This project was funded by The Samuel Roberts Noble Foundation. Authors thank Mss. Janie Gallaway and Colleen Elles for excellent plant care; and Ms. Katie Brown for artwork. We also would like to thank Mss. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda and Mr. Isaac Greenhut for technical help during establishment of this protocol.

1. Plant Growth and Target Gene Silencing
<ol>
	<li>
		Plant growth conditions:
		<ol>
			<li>
				Sow N. benthamiana seeds on soil-less potting mixture, Metro-Mix 350 and germinate the seeds in a growth chamber. Any other soil or soil-less medium can also be used instead of Metro-Mix.</li>
			<li>
				Transplant three-week old seedlings into individual pots and grow them in a greenhouse maintained at 21&plusmn;2 &deg;C along with other growth conditions as detailed in previous literature12. Two to three days after transplanting, plants can be used for TRV inoculation.</li>
		</ol>
	</li>
	<li>
		Growing TRV2 clones: 
		TRV is a bipartite virus and its genome consists of RNA1 and RNA2. RNA1 encodes an RNA-dependent RNA polymerase and a movement protein20,21. RNA2 encodes a coat protein (CP) and two nonstructural proteins from the subgenomic RNAs21. Both RNA1 and RNA2 are required for the formation of matured virus particles and their spread20,21. cDNA library construction in TRV2 vector is described in previous literature22,23. Briefly, VIGS library used in this study was constructed from the RNA extracted from leaf tissues exposed to various biotic and abiotic elicitors.
		<ol>
			<li>
				Take out Agrobacterium (GV2260 strain) containing the cDNA clones in TRV2 vector (a 96-well plate) from the freezer. Gradually thaw them and after the cultures reach room temperature, inoculate the individual Agrobacterium culture onto Luria-Bertani (LB) agar plate with rifampicin (10 &mu;g/ml) and kanamycin (50 &mu;g/ml) using a 96-pin replicator.</li>
			<li>
				Incubate the plates at 28 &deg;C for two days. We usually grow four replicate colonies for each clone so that adequate Agrobacterium inoculum is available for prick inoculation of two plants. Perform all the steps under sterile conditions.</li>
		</ol>
	</li>
	<li>
		VIGS:
		<ol>
			<li>
				Grow Agrobacterium (GV2260) carrying TRV1 at 28 &deg;C in LB liquid medium with antibiotics mentioned above. Harvest cells by centrifugation from overnight grown cultures, re-suspend in the inoculation buffer (10 mM MES, pH 5.5; 200 &mu;M acetosyringone), and incubate for 3 hr at room temperature on a shaker at 50 rpm.</li>
			<li>
				Harvest the cells by centrifugation and re-suspend in 5 mM MES buffer (pH 5.5) and inoculate (OD600 = 0.3) into abaxial side of 3-4 N. benthamiana leaves using a needleless syringe. Detailed inoculation procedure is demonstrated in previous literature24. Later, at the site of TRV1 inoculation, inoculate respective TRV2 colonies by pricking the leaves with a toothpick.</li>
			<li>
				Maintain the plants with adequate nutrition as vigorous growth is important for efficient VIGS12. About two weeks post inoculation the transcripts of targeted genes will begin to reduce and the plants are ready for pathogen inoculation at three weeks after TRV inoculation.</li>
		</ol>
	</li>
</ol>

	2. Preparation of Nonhost Pathogen Cultures and Plant Inoculation
<ol>
	<li>
		Details of pathogens used in this study: 
		Pseudomonas syringae pv. tabaci, P. syringae pv. tomato T1, P. syringae pv. glycinea and Xanthomonas campestris pv. vesicatoria are used in this study. Grow P. syringae strains in King&#39;s B (KB) liquid medium supplemented with rifampicin (10 &mu;g/ml), kanamycin (50 &mu;g/ml) at 28 &deg;C for 12 hr. Grow X. campestris pv. vesicatoria in LB liquid medium for 16 hr. All pathogens harbor a plasmid that can express GFPuv as described in previous literature19.</li>
	<li>
		Preparation of pathogen cultures for plant inoculation:
		<ol>
			<li>
				Harvest bacterial cells by centrifugation and confirm the presence of green fluorescence using long wavelength UV lamp in the dark. Wash the cells twice with sterile water and re-suspend them to the desired concentration using sterile water.</li>
			<li>
				Inoculate the respective pathogen(s) on to abaxial side of target gene silenced leaves (5th to 8th) as spots (about 1.5 cm diameters). Several nonhost pathogens can be simultaneously tested for their growth in the target gene silenced plants. Simultaneously inoculate the host pathogen as this can be used as a positive control for viewing in planta bacterial growth. Also inoculate vector control (TRV::00) plants.</li>
		</ol>
	</li>
</ol>

	3. Observation of in planta Growth of Bacterial Pathogens
<ol>
	<li>
		Expose the inoculated leaves to a long wavelength UV light in the dark. Bacterial colonies can be viewed as green fluorescent dots in the abaxial side of the leaf in the background of red fluorescence emitted by leaf surface.</li>
	<li>
		Observe pathogen growth from 2 days post inoculation (dpi) to 5 dpi. Everyday observation during this time interval is necessary.</li>
	<li>
		After the first screen, short list the clones whose silencing results in growth of one or more nonhost pathogen(s).</li>
	<li>
		Repeat VIGS for the selected clones and again test the response of gene silenced plants to nonhost pathogen(s). This second level of screening is done to remove the false positives obtained during the first screen.</li>
</ol>

	4. Confirmation of Shortlisted Plants for Compromised Nonhost Resistance
<ol>
	<li>
		Silence the cDNA clones selected from the screen as described above. Inoculate the whole plant with nonhost pathogen(s) by submerging the plants with respective pathogen cultures with 0.01% (v/v) Silwet L-77 and subjecting the submerged plants to vacuum for 3 - 5 min. Quantify the bacterial growth by conventional growth assay6,18,19 as described below.</li>
	<li>
		At 0 hr post inoculation (hpi), 3 dpi and 5 dpi, collect two leaf samples from five biological replicates for each nonhost pathogen(s) inoculated leaves using a leaf punch (0.5 cm2). Grind the leaf samples, serial dilute and plate the sap on KB agar medium supplemented with appropriate antibiotics and incubate at 28 &deg;C for 2 days. Count the bacterial colonies using a colony counter and calculate the bacterial growth in the leaves as described in previous literature6.</li>
	<li>
		Plants susceptible to nonhost pathogen(s) should show higher number of pathogen growth compared to vector control.</li>
</ol>

	5. Sequencing the Insert and Identification of Target Gene
<ol>
	<li>
		Perform colony PCR for the selected clone using attB1 and attB2 primers or using the primers flanking the cloning site in the TRV2 vector. Run the PCR product on the gel and check for amplification of the single band.</li>
	<li>
		Plant gene insert in the TRV2 vector can be sequenced using attB primers or primers flanking the cloning site.</li>
	<li>
		Perform BLAST using the sequence and identify the gene details.</li>
	<li>
		Obtain full length gene sequence along with the un-translated regions (UTRs).</li>
	<li>
		Select 300-400 bp fragments from three different regions of the sequence and clone them into TRV2 vector. Independently perform VIGS using all three VIGS constructs and confirm the compromise of nonhost resistance in all three gene silenced plants.</li>
</ol>

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

We have nothing to disclose.

Plant immunity limits the growth of nonhost pathogens and hence, little or no green fluorescence is emitted from vector control plant leaves inoculated with nonhost pathogen under long wavelength UV light (Figure 3D). However, when a gene involved in nonhost resistance is silenced, the gene silenced plants favor the growth of nonhost pathogen and green fluorescence is seen (Figure 3E). This is the basic principle involved in the method described in this manuscript. This methodology has...

Nonhost resistance is the resistance of all plant species against races of a particular pathogen1,2. This imparts broad spectrum and durable disease resistance in plants2,3. However, its mechanism, particularly against bacterial pathogens, is not well understood4. Screening for mutants or silenced plants that compromise nonhost resistance, and high throughput transcript profiling for identification of differentially expressed genes during nonhost resistance5-9 are two major approaches previously used for dissecting bacterial nonhost resistance. Because nonhost resistance is controlled by a complex mechanism(s)4 with the involvement of many genes, a high throughput functional genomic approach for gene identification is critical for better understanding the nonhost resistance mechanism(s).

	Virus-induced gene silencing (VIGS) has been successfully used to silence endogenous plant genes in many plant species10,11. Nicotiana benthamiana is one of the best suited plants for VIGS10,12 and its draft genome sequence is now available13. Tobacco rattle virus (TRV)-based VIGS has been widely used as reverse genetics tool to characterize genes involved in nonhost resistance2,4,14. This VIGS vectors and derivatives are now available through Arabidopsis Biological Resource Center (ABRC, <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html</a>). VIGS has also been used as a forward genetics tool for identifying genes involved in plant immunity15-17, especially nonhost resistance6,18. Assessing hypersensitive response (HR)-mediated cell death induced by plants against a specific nonhost pathogen and assessing the disease induced cell death are two major assays mainly used for identifying susceptible gene silenced plants. However, HR cell death is induced only against type-II nonhost pathogens and not against the type-I nonhost pathogens2. Hence, HR assays cannot be universally used to identify nonhost resistance strategies used by plants, especially against wide range of type-I nonhost pathogens. Also, partial loss of nonhost resistance in a gene silenced plant does not always lead to disease symptoms6 and hence disease scoring cannot be used for identifying plants compromising nonhost resistance. In contrary, assessing the growth of nonhost pathogens in the gene silenced plants is a better method for studying the loss of nonhost resistance in gene silenced plants.

	Compared to conventional growth assay6,19, a faster method for assessing nonhost bacterial growth&nbsp;on the gene silenced plants can shorten the time required for forward genetics screening. We earlier reported a method for observing bacterial pathogen growth on leaves by naked eye under ultraviolet (UV) light using bacteria expressing green fluorescent protein (GFP)19. In this manuscript we demonstrate the usefulness of GFPuv expressing nonhost bacterial pathogens for easy identification of gene silenced plants that are compromised for nonhost resistance. This methodology is accurate for identification of susceptible plants and amenable for high throughput screening.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent/equipment</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>96-well U-bottom plates</td>
 <td> Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td>
 <td> 35-3077</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>96-pin replicator stainless steel</td>
 <td> Nalge Nunc International (Naperville, IL, USA)</td>
 <td> 250520</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> High Intensity UV Inspection Lamps, Model B-100ap</td>
 <td> Thomas scientific (Swedesboro, NJ, USA)</td>
 <td> 6283K50</td>
 <td> Manufacturer ID 95-0127-01</td>
 </tr>
 <tr>
 <td> Stuart SC6 colony counter</td>
 <td> Bibby Scientific Limited, Staffordshire, UK</td>
 <td> SC6PLUS</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Soil-less potting mixture, Metro-Mix 350</td>
 <td> SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Primers: 
 attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) 
 attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td>
 <td> Integrated DNA Technologies, Inc (Coralville, IA, USA)</td>
 <td> Custom synthesized</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> MES, Monohydrate</td>
 <td> VWR international (Radnor, PA, USA)</td>
 <td> CAS No. 145224-94-8</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Acetosyringone (Dimethoxy-4'-hydroxyacetophenone)</td>
 <td> Sigma Aldrich (St. Louis, MO, USA)</td>
 <td> D134406</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Vac-In-Stuff (Silwet L-77)</td>
 <td> Lehle Seeds (Round Rock, TX, USA)</td>
 <td> VIS-30</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
</table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important for developing durable disease-resistant plants against wide range of pathogens. Virus-induced gene silencing (VIGS)-based forward genetics screening is a useful approach for identification of plant defense genes imparting nonhost resistance. Tobacco rattle virus (TRV)-based VIGS vector is the most efficient VIGS vector to date and has been efficiently used to silence endogenous target genes in Nicotiana benthamiana.

	In this manuscript, we demonstrate a forward genetics screening approach for silencing of individual clones from a cDNA library in N. benthamiana and assessing the response of gene silenced plants for compromised nonhost resistance against nonhost pathogens, Pseudomonas syringae pv. tomato T1, P. syringae pv. glycinea, and X. campestris pv. vesicatoria. These bacterial pathogens are engineered to express GFPuv protein and their green fluorescing colonies can be seen by naked eye under UV light in the nonhost pathogen inoculated plants if the silenced target gene is involved in imparting nonhost resistance. This facilitates reliable and faster identification of gene silenced plants susceptible to nonhost pathogens. Further, promising candidate gene information can be known by sequencing the plant gene insert in TRV vector. Here we demonstrate the high throughput capability of VIGS-mediated forward genetics to identify genes involved in nonhost resistance. Approximately, 100 cDNAs can be individually silenced in about two to three weeks and their relevance in nonhost resistance against several nonhost bacterial pathogens can be studied in a week thereafter. In this manuscript, we enumerate the detailed steps involved in this screening. VIGS-mediated forward genetics screening approach can be extended not only to identifying genes involved in nonhost resistance but also to studying genes imparting several biotic and abiotic stress tolerances in various plant species.

Major aim of this study is to demonstrate a method for easy and accurate identification of gene silenced N. benthamiana plants that are compromised for nonhost resistance. There are four major steps in this methodology. First step is to individually silence large number of genes using TRV-VIGS. We had silenced about 5,000 genes6,18 over a period of about 1.5 years using the protocol depicted in Figure 1. Some of the gene silenced plants showed various phenotypic alterations includin...

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Virus-induced gene silencing is an useful tool for identifying genes involved in nonhost resistance of plants. We demonstrate the use of bacterial pathogens expressing GFPuv in identifying gene silenced plants susceptible to nonhost pathogens. This approach is easy, fast and facilitates large scale screening and similar protocol can be applied to studying various other plant-microbe interactions.


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

vigs-mediated-forward-genetics-screening-for-identification-genes

Research

JoVE Journal

Immunology and Infection

16.9K Views.  The Samuel Roberts Noble Foundation.  Virus-induced gene silencing is an useful tool for identifying genes involved in nonhost resistance of plants. We demonstrate the use of bacterial pathogens expressing GFPuv in identifying gene silenced plants susceptible to nonhost pathogens. This approach is easy, fast and facilitates large scale screening and similar protocol can be applied to studying various other plant-microbe interactions.

Video: VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response following an infection. Despite efforts to identify unique surface marker on Tregs, the only unique feature is their ability to suppress the proliferation and function of effector T cells. While it is clear that only in vitro assays can be used in assessing human Treg function, this becomes problematic when assessing the results from cross-sectional studies where healthy cells and cells isolated from subjects with autoimmune diseases (like Type 1 Diabetes-T1D) need to be compared. There is a great variability among laboratories in the number and type of responder T cells, nature and strength of stimulation, Treg:responder ratios and the number and type of antigen-presenting cells (APC) used in human in vitro suppression assays. This variability makes comparison between studies measuring Treg function difficult. The Treg field needs a standardized suppression assay that will work well with both healthy subjects and those with autoimmune diseases. We have developed an in vitro suppression assay that shows very little intra-assay variability in the stimulation of T cells isolated from healthy volunteers compared to subjects with underlying autoimmune destruction of pancreatic &beta;-cells. The main goal of this piece is to describe an in vitro human suppression assay that allows comparison between different subject groups. Additionally, this assay has the potential to delineate a small loss in nTreg function and anticipate further loss in the future, thus identifying subjects who could benefit from preventive immunomodulatory therapy1. Below, we provide thorough description of the steps involved in this procedure. We hope to contribute to the standardization of the in vitro suppression assay used to measure Treg function. In addition, we offer this assay as a tool to recognize an early state of immune imbalance and a potential functional biomarker for T1D.

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Tregs are potent suppressors of the immune system. There is a lack of unique surface markers to define them, hence, definitions of Tregs are primarily functional. Here we describe an optimized in vitro assay capable of identifying immune imbalance in subjects at risk to develop T1D.

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

Reverse Genetics Mediated Recovery of Infectious Murine Norovirus

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close person-to-person contact cannot be avoided 1, 2. During the last few years an increase in the incidence of outbreaks in hospitals has been reported, causing significant disruptions to their operational capacity as well as large economic losses. The identification of new antiviral approaches has been limited due to the inability of human noroviruses to complete a productive infection in cell culture 3. The recent isolation of a murine norovirus (MNV), closely related to human norovirus 4 but which can be propagated in cells 5 has opened new avenues for the investigation of these pathogens 6, 7. 
MNV replication results in the synthesis of new positive sense genomic and subgenomic RNA molecules, the latter of which corresponds to the last third of the viral genome (Figure 1). MNV contains four different open reading frames (ORFs), of which ORF1 occupies most of the genome and encodes seven non-structural proteins (NS1-7) released from a polyprotein precursor. ORF2 and ORF3 are contained within the subgenomic RNA region and encode the capsid proteins (VP1 and VP2, respectively) (Figure 1). Recently, we have identified that additional ORF4 overlapping ORF2 but in a different reading frame is functional and encodes for a mitochondrial localised virulence factor (VF1) 8.
Replication for positive sense RNA viruses, including noroviruses, takes place in the cytoplasm resulting in the synthesis of new uncapped RNA genomes. To promote viral translation, viruses exploit different strategies aimed at recruiting the cellular protein synthesis machinery 9-11. Interestingly, norovirus translation is driven by the multifunctional viral protein-primer VPg covalently linked to the 5' end of both genomic and subgenomic RNAs 12-14. This sophisticated mechanism of translation is likely to be a major factor in the limited efficiency of viral recovery by conventional reverse genetics approaches. 
Here we report two different strategies based on the generation of murine norovirus-1 (referred to as MNV herewith) transcripts capped at the 5' end. One of the methods involves both in vitro synthesis and capping of viral RNA, whereas the second approach entails the transcription of MNV cDNA in cells expressing T7 RNA polymerase. The availability of these reverse genetics systems for the study of MNV and a small animal model has provided an unprecedented ability to dissect the role of viral sequences in replication and pathogenesis 15-17.

Noroviruses are a major cause of gastroenteritis yet molecular techniques for their characterisation are still relatively new. Here we report two different reverse genetics approaches for the efficient recovery of murine norovirus (MNV), the only member of this genus which can be propagated in cell culture.

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close ...

Forward Genetic Approaches in Chlamydia trachomatis

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its intractability to experimental transformation with recombinant DNA. We developed an approach to perform genetic analysis in C. trachomatis&#160;despite the lack of molecular genetic tools. Our method involves: i.) chemical mutagenesis to rapidly generate comprehensive libraries of genetically-defined mutants with distinct phenotypes; ii.) whole-genome sequencing (WGS) to map the underlying genetic lesions and to find associations between mutated gene(s) and a common phenotype; iii.) generation of recombinant strains through co-infection of mammalian cells with mutant and wild type bacteria. Accordingly, we were able to establish causal relationships between genotypes and phenotypes. The coupling of chemically-induced gene variation and WGS to establish correlative genotype&#8211;phenotype associations should be broadly applicable to the large list of medically and environmentally important microorganisms currently intractable to genetic analysis.

Forward Genetic Approaches in Chlamydia trachomatis

We describe a methodology to perform genetic analysis in Chlamydia based on chemical mutagenesis and whole genome sequencing. In addition, a system for DNA exchange within infected cells is described that can be used for genetic mapping. This method may be broadly applicable to microbial systems lacking transformation systems and molecular genetic tools.

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial pathogen which establishes chronic pulmonary infections in patients with cystic fibrosis (CF). The overproduction of a capsular polysaccharide called alginate, also known as mucoidy, promotes the formation of mucoid biofilms which are more resistant than planktonic cells to antibiotic chemotherapy and host defenses. Additionally, the conversion from the nonmucoid to mucoid phenotype is a clinical marker for the onset of chronic infection in CF. Alginate overproduction by P. aeruginosa is an endergonic process which heavily taxes cellular energy. Therefore, alginate production is highly regulated in P. aeruginosa. To better understand alginate regulation, we describe a protocol using the mini-himar1 transposon mutagenesis for the identification of novel alginate regulators in a prototypic strain PAO1. The procedure consists of two basic steps. First, we transferred the mini-himar1 transposon (pFAC) from host E. coli SM10/&#955;pir into recipient P. aeruginosa PAO1 via biparental conjugation to create a high-density insertion mutant library, which were selected on Pseudomonas isolation agar plates supplemented with gentamycin. Secondly, we screened and isolated the mucoid colonies to map the insertion site through inverse PCR using DNA primers pointing outward from the gentamycin cassette and DNA sequencing. Using this protocol, we have identified two novel alginate regulators, mucE (PA4033) and kinB (PA5484), in strain PAO1 with a wild-type mucA encoding the anti-sigma factor MucA for the master alginate regulator AlgU (AlgT, &#963;22). This high-throughput mutagenesis protocol can be modified for the identification of other virulence-related genes causing change in colony morphology.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Here we describe a protocol using the mini-himar1 mariner transposon-mediated mutagenesis for generating a high-density insertion mutant library to screen, isolate and identify novel alginate regulators in the prototypic Pseudomonas aeruginosa strain PAO1.

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify new compounds that can inhibit infection by the common drug resistant HIV-1 strains with minimal toxicity. Here we describe an efficient assay that can be used to rapidly determine the cellular cytotoxicity and efficacy of a compound against WT and mutant viral strains.
The desired target cell line is seeded in a 96-well plate and, after a 24 hr incubation, serially dilutions of the compounds to be tested are added. No further manipulations are necessary for cellular cytotoxicity assays; for anti HIV assays a predetermined amount of either a WT or drug resistant HIV-1 vector that expresses luciferase is added to the cells. Cytotoxicity is measured by using an ATP dependent luminescence assay and the impact of the compounds on infectivity is measured by determining the amount of luciferase in the presence or the absence of the putative inhibitors.
This screening assay takes 4 days to complete and multiple compounds can be screened in parallel. Compounds are screened in triplicate and the data are normalized to the infectivity/ATP levels in absence of target compounds. This technique provides a quick and accurate measurement of the efficacy and toxicity of potential anti HIV compounds.

Here we describe cellular cytotoxicity and single round infectivity assays that allow for the rapid and accurate screening of compounds to determine their cellular cytotoxicity (CC50) and IC50 values against WT and drug resistant HIV-1.

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependent-innate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in na&#239;ve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified parasite gene to establishment of chronic infection.

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&amp;#947;-Dependent Cell Autonomous Immunity

Forward genetics is a powerful approach to identify genes in intracellular pathogens important for resistance to cell autonomous immunity. The current approach uses innate immune cells, specifically macrophages, to identify novel Toxoplasma gondii genes important for immune evasion.

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.