Questo progetto è stato finanziato dalla Fondazione Samuel Roberts Noble. Autori ringraziano Mss. Janie Gallaway e Colleen Elles per un&#39;eccellente cura delle piante, e la signora Katie Brown per opere d&#39;arte. Vorremmo anche ringraziare Mss. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda e il signor Isaac Greenhut per assistenza tecnica durante istituzione di questo protocollo.

1. Crescita delle piante e Target silenziamento genico <ol><li> Condizioni di crescita delle piante: <ol><li> Seminare N. semi benthamiana sul suolo-meno miscela invasatura, Metro-Mix 350 e germinare i semi in una camera di crescita. Qualsiasi altro suolo o fuori suolo medio può anche essere usato al posto di Metro-Mix. </li><li> Trapianto di tre settimane vecchie piantine in singoli vasi e farli crescere in una serra mantenuta a 21 ± 2 ° C insieme ad altre condizioni di crescita, come descritto nella letteratura precedente 12. Due o tre giorni dopo il trapianto, le piante possono essere utilizzati per TRV inoculazione. </li></ol></li><li> Crescere TRV2 cloni: TRV è un virus bipartito e il suo genoma è costituito da RNA1 e RNA2. RNA1 codifica un RNA polimerasi RNA-dipendente e una proteina movimento 20,21. RNA2 codifica una proteina di rivestimento (CP) e due proteine ​​non strutturali provenienti dai RNA subgenomici 21. Sia RNA1 e RNA2 sono necessari per la formazione di vir maturatonoi particelle e la loro diffusione 20,21. costruzione della libreria di cDNA in TRV2 vettore è descritto nella letteratura precedente 22,23. Brevemente, biblioteca VIGS utilizzato in questo studio è stato costruito dagli RNA estratto da tessuti fogliari esposti a vari elicitori biotici e abiotici. <ol><li> Estrarre Agrobacterium (GV2260 ceppo) contenente i cloni di cDNA in TRV2 vettore (una piastra a 96 pozzetti) dal freezer. A poco a poco li scongelare e dopo le culture a temperatura ambiente, inoculare la cultura Agrobacterium individuale su Luria-Bertani (LB) piastra di agar con rifampicina (10 mg / ml) e kanamicina (50 mg / ml) utilizzando un replicatore 96-pin. </li><li> Incubare le piastre a 28 ° C per due giorni. Noi di solito crescono quattro colonie repliche per ogni clone in modo adeguato Agrobacterium inoculo è disponibile per pungere l&#39;inoculazione dei due impianti. Eseguire tutte le operazioni in condizioni sterili. </li></ol></li><li> VIGS: <ol><li> CrescereAgrobacterium (GV2260) portante TRV1 a 28 ° C in terreno liquido LB con antibiotici summenzionati. Celle di raccolta per centrifugazione di culture cresciute durante la notte, risospendere nel buffer di inoculazione (10 mM MES, pH 5.5, 200 mM acetosyringone), e incubare per 3 ore a temperatura ambiente su un agitatore a 50 rpm. </li><li> Raccogliere le cellule per centrifugazione e risospendere in 5 mM MES tampone (pH 5,5) e inoculare (OD 600 = 0,3) nel lato abaxial di 3-4 N. benthamiana lascia utilizzando una siringa senza ago. Procedura di inoculazione dettagliato è dimostrato nella letteratura precedente 24. Più tardi, nella sede di inoculazione TRV1, inoculare rispettivi TRV2 colonie, pungendo le foglie con uno stuzzicadenti. </li><li> Mantenere le piante con una nutrizione adeguata, come la crescita vigorosa è importante per VIGS efficienti 12. Circa due settimane dopo l&#39;inoculazione le trascrizioni dei geni mirati cominceranno a diminuire e le piante sono pronte per INOC patogenomento a tre settimane dopo l&#39;inoculazione TRV. </li></ol></li></ol> 2. Preparazione di Nonhost Culture patogeno e inoculazione impianto <ol><li> Dettagli di agenti patogeni utilizzati in questo studio: Pseudomonas syringae pv. Tabaci, P. syringae pv. pomodoro T1, P. syringae pv. glycinea e Xanthomonas campestris pv. vesicatoria sono utilizzati in questo studio. Crescere P. syringae in B Re (KB) mezzo liquido integrato con rifampicina (10 mg / ml), kanamicina (50 mg / ml) a 28 ° C per 12 ore. Crescere X. campestris pv. vesicatoria in LB liquido per 16 ore. Tutti gli agenti patogeni harbor un plasmide che può esprimere GFPuv come descritto nella letteratura precedente 19. </li><li> Preparazione delle colture di agenti patogeni per l&#39;inoculazione impianto: <ol><li> Raccogliere le cellule batteriche mediante centrifugazione e confermare la presenza di fluorescenza verde tramite lunghe walampada UV velength al buio. Lavare le cellule due volte con acqua sterile e risospendere alla concentrazione desiderata con acqua sterile. </li><li> Seminare il rispettivo agente patogeno (s) sul lato abaxial di geni silenziati foglie di destinazione (5 all&#39;8) come macchie (circa 1,5 cm diametro). Diversi patogeni nonhost possono essere testati simultaneamente per la loro crescita nel gene piante silenziate bersaglio. Contemporaneamente inoculare il patogeno host come questo può essere usato come controllo positivo per la visualizzazione in planta crescita batterica. Inoculare anche il controllo vettoriale (TRV :: 00) piante. </li></ol></li></ol> 3. Osservazione in planta di crescita di batteri patogeni <ol><li> Esporre le foglie inoculate ad una lunga luce UV di lunghezza d&#39;onda nel buio. Colonie batteriche possono essere visualizzate come punti verdi fluorescenti nella parte abassiale della foglia sullo sfondo di fluorescenza rossa emessa dalla superficie della foglia. </li><li> Osservare la crescita dei patogeniDa 2 giorni dopo l&#39;inoculazione (dpi) a 5 dpi. L&#39;osservazione quotidiana durante questo intervallo di tempo è necessario. </li><li> Dopo la prima schermata, breve elenco dei cloni il cui silenziamento risultati in crescita di uno o più agenti patogeni nonhost (s). </li><li> Ripetere VIGS per i cloni selezionati e nuovamente valutare la risposta dei geni di piante silenziate patogeno nonhost (s). Questo secondo livello di screening è fatto per rimuovere i falsi positivi ottenuti nel primo schermo. </li></ol> 4. Conferma di piante selezionate per resistenza Nonhost compromessa <ol><li> Tacere i cloni di cDNA selezionate dalla schermata come descritto sopra. Inoculare l&#39;intera pianta con nonhost patogeno (s) immergendo le piante con rispettive culture patogeno con 0,01% (v / v) Silwet L-77 e sottoponendo le piante sommerse per aspirare per 3 - 5 min. Quantificare la crescita batterica mediante saggio di crescita convenzionale 6,18,19 come descritto di seguito. </li><li> A 0 ore post inoculazione (HPI),3 dpi e 5 dpi, raccolgono due campioni di foglie da cinque biologico repliche per ciascun patogeno nonhost (s) foglie inoculate con un pugno foglia (0,5 cm 2). Macinare i campioni di foglie, di serie diluito e piatto il SAP su KB agar addizionato con antibiotici e incubare appropriate a 28 ° C per 2 giorni. Contare le colonie batteriche utilizzando un contatore di colonie e calcolare la crescita batterica nelle foglie, come descritto nella letteratura precedente 6. </li><li> Piante sensibili al nonhost patogeno (s) dovrebbero mostrare maggiore numero di crescita dei patogeni rispetto al controllo vettoriale. </li></ol> 5. Sequenziamento Inserisci e Identificazione di Target Gene <ol><li> Eseguire colonia PCR per il clone selezionato utilizzando attB1 e attB2 primer o utilizzando i primer fiancheggianti il ​​sito di clonaggio nel vettore TRV2. Eseguire il prodotto di PCR sul gel e controllare l&#39;amplificazione della singola banda. </li><li> Inserto gene vegetale nel vettore TRV2 può essere sequenziato usando attBprimer o primer fiancheggianti il ​​sito di clonazione. </li><li> Eseguire BLAST utilizzando la sequenza e identificare i dettagli gene. </li><li> Ottenere piena sequenza genica lunghezza insieme con le regioni non tradotti (UTR). </li><li> Selezionare 300-400 bp frammenti provenienti da tre diverse regioni della sequenza e li clonare in TRV2 vettore. Indipendentemente eseguire VIGS utilizzando tutti e tre i VIGS costrutti e confermare il compromesso di resistenza nonhost in tutte e tre le piante silenziate gene. </li></ol>

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

Non abbiamo nulla da rivelare.

Immunità impianto limita la crescita di patogeni nonhost e, quindi, poca o nessuna fluorescenza verde è emessa da impianti di controllo vettoriale foglie inoculate con patogeni nonhost sotto luce UV di lunghezza d&#39;onda lunga (Figura 3D). Tuttavia, quando un gene coinvolto nella resistenza nonhost viene messo a tacere, le piante silenziate gene favoriscono la crescita di nonhost fluorescenza patogeno e verde è visto (Figura 3E). Questo è il principio di base coinvolti nel metodo ...

Nonhost resistenza è la resistenza di tutte le specie vegetali da anelli di un particolare agente patogeno 1,2. Questo conferisce ampio spettro e durevole resistenza alle malattie nelle piante 2,3. Tuttavia, il suo meccanismo, in particolare contro batteri patogeni, non è ben compreso 4. Screening per mutanti o piante tacere che la resistenza nonhost compromesso, e l&#39;alta velocità trascrizione profiling per l&#39;identificazione di geni differenzialmente espressi durante la resistenza nonhost 5-9 sono due principali approcci precedentemente utilizzati per sezionare batterica resistenza nonhost. Perché la resistenza nonhost è controllato da un complesso meccanismo (s) 4 con il coinvolgimento di molti geni, un approccio genomica funzionale di throughput elevato per l&#39;identificazione di geni è fondamentale per una migliore comprensione del meccanismo di resistenza nonhost (s). Indotta da virus silenziamento genico (VIGS) è stato utilizzato con successo per mettere a tacere pianta endogenageni in molte specie vegetali 10,11. Nicotiana benthamiana è una delle migliori piante adatte per VIGS 10,12 e il suo progetto di sequenza del genoma è ora disponibile 13. virus sonaglio tabacco (TRV) basati VIGS è stato ampiamente utilizzato come strumento di genetica inversa per caratterizzare i geni coinvolti nella resistenza nonhost 2,4,14. Questo VIGS vettori e derivati ​​sono ora disponibili attraverso Arabidopsis Centro di Risorse Biologiche (ABRC, <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html</a> ). VIGS è stato utilizzato anche come strumento di genetica in avanti per identificare geni coinvolti nella immunità pianta 15-17, resistenza soprattutto nonhost 6,18. Valutare la risposta ipersensibile (HR)-mediata morte cellulare indotta da piante contro uno specifico agente patogeno nonhost e valutare la malattia la morte cellulare indotta sono due importanti saggi utilizzati principalmente per identifying gene suscettibile tacere piante. Tuttavia, la morte delle cellule umane è indotta solo contro di tipo II nonhost patogeni e non contro le tipo-I nonhost patogeni 2. Quindi, le analisi delle risorse umane non può essere usato universalmente per identificare strategie di resistenza nonhost utilizzati dalle piante, in particolare contro un&#39;ampia gamma di tipo-I nonhost patogeni. Inoltre, la perdita parziale della resistenza nonhost in un gene silenziato impianto non sempre porta a sintomi di malattia 6 e quindi di punteggio malattia non può essere utilizzato per identificare le piante compromettenti resistenza nonhost. In contrario, valutare la crescita dei patogeni nonhost nelle piante silenziate gene è un metodo migliore per studiare la perdita di resistenza nonhost nel gene piante silenziate. Rispetto al saggio di crescita convenzionale 6,19, un metodo più veloce per valutare la crescita batterica nonhost sulle piante silenziate gene può ridurre il tempo richiesto per genetica diretta screening. Abbiamo precedentemente riportato un metodo per osservare i batteril crescita patogeno su foglie da occhio nudo sotto ultravioletta (UV) utilizzando batteri esprimenti proteina fluorescente verde (GFP) 19. In questo manoscritto si dimostra l&#39;utilità di GFPuv esprimere patogeni batterici nonhost per una facile identificazione di geni silenziati piante che sono compromesse per la resistenza nonhost. Questa metodologia è accurata per l&#39;identificazione delle piante sensibili e suscettibili di screening ad alto rendimento.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent/equipment</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>96-well U-bottom plates</td>
 <td> Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td>
 <td> 35-3077</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>96-pin replicator stainless steel</td>
 <td> Nalge Nunc International (Naperville, IL, USA)</td>
 <td> 250520</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> High Intensity UV Inspection Lamps, Model B-100ap</td>
 <td> Thomas scientific (Swedesboro, NJ, USA)</td>
 <td> 6283K50</td>
 <td> Manufacturer ID 95-0127-01</td>
 </tr>
 <tr>
 <td> Stuart SC6 colony counter</td>
 <td> Bibby Scientific Limited, Staffordshire, UK</td>
 <td> SC6PLUS</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Soil-less potting mixture, Metro-Mix 350</td>
 <td> SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Primers: 
 attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) 
 attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td>
 <td> Integrated DNA Technologies, Inc (Coralville, IA, USA)</td>
 <td> Custom synthesized</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> MES, Monohydrate</td>
 <td> VWR international (Radnor, PA, USA)</td>
 <td> CAS No. 145224-94-8</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Acetosyringone (Dimethoxy-4'-hydroxyacetophenone)</td>
 <td> Sigma Aldrich (St. Louis, MO, USA)</td>
 <td> D134406</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Vac-In-Stuff (Silwet L-77)</td>
 <td> Lehle Seeds (Round Rock, TX, USA)</td>
 <td> VIS-30</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
</table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

Nonhost resistenza alle malattie delle piante contro i batteri patogeni è controllato da meccanismi di difesa complessi. La comprensione di questo meccanismo è importante per lo sviluppo di piante resistenti alle malattie durevoli contro un&#39;ampia gamma di patogeni. Indotta da virus silenziamento genico (VIGS) a base di genetica diretta screening è un approccio utile per l&#39;identificazione di geni di difesa delle piante imprimere resistenza nonhost. Virus sonaglio tabacco (TRV) a base di VIGS vettore è il più efficiente VIGS vettore ad oggi ed è stato utilizzato in modo efficiente per silenziare geni bersaglio endogeni in Nicotiana benthamiana. In questo manoscritto, dimostriamo un approccio prospettico di screening genetico per il silenziamento di singoli cloni da una libreria di cDNA in N. benthamiana e valutare la risposta del gene piante silenziate per resistenza nonhost compromessi contro i patogeni nonhost, Pseudomonas syringae pv. pomodoro T1, P. syringae pv. glycINEA, e X. campestris pv. vesicatoria. Questi agenti patogeni batterici sono progettati per esprimere proteine ​​GFPuv e le loro colonie verde fluorescenti possono essere visti ad occhio nudo sotto la luce UV in nonhost piante inoculate patogeni se il gene bersaglio tacere è coinvolto in impartire resistenza nonhost. Questo facilita l&#39;identificazione affidabile e più veloce di geni silenziati piante suscettibili ai patogeni nonhost. Inoltre, promettente informazioni gene candidato può essere conosciuto con il sequenziamento del gene inserto centrale in TRV vettore. Qui mostriamo la capacità di throughput elevato di VIGS-mediate genetica avanti per identificare i geni coinvolti nella resistenza nonhost. Approssimativamente, 100 cDNA possono essere messi a tacere singolarmente in circa due o tre settimane e la loro rilevanza nella resistenza nonhost contro diversi batteri patogeni nonhost può essere studiato in una settimana dopo. In questo manoscritto, annoveriamo i passaggi dettagliati coinvolti in questo screening. VIGS-mediata genetica diretta screening approccio può essere esteso non solo ai geni coinvolti nella resistenza identificativi nonhost ma anche per studiare geni impartendo diverse tolleranze di stress biotico e abiotico in diverse specie vegetali.

Scopo principale di questo studio è quello di dimostrare un metodo per l&#39;identificazione facile e precisa di gene silenziato N. piante benthamiana che sono compromesse per la resistenza nonhost. Ci sono quattro fasi principali di questa metodologia. Il primo passo è quello di mettere a tacere individualmente gran numero di geni che utilizzano TRV-VIGS. Avevamo silenziato circa 5.000 geni 6,18 su un periodo di circa 1,5 anni usando il protocollo illustrato nella Figura 1.</stron...

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Indotta da virus silenziamento genico è uno strumento utile per identificare geni coinvolti nella resistenza nonhost delle piante. Dimostriamo l&#39;uso di agenti patogeni batterici che esprimono GFPuv nell&#39;identificazione di geni silenziati piante suscettibili ai patogeni nonhost. Questo approccio è semplice, veloce e facilita lo screening su larga scala e di protocollo simili possono essere applicati a studiare varie altre interazioni pianta-microbo.

VIGS-Mediated Forward Genetica screening per la identificazione di geni coinvolti nella resistenza Nonhost


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

vigs-mediated-forward-genetics-screening-for-identification-genes

Research

JoVE Journal

Immunology and Infection

16.9K Views.  The Samuel Roberts Noble Foundation.  Indotta da virus silenziamento genico è uno strumento utile per identificare geni coinvolti nella resistenza nonhost delle piante. Dimostriamo l'uso di agenti patogeni batterici che esprimono GFPuv nell'identificazione di geni silenziati piante suscettibili ai patogeni nonhost. Questo approccio è semplice, veloce e facilita lo screening su larga scala e di protocollo simili possono essere applicati a studiare varie altre interazioni pianta-microbo. 

Video: VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

Lo screening RNAi per fattori di accoglienza che partecipano Vaccinia Infezione da virus utilizzando Drosophila Celle

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Ricerca

Immunologia e infezioni

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response following an infection. Despite efforts to identify unique surface marker on Tregs, the only unique feature is their ability to suppress the proliferation and function of effector T cells. While it is clear that only in vitro assays can be used in assessing human Treg function, this becomes problematic when assessing the results from cross-sectional studies where healthy cells and cells isolated from subjects with autoimmune diseases (like Type 1 Diabetes-T1D) need to be compared. There is a great variability among laboratories in the number and type of responder T cells, nature and strength of stimulation, Treg:responder ratios and the number and type of antigen-presenting cells (APC) used in human in vitro suppression assays. This variability makes comparison between studies measuring Treg function difficult. The Treg field needs a standardized suppression assay that will work well with both healthy subjects and those with autoimmune diseases. We have developed an in vitro suppression assay that shows very little intra-assay variability in the stimulation of T cells isolated from healthy volunteers compared to subjects with underlying autoimmune destruction of pancreatic &beta;-cells. The main goal of this piece is to describe an in vitro human suppression assay that allows comparison between different subject groups. Additionally, this assay has the potential to delineate a small loss in nTreg function and anticipate further loss in the future, thus identifying subjects who could benefit from preventive immunomodulatory therapy1. Below, we provide thorough description of the steps involved in this procedure. We hope to contribute to the standardization of the in vitro suppression assay used to measure Treg function. In addition, we offer this assay as a tool to recognize an early state of immune imbalance and a potential functional biomarker for T1D.

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Tregs are potent suppressors of the immune system. There is a lack of unique surface markers to define them, hence, definitions of Tregs are primarily functional. Here we describe an optimized in vitro assay capable of identifying immune imbalance in subjects at risk to develop T1D.

Umano In Vitro</emSoppressione> come strumento di screening per il riconoscimento di uno Stato precoce di squilibrio immunitario

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

Reverse Genetics Mediated Recovery of Infectious Murine Norovirus

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close person-to-person contact cannot be avoided 1, 2. During the last few years an increase in the incidence of outbreaks in hospitals has been reported, causing significant disruptions to their operational capacity as well as large economic losses. The identification of new antiviral approaches has been limited due to the inability of human noroviruses to complete a productive infection in cell culture 3. The recent isolation of a murine norovirus (MNV), closely related to human norovirus 4 but which can be propagated in cells 5 has opened new avenues for the investigation of these pathogens 6, 7. 
MNV replication results in the synthesis of new positive sense genomic and subgenomic RNA molecules, the latter of which corresponds to the last third of the viral genome (Figure 1). MNV contains four different open reading frames (ORFs), of which ORF1 occupies most of the genome and encodes seven non-structural proteins (NS1-7) released from a polyprotein precursor. ORF2 and ORF3 are contained within the subgenomic RNA region and encode the capsid proteins (VP1 and VP2, respectively) (Figure 1). Recently, we have identified that additional ORF4 overlapping ORF2 but in a different reading frame is functional and encodes for a mitochondrial localised virulence factor (VF1) 8.
Replication for positive sense RNA viruses, including noroviruses, takes place in the cytoplasm resulting in the synthesis of new uncapped RNA genomes. To promote viral translation, viruses exploit different strategies aimed at recruiting the cellular protein synthesis machinery 9-11. Interestingly, norovirus translation is driven by the multifunctional viral protein-primer VPg covalently linked to the 5' end of both genomic and subgenomic RNAs 12-14. This sophisticated mechanism of translation is likely to be a major factor in the limited efficiency of viral recovery by conventional reverse genetics approaches. 
Here we report two different strategies based on the generation of murine norovirus-1 (referred to as MNV herewith) transcripts capped at the 5' end. One of the methods involves both in vitro synthesis and capping of viral RNA, whereas the second approach entails the transcription of MNV cDNA in cells expressing T7 RNA polymerase. The availability of these reverse genetics systems for the study of MNV and a small animal model has provided an unprecedented ability to dissect the role of viral sequences in replication and pathogenesis 15-17.

Noroviruses are a major cause of gastroenteritis yet molecular techniques for their characterisation are still relatively new. Here we report two different reverse genetics approaches for the efficient recovery of murine norovirus (MNV), the only member of this genus which can be propagated in cell culture.

Reverse Genetics recupero mediato del Infettive Norovirus Murine

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close ...

Forward Genetic Approaches in Chlamydia trachomatis

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its intractability to experimental transformation with recombinant DNA. We developed an approach to perform genetic analysis in C. trachomatis&#160;despite the lack of molecular genetic tools. Our method involves: i.) chemical mutagenesis to rapidly generate comprehensive libraries of genetically-defined mutants with distinct phenotypes; ii.) whole-genome sequencing (WGS) to map the underlying genetic lesions and to find associations between mutated gene(s) and a common phenotype; iii.) generation of recombinant strains through co-infection of mammalian cells with mutant and wild type bacteria. Accordingly, we were able to establish causal relationships between genotypes and phenotypes. The coupling of chemically-induced gene variation and WGS to establish correlative genotype&#8211;phenotype associations should be broadly applicable to the large list of medically and environmentally important microorganisms currently intractable to genetic analysis.

Forward Genetic Approaches in Chlamydia trachomatis

We describe a methodology to perform genetic analysis in Chlamydia based on chemical mutagenesis and whole genome sequencing. In addition, a system for DNA exchange within infected cells is described that can be used for genetic mapping. This method may be broadly applicable to microbial systems lacking transformation systems and molecular genetic tools.

Approcci genetici in avanti<em&gt; Chlamydia trachomatis</em

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

Usando RNA-interferenza per Indagare sulla risposta immunitaria innata in mouse macrofagi

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial pathogen which establishes chronic pulmonary infections in patients with cystic fibrosis (CF). The overproduction of a capsular polysaccharide called alginate, also known as mucoidy, promotes the formation of mucoid biofilms which are more resistant than planktonic cells to antibiotic chemotherapy and host defenses. Additionally, the conversion from the nonmucoid to mucoid phenotype is a clinical marker for the onset of chronic infection in CF. Alginate overproduction by P. aeruginosa is an endergonic process which heavily taxes cellular energy. Therefore, alginate production is highly regulated in P. aeruginosa. To better understand alginate regulation, we describe a protocol using the mini-himar1 transposon mutagenesis for the identification of novel alginate regulators in a prototypic strain PAO1. The procedure consists of two basic steps. First, we transferred the mini-himar1 transposon (pFAC) from host E. coli SM10/&#955;pir into recipient P. aeruginosa PAO1 via biparental conjugation to create a high-density insertion mutant library, which were selected on Pseudomonas isolation agar plates supplemented with gentamycin. Secondly, we screened and isolated the mucoid colonies to map the insertion site through inverse PCR using DNA primers pointing outward from the gentamycin cassette and DNA sequencing. Using this protocol, we have identified two novel alginate regulators, mucE (PA4033) and kinB (PA5484), in strain PAO1 with a wild-type mucA encoding the anti-sigma factor MucA for the master alginate regulator AlgU (AlgT, &#963;22). This high-throughput mutagenesis protocol can be modified for the identification of other virulence-related genes causing change in colony morphology.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Here we describe a protocol using the mini-himar1 mariner transposon-mediated mutagenesis for generating a high-density insertion mutant library to screen, isolate and identify novel alginate regulators in the prototypic Pseudomonas aeruginosa strain PAO1.

Identificazione di geni novelli associati con alginato di produzione in<em&gt; Pseudomonas aeruginosa</em&gt; Utilizzo Mini-<em&gt; Himar1</em&gt; Mutagenesi Mariner Transposon-mediata

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify new compounds that can inhibit infection by the common drug resistant HIV-1 strains with minimal toxicity. Here we describe an efficient assay that can be used to rapidly determine the cellular cytotoxicity and efficacy of a compound against WT and mutant viral strains.
The desired target cell line is seeded in a 96-well plate and, after a 24 hr incubation, serially dilutions of the compounds to be tested are added. No further manipulations are necessary for cellular cytotoxicity assays; for anti HIV assays a predetermined amount of either a WT or drug resistant HIV-1 vector that expresses luciferase is added to the cells. Cytotoxicity is measured by using an ATP dependent luminescence assay and the impact of the compounds on infectivity is measured by determining the amount of luciferase in the presence or the absence of the putative inhibitors.
This screening assay takes 4 days to complete and multiple compounds can be screened in parallel. Compounds are screened in triplicate and the data are normalized to the infectivity/ATP levels in absence of target compounds. This technique provides a quick and accurate measurement of the efficacy and toxicity of potential anti HIV compounds.

Here we describe cellular cytotoxicity and single round infectivity assays that allow for the rapid and accurate screening of compounds to determine their cellular cytotoxicity (CC50) and IC50 values against WT and drug resistant HIV-1.

Screening rapido di HIV trascrittasi inversa e inibitori dell&#39;integrasi

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependent-innate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in na&#239;ve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified parasite gene to establishment of chronic infection.

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&amp;#947;-Dependent Cell Autonomous Immunity

Forward genetics is a powerful approach to identify genes in intracellular pathogens important for resistance to cell autonomous immunity. The current approach uses innate immune cells, specifically macrophages, to identify novel Toxoplasma gondii genes important for immune evasion.

Forward Genetica schermi usando macrofagi per identificare<em&gt; Toxoplasma gondii</em&gt; geni importanti per la Resistenza di IFN-γ-Dependent cellulare Immunità autonoma

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Saggi Microscopia-based per high-throughput screening dei fattori di accoglienza che partecipano<em&gt; Brucella</em&gt; L&#39;infezione di cellule HeLa

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.