We demonstrate the use of bacterial pathogens expressing GFPuv in identifying gene silenced plants susceptible to nonhost pathogens. This approach is easy, fast and facilitates large scale screening and similar protocol can be applied to studying various other plant-microbe interactions.

Video: VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

RNAi Tarama için ilgilendim Ana Faktörler Vaccinia Virüs Enfeksiyonu Drosophila Hücre

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

İmmünoloji ve Enfeksiyon

Forward Genetic Approach to Uncover Stress Resistance Genes in Mice &#8212; A High-throughput Screen in ES Cells

Phenotype-driven genetic screens in mice is a powerful technique to uncover gene functions, but are often hampered by extremely high costs, which severely limits its potential. We describe here the use of mouse embryonic stem (ES) cells as surrogate cells to screen for a phenotype of interest and subsequently introduce these cells into a host embryo to develop into a living mouse carrying the phenotype. This method provides (1) a cost effective, high-throughput platform for genetic screen in mammalian cells; (2) a rapid way to identify the mutated genes and verify causality; and (3) a short-cut to develop mouse mutants directly from these selected ES cells for whole animal studies. We demonstrated the use of paraquat (PQ) to select resistant mutants and identify mutations that confer oxidative stress resistance. Other stressors or cytotoxic compounds may also be used to screen for resistant mutants to uncover novel genetic determinants of a variety of cellular stress resistance.

Stress resistance is one of the hallmarks for longevity and is known to be genetically governed. Here, we developed an unbiased high-throughput method to screen for mutations that confer stress resistance in ES cells with which to develop mouse models for longevity studies.

İleri Genetik Yaklaşım Farelerde Stres Direnci Genler ortaya çıkarmak için - ES Hücrelerde bir Yüksek verim Ekranı

Phenotype-driven genetic screens in mice is a powerful technique to uncover gene functions, but are often hampered by extremely high costs, which severely ...

Gelişim Biyolojisi

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

Memeli Hücrelerinde CRISPR / Cas9 aracılı Gen Knockout&#39;larının Seçime Bağlı ve Bağımsız Üretimi

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Genetik

Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

Here we describe a protocol for employing high-throughput RNAi screening to uncover host targets that can be manipulated to enhance oncolytic virus therapy, specifically rhabodvirus and vaccinia virus therapy, but it can be readily adapted to other oncolytic virus platforms or for discovering host genes that modulate virus replication generally.

Tedavi Oncolytic virusu modüle ana faktörleri tanımlamak için genom çapında RNAi tarama

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus ...

Kanser Araştırmaları

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic screening using chemical mutagens is a useful strategy for mapping mutant phenotypes to genes among Drosophila and other model organisms that share conserved cellular pathways with humans. If the mutated gene of interest is not lethal in early developmental stages of flies, a climbing assay can be conducted to screen for phenotypic indicators of decreased brain functioning, such as low climbing rates. Subsequently, secondary histological analysis of brain tissue can be performed in order to verify the neuroprotective function of the gene by scoring neurodegeneration phenotypes. Gene mapping strategies include meiotic and deficiency mapping that rely on these same assays can be followed by DNA sequencing to identify possible nucleotide changes in the gene of interest.

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

We present a protocol using a forward genetic approach to screen for mutants exhibiting neurodegeneration in Drosophila melanogaster. It incorporates a climbing assay, histology analysis, gene mapping and DNA sequencing to ultimately identify novel genes related to the process of neuroprotection.

In vivo Ileri genetik ekran Drosophila melanogaster yeni Nörokoruyucu genler tanımlamak için

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Virus-induced Gene Silencing (VIGS) in Nicotiana benthamiana and Tomato

RNA interference (RNAi) is a highly specific gene-silencing phenomenon triggered by dsRNA1. This silencing mechanism uses two major classes of RNA regulators: microRNAs, which are produced from non-protein coding genes and short interfering RNAs (siRNAs). Plants use RNAi to control transposons and to exert tight control over developmental processes such as flower organ formation and leaf development2,3,4. Plants also use RNAi to defend themselves against infection by viruses. Consequently, many viruses have evolved suppressors of gene silencing to allow their successful colonization of their host5.
Virus-induced gene silencing (VIGS) is a method that takes advantage of the plant RNAi-mediated antiviral defense mechanism. In plants infected with unmodified viruses the mechanism is specifically targeted against the viral genome. However, with virus vectors carrying sequences derived from host genes, the process can be additionally targeted against the corresponding host mRNAs. VIGS has been adapted for high-throughput functional genomics in plants by using the plant pathogen Agrobacterium tumefaciens to deliver, via its Ti plasmid, a recombinant virus carrying the entire or part of the gene sequence targeted for silencing. Systemic virus spread and the endogenous plant RNAi machinery take care of the rest. dsRNAs corresponding to the target gene are produced and then cleaved by the ribonuclease Dicer into siRNAs of 21 to 24 nucleotides in length. These siRNAs ultimately guide the RNA-induced silencing complex (RISC) to degrade the target transcript2.
Different vectors have been employed in VIGS and one of the most frequently used is based on tobacco rattle virus (TRV). TRV is a bipartite virus and, as such, two different A. tumefaciens strains are used for VIGS. One carries pTRV1, which encodes the replication and movement viral functions while the other, pTRV2, harbors the coat protein and the sequence used for VIGS6,7. Inoculation of Nicotiana benthamiana and tomato seedlings with a mixture of both strains results in gene silencing. Silencing of the endogenous phytoene desaturase (PDS) gene, which causes photobleaching, is used as a control for VIGS efficiency. It should be noted, however, that silencing in tomato is usually less efficient than in N. benthamiana. RNA transcript abundance of the gene of interest should always be measured to ensure that the target gene has efficiently been down-regulated. Nevertheless, heterologous gene sequences from N. benthamiana can be used to silence their respective orthologs in tomato and vice versa8.

