העבודה המתוארת בפרוטוקול זה התאפשרה על ידי מימון מהממשלה ויקטוריאני, כחלק מברית של שיתוף פעולה עם מכון קליפורניה לרפואת רגנרטיבית (CIRM).

כל ההליכים מתבצעים בזרימה למינרית סטרילי. כל כלי התקשורת והפתרונים equilibrated ל37 ° C אלא אם צוינו אחרת. .1 הרחבת PSCs האדם (hESCs וhiPSCs, WA-09 שימוש בפרוטוקול זה) לTransfection הערה: אין צורך להרחיב את hESCs על Matrigel או Geltrex. hESCs הרחיב על fibroblasts העכבר העוברי (MEFs) יכול לשמש לelectroporation או nucleofection הבא צעד הסרת MEF (ראה סעיף 2.8). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן 1 x 100 צלחת מ&quot;מ ובקבוק 1 x 75cm2 של MEFs DR4 ב2.0 x 10 4 תאים לכל 2 סנטימטר בתקשורת MEF (ראה טבלה 1) על מנות מראש מצופה עם 0.1% w / ג&#39;לטין v. הערה: CF1, MEFs BLK6 או MF1 ניתן להשתמש, לעומת זאת, מומלץ שמשמשים קווים MEF עמידים לאנטיביוטיקה, למשל, DR410. </li><li style=";text-align:right;direction:rtl"> למחרת, hESCs מעבר על צלחת 100 מ&quot;מ מראש מצופה MEFs מוכן בסעיף 1.1. כדי לעשות ASPI זהשיעור תקשורת hESC ממנות תרבויות, לשטוף hESCs עם תמיסת מלח המאוזן Ca 2 + / Mg2 + -חינם &#39;הנקס (HBSS), להוסיף Dispase (ראה טבלה 2 כרכים מתאימים) ומקום בחממה humidified על 37 מעלות צלזיוס / 5% CO 2. בעקבות 3-5 דגירה דקות, לשאוב Dispase ולשטוף בעדינות 1 - 2 פעמים עם HBSS להסיר MEFs. הוסף מדיה hESC (ראה טבלה 3) ובאמצעות מגרד תא, או פיפטה 5 מ&quot;ל, בעדינות לגרד מושבות את פני השטח של צלחת התרבות. </li><li style=";text-align:right;direction:rtl"> לאסוף את שברי המושבה בהשעיה ממנת התרבות לתוך צינור צנטריפוגות 15 מ&quot;ל. צלחת התרבות לשטוף עם תקשורת hESC והעברה לצינור 15 מ&quot;ל. היזהר שלא לשבור את הגושים לתוך תאים בודדים או שברים קטנים. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה במשך 5 דקות ב160 XG כדי גלולה שברי מושבה. </li><li style=";text-align:right;direction:rtl"> לשאוב supernatant. הקש תחתון של צינור 15 מ&quot;ל עם אצבע כדי לשחרר גלולה בר מושבה. שברים בעדינות resuspend מושבה בתקשורת hESC על פי יחס פיצול (normallya לפצל יחס בין 1: 4 ו 1: 8 הוא מתאים). להיות זהיר מאוד שלא להפוך את הגושים לתוך תאים בודדים או שברים קטנים כמו זה ישפיע replating יעילות. </li><li style=";text-align:right;direction:rtl"> לפני replating ברי hESC על MEFs לשטוף 1x עם HBSS. לאט לאט להוסיף כמות מתאימה (ראה טבלה 2) של השעיה תא המכילה שברי hESC בתקשורת hESC מנות מראש מצופה MEFs. </li><li style=";text-align:right;direction:rtl"> מניחים מנות תרבות על מדף בחממה ולנוע באיטיות קדימה ואחורה ומצד לצד כדי לפזר באופן שווה שברי מושבה. </li><li style=";text-align:right;direction:rtl"> החלף תקשורת hESC יומית. </li><li style=";text-align:right;direction:rtl"> כדי להכין תקשורת מותנית מMEFs (MEF-CM) לשטוף 75 סנטימטר 2 בקבוק מראש מצופה MEFs x 1 עם HBSS. הוסף מדיה hESC. בעקבות 24 שעות, לאסוף התנה תקשורת ולהחליף עם תקשורת hESC טריות. חזור מדי יום לתקופה מקסימלית של 12 ימים. אחסן MEF-CM ב 4 ° C. עד צורך. </li></ol> 2 הכנת ESCs האדם לTransfection <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> שים לב לצמיחה של hESCsתחת מיקרוסקופ יומי. כאשר המושבות הפכו 40-50% ומחוברות, צלחת 3 x 100 מנות מ&quot;מ עם 2.0 x 10 5 MEFs לסנטימטר 2. </li><li style=";text-align:right;direction:rtl"> כאשר המושבות הפכו 60 - ומחוברות 70% הם מוכנים להיות transfected. מושבות &#39;חתן&#39; על ידי הסרת מושבות מובחנות או ליבות מושבה. הערה: כפי שאנו מאמינים transfection גבוה יותר ויעילות מיקוד מתרחשת כאשר תאים נמצאים בצמיחת שלב יומן, הוא הציע שייערך electroporation לפני hESCs להגיע ≥ confluency 70%. </li><li style=";text-align:right;direction:rtl"> לשטוף מושבות hESC עם HBSS ולהוסיף Accutase. הערה: אין צורך hESCs מראש פינוק עם מעכב ROCK Y-27632 עיכוב מספיק כיתרחש כאשר הודגרו עם Y-27632 במהלך שלב 2.7 </li><li style=";text-align:right;direction:rtl"> דגירה של 10 - 20 דקות על 37 מעלות צלזיוס / 5% CO 2 עד מושבות ניתנות תאים בודדים כמתחת למיקרוסקופ. תאי Triturate עם טפטפת מ&quot;ל 1. </li><li style=";text-align:right;direction:rtl"> הוסף מדיה hESC ומסנן לתוך צינור חרוטי 15 מ&quot;ל באמצעות straine 40 מיקרומטר תאr כדי להסיר גושי תא. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה ב160 XG למשך 5 דקות. גלולה תא הגלולה בתקשורת hESC טריות וחזור כדי להסיר כל פתרון Accutase השיורי. </li><li style=";text-align:right;direction:rtl"> תאים גלולים בתקשורת hESC המכילים 10 מיקרומטר Y-27632 ולהעביר כוללת ההשעיה התא לצלחת 100 מ&quot;מ מראש מצופה עם ג&#39;לטין. </li><li style=";text-align:right;direction:rtl"> דגירה על 37 מעלות צלזיוס / 5% CO 2 למשך תקופה מינימאלית של 30 דקות. </li><li style=";text-align:right;direction:rtl"> במהלך תקופה זו MEFs ידבק צלחת ג&#39;לטין מצופה. לאסוף hESCs לא חסיד באמצעות פיפטה 1 מ&quot;ל לתוך צינור צנטריפוגות 15 מ&quot;ל טרי ולקבוע צפיפות תאים באמצעות hemocytometer. </li></ol> .3 Electroporation של hESCs <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תקשורת CM-MEF מסנן באמצעות מסנן 0.22 מיקרומטר ולהוסיף 10 גורם גדילת רקומביננטי מ&quot;ל / פיברובלסטים אנושיים ng 2 (rhFGF2). </li><li style=";text-align:right;direction:rtl"> העבר את 7.5 x 106 hESCs מסעיף 2.9 לצינור חדש 15 מ&quot;ל חרוטי ו צנטריפוגות ב XG 160 למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> בתקופה זו הקימה את electroporator: בחר תכנית לele מעריכיctroporation ולהגדיר את הפרמטרים הבאים, מתח: 250 V, קיבוליות: 500 μF, והתנגדות: ∞-. </li><li style=";text-align:right;direction:rtl"> לשאוב supernatant מחדש להשעות תא גלולה ב 0.8 מ&quot;ל של 0.22 מיקרומטר HBSS המסונן קר כקרח. מעבירים את הפתרון לקובט electroporation 0.4 סנטימטר סטרילי. </li><li style=";text-align:right;direction:rtl"> הוספת מבנה TV-hPITX3 קדימה מיקוד (30 מיקרוגרם DNA) ומערבבים בעדינות עם טפטפת 200 μl. לדגור על קרח למשך 5 דקות. במהלך תקופה זו להסיר aliquot אחד PITX3 ZFN mRNA ולהפשיר על קרח. כאשר העברה מופשרת 7.5 μl של ZFN mRNA לDNA / תערובת תא בקובט electroporation. מערבבים בעדינות עם טפטפת 200 μl. הערה: הלוקוס על הכוונת הוא הגורם העיקרי שתורם למיקוד יעילות. קידוד לוקוסים גנים שקטים, גנים לא באו לידי ביטוי בESCs, כגון PITX3 קשים למקד באמצעות רקומבינציה הומולוגית הקונבנציונלית 6. לפיכך, פרוטוקול זה מנצל אישית מעוצב ZFNs למוקד PITX3 האנושי כדי לגרום b גדיל הדנ&quot;א כפולהreak. </li><li style=";text-align:right;direction:rtl"> Electroporate על ידי הבא במסך ההוראות המופיעה על electroporator. </li><li style=";text-align:right;direction:rtl"> בעזרת פיפטה 200 μl להעביר את התוכן מקובט electroporation לצינור 15 מ&quot;ל מכיל 10 מ&quot;ל תקשורת hESC. שטוף את קובט פעמיים עם 200 μl של תקשורת hESC בכל פעם ולהעביר צינור 15 מ&quot;ל. יהיו &quot;כמו רירי-&quot; פסולת בהיקף של דנ&quot;א וחלבון מתאי lysed אשר להשפיע לרעה על הישרדות תא. צנטריפוגה ב160 XG למשך 5 דקות כדי להסיר שאריות זה. </li><li style=";text-align:right;direction:rtl"> לשאוב supernatant ולטפוח בעדינות תא גלולה כדי לשחרר. להשעות Re ב30 מ&quot;ל בתוספת MEF-CM מכיל 10 מיקרומטר Y-27632 וreplate על 3 x 100 מנות מ&quot;מ preplated עם MEFs. </li><li style=";text-align:right;direction:rtl"> לשנות את התקשורת מדי יום. ביום 2, Y-27632 ניתנים למשיכה ותאים שגודלו בתקשורת hESC בלבד. </li><li style=";text-align:right;direction:rtl"> אחרי 2-3 ימים hESCs צריך להיות 50-70% ומחוברות. בשלב זה מתחיל בחירת אנטיביוטיקה (לדוגמא, puromycin 0.5 מיקרוגרם / מ&quot;ל). </li><li style=";text-align:right;direction:rtl"> לשמור על selשיקוף על ידי הוספת מדיה hESC / puromycin טרי מדי יום. לאחר ~ 7 ימים מושבות קטנות צריכה להיות גלויות. אם לא נעשה שימוש בMEFs עמיד לאנטיביוטיקה, MEFs ניתן להשלים על ידי הוספת 1.0 x 10 4 תאים נוספים לסנטימטר 2. </li></ol> .4 המשובטים המהונדסים hESC בחירה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כ 14 - 21 יום בעקבות בחירתה (כאשר מושבות הגיעו קוטר ~ 1 מ&quot;מ) להכין צלחות להתרחבות ולהקרנה. בגין על ידי הפשרת aliquot של Matrigel או Geltrex על 4 מעלות צלזיוס למשך תקופה מינימאלית של 5 שעות. לדלל לפי הוראות יצרנים ולהוסיף 75 μl היטב בכל צלחות 3 x 96 היטב. הכן צלחות 3 x 48 היטב על ידי ציפוי MEFs ב2.0 x 10 4 תאים לכל 2 סנטימטר. דגירה שני צלחות O / N ב 37 מעלות צלזיוס / 5% CO 2. </li><li style=";text-align:right;direction:rtl"> למחרת לנתח מושבות ל16-25 חתיכות באמצעות 21 מחט G בסוף פיפטה 2 מ&quot;ל על ידי חיתוך רשת. </li><li style=";text-align:right;direction:rtl"> לשאוב Matrigel מצלחות 96 היטב ולהחליף עם supplemתקשורת ented CM-MEF. MEFs לשטוף בצלחות 48 היטב x 1 עם HBSS ולהוסיף מדיה hESC. </li><li style=";text-align:right;direction:rtl"> בעזרת פיפטה 200 μl בעדינות להעביר 1/3 של המושבה גזור לתוך צלחת 48 היטב להרחבה. העבר את 2/3 האחר של המושבה גזור לתוך צלחת 96 היטב מתאימה המכילה תקשורת CM-MEF תוספת. </li><li style=";text-align:right;direction:rtl"> לשמור על שני הצלחות על ידי שינוי בתקשורת יומית (בתוספת תקשורת CM-MEF לצלחות matrigel מצופה 96 היטב ותקשורת hESC לצלחות 48 היטב המכילות MEFs; שני בתוספת 0.5 מיקרוגרם / puromycin מ&quot;ל). </li><li style=";text-align:right;direction:rtl"> להרחיב עד 96-גם צלחות הן 100% ומחוברות ולאחר מכן בתחילה מסך באמצעות PCR. </li></ol> .5 הקרנה והרחבת שיבוטים החיוביים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כדי להכין הדנ&quot;א הגנומי (שיטה המבוססת ביום 11 ב) להסיר את כל המדיה מצלחות על ידי היפוך, ואז למחוק על מגבות נייר. </li><li style=";text-align:right;direction:rtl"> לשטוף היטב כל פעמיים עם RT PBS (100 μl / גם כל שטיפה), להפוך וכתם כלצעד 5.1. צלחות מקום בf -80 מעלות צלזיוסאו 1 - שעה 2 כדי לסייע בתמוגה תא (ניתן לאחסן צלחות ללא הגבלת זמן כזה). </li><li style=";text-align:right;direction:rtl"> בעוד תאים נמצאים ב-80 ° C לעשות Sarcosyl תמוגה חוצץ (ראה טבלה 4) (50 μl / טוב). לlyse תאים, צלחות חמות למשך 5 דקות ב RT אז חיץ תמוגה פיפטה לתוך כל טוב. סוגר את הקצוות של כל צלחת עם קלטת, מקום במכל רב סגר המכיל מגבות נייר לחות כדי ליצור לחות, ודגירת O / N ב 60 ° C. </li><li style=";text-align:right;direction:rtl"> לאחר הדגירה להוסיף 150 μl של 5M NaCl ל10 מ&quot;ל של אתנול מוחלט -20 ° C, ומערבב היטב, ומוסיף 100 μl היטב כל אחד (הערה: אתנול ילך מעונן כאשר NaCl מתווסף). צלחות ברז בעדינות לתערובת (לא פיפטה) ולהשאיר למשך תקופה מינימאלית של 30 דקות ב RT. במהלך תקופה זו הפתרון ילך ברור וDNA יהיה להאיץ. </li><li style=";text-align:right;direction:rtl"> הסר פתרון כמו בשלב 5.1 לאחר מכן להוסיף 150 μl של 70% אתנול היטב כל אחד. הפוך צלחת בעדינות ולמחוק כמו קודם. חזור על שלב זה 2x נוסף. הערה: מאחר DNA זירז באופן טבעי adheמיל לפלסטיק תרבית רקמה זה לא להיות וחלץ במהלך שלבי כביסה אלה.) </li><li style=";text-align:right;direction:rtl"> לאחר לשטוף הסופי צלחות צנטריפוגות בקצרה במהירות השיא להתרכז DNA לתחתית של כל אחד גם אז אוויר יבש ב RT (או 37 מעלות צלזיוס) במשך דקות לפחות 30. </li><li style=";text-align:right;direction:rtl"> הוספת 40 - 50 T0.1E μl (pH8.0) (ראה לוח 5) או TE (pH8.0) לכל צלחות גם ומקום ב65 מעלות צלזיוס במשך שעה 1 או 4 ° CO / N לפני השימוש לPCR. Resuspend DNA בעדינות על ידי הקשה על צידי הצלחת. השתמש 1-2 μl של תגובת PCR מחדש מושעה μl DNA / 10. </li><li style=";text-align:right;direction:rtl"> באמצעות להרחיב מערכת PCR תבנית ארוכה עם זרוע L hPITX3 gen. F ופריימרים R GFP זרוע L hPITX3 לבצע סינון ראשוני של שיבוטים ב58 חישול C °, 45 הארכת שניות, 35 מחזורים. </li><li style=";text-align:right;direction:rtl"> דגימות Electrophorese עם 1kb Hyperladder ב1% agarose ג&#39;ל מכילים GelRed ב100 V 45 דקות ולזהות שיבוטים חיוביים באמצעות תאורת UV. </li><li style=";text-align:right;direction:rtl"> לאמת שיבוטים חיוביים PCR ידי לעכל הדנ&quot;א הגנומי מexpaשיבוטים nded (ראה להלן) עם בדיקות HindIII והכלאות 5 &#39;ו 3&#39; של זרועות ההומולוגיה וקטור לכתם דרום (כפי שתואר לעיל ב1). בדיקות מופקות על ידי PCR באמצעות זוגות פריימר hPITX3 5 &#39;הבדיקה F ו R, וhPITX3 3&#39; בדיקה F ו R, מתעכל עם EcoRI וligated לתוך וקטור שיבוט כללי. </li><li style=";text-align:right;direction:rtl"> תלוי במספר של שיבוטים חיוביים, להכין 2 בארות של צלחת 6 היטב על ידי מראש ציפוי עם MEFs (2.0 x 10 4 תאים לכל 2 סנטימטר). </li><li style=";text-align:right;direction:rtl"> למחרת pretreat שיבוטים חיוביים בצלחת 48 היטב עם 10 מיקרומטר Y-27632 למינימום של 1 שעה. </li><li style=";text-align:right;direction:rtl"> לשטוף שיבוטים חיוביים עם HBSS ולהוסיף 300 μl של Accutase. </li><li style=";text-align:right;direction:rtl"> כאשר מושבות ניתנות תאים בודדים, להוסיף 1 מ&quot;ל של תקשורת hESC ולאסוף לתוך צינור 15 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> לשנות את התקשורת מדי יום. ביום 2, Y-27632 ניתנים למשיכה ותאים שגודלו בתקשורת hESC. </li><li style=";text-align:right;direction:rtl"> כאשר מושבות הן 70 - 80% ומחוברות, תת ולהקפיא את יתרת קולושברים בניו יורק. </li></ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

יש לי המחברים אין לחשוף.

הדור של שורות תאי כתב מציע אמצעי רב עוצמה למעקב אחר, לחזות ובודד תאים של ריבית מאוכלוסייה הטרוגנית נגזרת מhESCs. עם זאת, גן המיקוד באמצעות רקומבינציה הומולוגית הקונבנציונלית הוכיח להיות מאוד יעיל לESCs אדם 3. בפרוטוקול זה אנו מתארים טכניקה פשוטה יחסית להכנסת RP לאקסו...

פרוטוקולי התמיינות תאי גזע עובריים (ESC) זרם לגרום לאוכלוסיות תאים הטרוגנית, במיוחד ביחס לגזירה של פנוטיפים עצביים ספציפיים. כך, למרות שתרבויות להכיל את הפנוטיפ הסלולרי הרצוי, עצבי אחרים, סוגים מובחנים בלתי הלא עצבי ותא הם לעתים קרובות הווה 1. מאפיינים אלה מגבילים את היישום של ESC נגזר מקורות תא לשימוש בטיפול בתחליפי תא ובדוגמנות מחלה מבחנה. שורות תאי כתב גנטיות מציעות אמצעים כדי להמחיש, לעקוב ובודד תאים של עניין, ובלבד שהביטוי של חלבון הכתב (RP) מתרבה ביטוי אנדוגני. שימוש במקדמים באופן מיידי במעלה הזרם של אזור קוד גנטי יכול לשמש כדי להפיק כתבים גנטיים גולמיים אך מבנים כגון חסרי אלמנטי רגולציה המדויקים השולטים על ביטוי גני אנדוגני. בניגוד לכך, רקומבינציה הומולוגית מציעההזדמנות להבטיח ביטוי באיכות גבוהה של RP. בעבר, מיקוד וקטורים מיועדים לרקומבינציה הומולוגית בלוקוסים ספציפיים של עניין היה בשימוש למקד RPS בעכבר ESCs (mESCs) באמצעות electroporation כאמצעי למשלוח DNA 1,2. עם זאת הדור של שורות תאי כתב באמצעות רקומבינציה הומולוגית הקונבנציונלית הוא מאוד לא יעיל לESCs האנושי (hESCs), ובכך תועד רק בקומץ של מקרים (שנסקר ב3). על ידי שימוש בחלבון מהונדס chimeric המכיל שילוב של פוק אני nuclease עם מוטיבים אבץ אצבע ספציפי לאתר, ידועים קולקטיבי אבץ האצבע nucleases (ZFNs), יכולות להיות הציגו הפסקות כפולות גדיל DNA בלוקוסים הגנומי שנקבע מראש. כאשר וקטור DNA עם הומולוגיה לשני הצדדים של הפסקת גדיל הדנ&quot;א כפול הוא הוסיף, האתר הגנומי ניתן לתיקון על ידי רקומבינציה הומולוגית, המאפשר שילוב של רצף תורם DNA. טכניקה זו הוכיחה f שימושיתאו עריכה הגנומי בשני תאים ראשוניים אנושיים 4,5 וhESCs 6,7. nucleases עבודה מאוחרת יותר נצלה שעתוק כמו activator-מפעיל (TALENs), גורמי שעתוק המשמשים את מפעל פתוגנים 8, כדי לסייע בעיצוב של nucleases ספציפי לאתר 9. בפרוטוקול הבא אנחנו מדגימים את הדור של שורת תאי כתב hESC ידי electroporation של EGFP המכיל וקטור מיקוד הומולוגי 6 יחד עם ZFNs לhomeobox יותרת המוח האנושי 3 הלוקוס (PITX3). בעקבות בחירתה אנטיביוטיקה ל2-3 שבועות, hESCs עם DNA המשולב בצורה נכונה יכול להיות ידני הרים, הרחיב והוקרן בתחילה באמצעות PCR, ומאומתים בהמשך על ידי סופג דרום.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

מגבלה העיקרית אחת עם פרוטוקולי התמיינות תאי גזע עובריים אנושיים (ESC) הנוכחיים היא הדור של אוכלוסיות תאים הטרוגנית. תרבויות אלה מכילות תאים של עניין, אלא גם נגועות בESCs מובחן, נגזרים שאינם עצביים ותת עצביים אחרים. זה מגביל את השימוש שלהם במבחנה וביישומי vivo, כגון דוגמנות במבחנה לגילוי סמים או טיפול בתחליפי תא. כדי לסייע להתגבר על זה, שורות תאי כתב, אשר מציעות אמצעים כדי לחזות, מסלול ובודד תאים של עניין, יכולות להיות מהונדסות. עם זאת, כדי להשיג את זה בתאי גזע עובריים אנושיים באמצעות רקומבינציה הומולוגית הקונבנציונלית היא מאוד לא יעילה. פרוטוקול זה מתאר מיקוד של homeobox יותרת המוח 3 הלוקוס (PITX3) בתאי גזע עובריים אנושיים באמצעות nucleases אבץ אצבע מעוצב בהתאמה אישית, המציג את הפסקות DNA גדיל פעמיים ספציפיות לאתר, יחד עםPITX3 - וקטור תורם DNA -specific EGFP. בעקבות הדור של הקו הסלולרי כתב PITX3, זה יכול לאחר מכן להיות מובחן באמצעות פרוטוקולים שפורסמו לשימוש במחקרים כגון במבחנה דוגמנות מחלה או החלפת תא הטיפול בפרקינסון.

בעקבות שיתוף electroporation של זוג אבץ אצבע PITX3 המותאם אישית תוכנן יחד עם PITX3 - וקטור תורם DNA -specific EGFP, ובחירת puromycin שלאחר מכן, שיבוטים hESC חיוביים בתחילה זוהו באמצעות הקרנה הגנומי PCR (איור 1). הכלאה כתם הדרומית של שיבוטים אלה PCR החיוביים עם 5 &#39;ו 3&#39; בדיקות ...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

שורות תאי כתב להציע אמצעים כדי להמחיש, לעקוב ובודד תאים של ריבית מאוכלוסיות הטרוגניות. עם זאת, באמצעות רקומבינציה הומולוגית קונבנציונלית בתאי גזע עובריים אנושיים מיקוד הגן הוא מאוד לא יעיל. בזאת, אנו מתארים מיקוד מוקד PITX3 CNS המוח התיכון ספציפי גורם שעתוק עם EGFP באמצעות רקומבינציה הומולוגית המשופרת nuclease אבץ האצבע.

ג&#39;ין משופר Nuclease אבץ אצבע מיקוד בתאי גזע עוברי האנושי

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.7K Views.  Monash University.  שורות תאי כתב להציע אמצעים כדי להמחיש, לעקוב ובודד תאים של ריבית מאוכלוסיות הטרוגניות. עם זאת, באמצעות רקומבינציה הומולוגית קונבנציונלית בתאי גזע עובריים אנושיים מיקוד הגן הוא מאוד לא יעיל. בזאת, אנו מתארים מיקוד מוקד PITX3 CNS המוח התיכון ספצ?...

Video: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

רביה של האדם גזע עובריים (ES) תאים

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

גזירת בתאי גזע עובריים אנושיים על ידי Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

גשוש עבור פעילות קומפלקס מיטוכונדריאלי של בתאי גזע עובריים אנושיים

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

במבחנה פליטת אור הדמיה vivo ג&#39;ין הכתב של בתאי גזע עובריים אנושיים

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

הכרומטין immunoprecipitation מן בתאי גזע עובריים אנושיים

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of the predominant imaging modalities to assess the restoration of the injured myocardium. Furthermore, ex-vivo labeling agents, such as iron-oxide nanoparticles, have been employed to track and localize the transplanted stem cells. However, this method does not monitor a fundamental cellular biology property regarding the viability of transplanted cells. It has been known that manganese chloride (MnCl2) enters the cells via voltage-gated calcium (Ca2+) channels when the cells are biologically active, and accumulates intracellularly to generate T1 shortening effect. Therefore, we suggest that manganese-guided MRI can be useful to monitor cell viability after the transplantation of hESC into the myocardium.
In this video, we will show how to label hESC with MnCl2 and how those cells can be clearly seen by using MRI in vitro. At the same time, biological activity of Ca2+-channels will be modulated utilizing both Ca2+-channel agonist and antagonist to evaluate concomitant signal changes.

In this video, we are showing how to label human embryonic stem cells (hESC) with manganese chloride (MnCl2) which can enter cells via voltage-gated calcium channels when the cells are biologically active. Additionally, we show the use of MnCl2 as cellular MRI contrast agent to determine the in vitro viability of hESC.

ב סימון במבחנה של בתאי גזע עובריים אנושיים עבור דימות תהודה מגנטית

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be  fed  every day by performing a complete medium change to replenish lost nutrients and to keep the cultures free of unwanted differentiation factors. Although a small amount of differentiation is normal and expected in stem cell cultures, the culture should be routinely cleaned up by manually removing, or "picking" differentiated areas. Identifying and removing excess differentiation from hES cell cultures are essential techniques in the maintenance of a healthy population of cells.

Culture and Maintenance of Human Embryonic Stem Cells

This protocol demonstrates how to maintain healthy, undifferentiated human embryonic stem (ES) cells.

תרבות ותחזוקה של בתאי גזע עובריים אנושיים

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

מקפיא הפשרה בתאי גזע עובריים אנושיים

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

התמיינות של תאים עובריים לתוך מבשרי Oligodendrocyte

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.