Virus-induced Gene Silencing VIGS in Nicotiana benthamiana and Tomato

Description of a virus-induced gene silencing (VIGS) method for knock-down of gene expression in Nicotiana benthamiana and tomato.

Virüs indüklenen gen susturma (VIGS) Nicotiana benthamiana Ve Domates

RNA interference (RNAi) is a highly specific gene-silencing phenomenon triggered by dsRNA1. This silencing mechanism uses two major classes of RNA ...

Biyoloji

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependent-innate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in na&#239;ve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified parasite gene to establishment of chronic infection.

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Forward genetics is a powerful approach to identify genes in intracellular pathogens important for resistance to cell autonomous immunity. The current approach uses innate immune cells, specifically macrophages, to identify novel Toxoplasma gondii genes important for immune evasion.

İleri Genetik tanımak makrofajlar kullanılarak Ekranlar<em&gt; Toxoplasma gondii</em&gt; Genler önemli direnç için IFN-γ-bağımlı hücre otonom bağışıklık

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

Agrobacterium-Mediated Virus-Induced Gene Silencing Assay In Cotton

Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties. The large-scale gene functional analysis in cotton has been lagged behind most of the modern plant species, likely due to its large size of genome, gene duplication and polyploidy, long growth cycle and recalcitrance to genetic transformation1. To facilitate high throughput functional genetic/genomic study in cotton, we attempt to develop rapid and efficient transient assays to assess cotton gene functions.
Virus-Induced Gene Silencing (VIGS) is a powerful technique that was developed based on the host Post-Transcriptional Gene Silencing (PTGS) to repress viral proliferation2,3. Agrobacterium-mediated VIGS has been successfully applied in a wide range of dicots species such as Solanaceae, Arabidopsis and legume species, and monocots species including barley, wheat and maize, for various functional genomic studies3,4. As this rapid and efficient approach avoids plant transformation and overcomes functional redundancy, it is particularly attractive and suitable for functional genomic study in crop species like cotton not amenable for transformation.
In this study, we report the detailed protocol of Agrobacterium-mediated VIGS system in cotton. Among the several viral VIGS vectors, the tobacco rattle virus (TRV) invades a wide range of hosts and is able to spread vigorously throughout the entire plant yet produce mild symptoms on the hosts5. To monitor the silencing efficiency, GrCLA1, a homolog gene of Arabidopsis Cloroplastos alterados 1 gene (AtCLA1) in cotton, has been cloned and inserted into the VIGS binary vector pYL156. CLA1 gene is involved in chloroplast development6, and previous studies have shown that loss-of-function of AtCLA1 resulted in an albino phenotype on true leaves7, providing an excellent visual marker for silencing efficiency. At approximately two weeks post Agrobacterium infiltration, the albino phenotype started to appear on the true leaves, with 100% silencing efficiency in all replicated experiments. The silencing of endogenous gene expression was also confirmed by RT-PCR analysis. Significantly, silencing could potently occur in all the cultivars we tested, including various commercially grown varieties in Texas. This rapid and efficient Agrobacterium-mediated VIGS assay provides a very powerful tool for rapid large-scale analysis of gene functions at genome-wide level in cotton.

We present the detailed protocol for Agrobacterium-mediated virus-induced gene silencing (VIGS) assay in cotton. The tobacco rattle virus (TRV)-derived VIGS vectors were deployed to induce RNA silencing of cotton GrCLA1, Cloroplastos alterados 1 gene. The albino phenotype caused by silencing GrCLA1 was observed at the seedling stage within 2 weeks after inoculation.

Pamuk olarak Agrobacterium Virüs Bağlı Gen susturma Testi

Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties.  The ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated tools and resources for studies in this system are facilitating continued discovery of genes with more subtle phenotypes or roles. 
Here we present a generalized protocol we adapted for identifying C. elegans genes with postembryonic phenotypes of interest using RNAi2. This procedure is easily modified to assay the phenotype of choice, whether by light or fluorescence optics on a dissecting or compound microscope. This screening protocol capitalizes on the physical assets of the organism and molecular tools the C. elegans research community has produced. As an example, we demonstrate the use of an integrated transgene that expresses a fluorescent product in an RNAi screen to identify genes required for the normal localization of this product in late stage larvae and adults. First, we used a commercially available genomic RNAi library with full-length cDNA inserts. This library facilitates the rapid identification of multiple candidates by RNAi reduction of the candidate gene product. Second, we generated an integrated transgene that expresses our fluorecently tagged protein of interest in an RNAi-sensitive background. Third, by exposing hatched animals to RNAi, this screen permits identification of gene products that have a vital embryonic role that would otherwise mask a post-embryonic role in regulating the protein of interest. Lastly, this screen uses a compound microscope equipped for single cell resolution.

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

We describe a sensitized method to identify postembryonic regulators of protein expression and localization in C. elegans using an RNAi-based genomic screen and an integrated transgene that expresses a functional, fluorescently tagged protein.

Içinde Postembryonic Fenotiplerin Belirleme RNAi Tarama C. elegans</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

Araçlar Viral Immunomodulators ve ana bilgisayar Antiviral faktörler tanımlanması için eleme olarak Abdovirüs enfeksiyonlar

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

Genler belirlenmesi için VIGS-aracılığı ile İleri Genetik Tarama konakçı olmayan Direnç ilgilendim

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler