The OPPF-UK is funded by the Medical Research Council, UK (grant MR/K018779/1) and the Membrane Protein Laboratory by the Wellcome Trust (grant 099165/Z/12/Z).

1. בנייה של וקטורי ביטוי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> שימוש PCR עירוי השיבוט לבנות עד 96 פלסמידים ביטוי במקביל באמצעות הווקטורים pOPINE-3C-GFP וpOPIN-N-GFP שיוסיפו או שילובי GFP-His6 cleavable C-מסוף או N-terminal לרצפי 13 בהתאמה. הערה: הבחירה של וקטור מוכתבת על ידי הטופולוגיה של החלבון מאז GFP צריך לבוא לידי ביטוי בcytosol, ובכך, לחלבון בעל N-הסופי cytosolic ו- C-הסופי תאי היינו להשתמש pOPIN-N-GFP ול N-הסופי תאי ו- C-הסופי cytosolic בהיינו להשתמש pOPINE-3C-GFP. איפה שני termini הוא cytosolic היינו להשתמש pOPINE-3C-GFP, אלא אם כן יש סיבה פונקציונלית לא לתייג C-הסופי. </li><li style=";text-align:right;direction:rtl"> להגביר את רצפי DNA המקודדים את החלבונים בממברנה עם פריימרים המאגדים את הסיומות הבאות מוצגות: pOPINE-3C-GFP (פריימר קדימה - AGGAGATATACCATG; לאחור תחל - CAGAACTTCCAGTTT) וpOPIN-N-GFP (פריימר קדימה - AAGTTCTGTTTCAGGGCCCG; לאחור תחל - ATGGTCTAGAAAGCTTTA). </li><li style=";text-align:right;direction:rtl"> לנתח את תגובת PCR על ידי ג&#39;ל אלקטרופורזה agarose. ברגע שמוצרי ה- PCR נקיים התקבלו, להוסיף 5 U DpnI היטב כל אחד (לפצות ב -5 μl של חיץ תגובת 1x DpnI). לטהר את מוצרי ה- PCR באמצעות חרוזים מגנטיים בפורמט 96-היטב. הערה: DpnI מתווסף להסיר את וקטור התבנית; צעד זה אינו נחוץ אם הדנ&quot;א הגנומי משמש כתבנית. </li><li style=";text-align:right;direction:rtl"> הוסף 1 μl (100 ng) של הווקטור לינארית המתאים היטב בכל צלחת PCR. </li><li style=";text-align:right;direction:rtl"> באמצעות x תוספת pipettor רב-ערוצי μl של PCR המטוהר להכניס לבארות המתאימות של צלחת PCR. להבטיח כי כל המוצרים הם בטווח של 10-250 ng. </li><li style=";text-align:right;direction:rtl"> להוסיף μl (9-x) של מים אל הבאר ולהעביר את כל 10 μl לצינור המכיל מגיב ב- היתוך היבש למטה. השאר למשך 30 שניות. </li><li style=";text-align:right;direction:rtl"> מערבבים תוכן בקצרה על ידי pipetting מעלה ומטה. העברההתגובות חזרה לצלחת PCR המקורית והחותם. </li><li style=";text-align:right;direction:rtl"> דגירה של 30 דקות ב 42 מעלות צלזיוס בthermocycler. </li><li style=";text-align:right;direction:rtl"> מייד להעביר את התגובות לקרח בהקדם התגובה היא להשלים ולהוסיף 40 μl של TE (10 מ&quot;מ טריס, pH 8.0, 1 mM EDTA). </li><li style=";text-align:right;direction:rtl"> להקפיא מייד או להפוך לתאים מוסמכים. לשינוי, להשתמש 3 μl של התגובה מדוללת ל-50 aliquot μl גבוה כשירות (&gt; 5 x 10 9 transformants / מיקרוגרם) E. המוסמך תאי coli. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מיליליטר של אגר LB בתוספת 50 מיקרוגרם / מיליליטר carbenicillin לכל טוב של צלחת תרבית רקמת 24 גם (לשיבוט, להכין בארות עבור 2 x מספר מבנים). </li><li style=";text-align:right;direction:rtl"> בעקבות תוצאה, בעקבות צלחת תולדה מתוך 25 μl ו -25 μl של 1 ב 5 דילול של התרבות על אגר המכילים צלחות תרבית רקמת 24 גם. </li><li style=";text-align:right;direction:rtl"> מורחים את התאים בעדינות על ידי הטיית הצלחת. </li><li style=";text-align:right;direction:rtl"> ייבש את הצלחת עם המכסה במשך 10-15 דקות ב 37 ° C או בפלהמכסה המנוע w בטמפרטורת חדר. </li><li style=";text-align:right;direction:rtl"> החזר את המכסה ולהפוך את צלחת דגירה הלילה על 37 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> פיק שתי מושבות ומיני הכנת הווקטורים. </li><li style=";text-align:right;direction:rtl"> PCR לוודא את המבנים באמצעות פריימר המבנה הספציפי ההפוך ופריימר וקטור ספציפי קדימה (למשל GG TAG pOPIN_FOR GAC CGA AAT TAA TAC GAC TCA CTA). </li></ol> 2. שינוי של א &#39; זני Xpression coli E הערה: לפני ביצוע פרוטוקול זה, א &#39; תאים מוסמכים coli נעשים, aliquotted ומאוחסנים קפוא ב -80 ° C כפי שתוארו לעיל 13. ביטוי חלבון קרום מוקרן באופן שיגרתי בשני זנים, Lemo21 (DE3) וC41 (DE3) pLysS. כדי לסייע פרשנות של תוצאותיה יכולות להיות מועילות לכלול שליטה חיובית, למשל פלסמיד GFP להביע או חלבון קרום התמזג GFP הידוע להביע ובקרת וקטור ריק שלילית. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להפשיר אותי<html> quotted E. coli על קרח. הוסף 3 μl של פלסמיד ביטוי הכין מיני לכל aliquot של תאים מוסמכים. </li><li style=";text-align:right;direction:rtl"> דגירה לערבב על קרח למשך 30 דקות. </li><li style=";text-align:right;direction:rtl"> חום-לזעזע את התאים למשך 30 שניות על 42 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> לאפשר לתאים להתאושש על קרח למשך 2 דקות ולאחר מכן להוסיף 300 μl של מרק כוח על צינור אחד. </li><li style=";text-align:right;direction:rtl"> דגירה עבור שעה 1 בחממה סטטי 37 ° C. </li><li style=";text-align:right;direction:rtl"> הכן את אגר LB בצלחת תרבית רקמת 24 גם, בתוספת 50 מיקרוגרם / מיליליטר carbenicillin ו -35 מיקרוגרם / מיליליטר chloramphenicol. להוסיף rhamnose לריכוז סופי של 0.25 מ&quot;מ לבארות המכילות Lemo21 (DE3). הערה: אם המוצר עשוי להיות רעיל הבארות המכילות C41 ניתן להשלים (DE3) pLysS עם 1% (w / v) גלוקוז. </li><li style=";text-align:right;direction:rtl"> העברה 30 μl של תאים מתערובת השינוי לצלחות LB אגר. מורחים ולייבש את הצלחת כפי שמתואר ב1.13-1.15. </li></ol> 3. הכנת תרבויות Starter לילה = &quot;Jove_content&quot;&gt; הערה: תמיד להכין תרבויות לילה ביום שלאחר שינוי לא מצלחת שינוי ישנה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להוסיף מרק 0.7 מיליליטר כוח היטב בכל 96 היטב עמוק היטב צלחת בתוספת 50 מיקרוגרם carbenicillin / מיליליטר ו -35 מיקרוגרם / מיליליטר chloramphenicol. להוסיף rhamnose לבארות המכילות Lemo21 (DE3) לריכוז סופי של 0.25 מ&quot;מ. לחלופין, להשלים C41 pLysS (DE3) עם 1% (w / v) גלוקוז; ראה לעיל (הערה 2.6). </li><li style=";text-align:right;direction:rtl"> פיק מושבה אחת מצלחות השינוי בין לילה לכל אחד. לאטום את הבלוק עם חותם גז חדיר. </li><li style=";text-align:right;direction:rtl"> לנער את הבלוק ב 250 סל&quot;ד באינקובטור עם זריקה גדולה (למשל מסלול 25 מ&quot;מ) או ב 600 סל&quot;ד באינקובטור עם זריקה קטנה (כגון מסלול 4.3 מ&quot;מ) על 37 מעלות צלזיוס למשך הלילה. </li></ol> 4. צמיחה ואינדוקציה של תרבויות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להוסיף 3 מיליליטר של מרק כוח בתוספת 50 מיקרוגרם / מיליליטר carbenicillin ו -35 מיקרוגרם / מיליליטר chloramphenicol לכל well של 24 גם צלחת עמוקה היטב. הוספת L-rhamnose (וגלוקוז) כמפורט בסעיף 3.1. השתמש 3 מיליליטר של תרבות, כדי לאפשר קצירה בשני עותקים, ולאפשר לכמה אידוי של מים דרך האטם החדיר הגז. </li><li style=";text-align:right;direction:rtl"> הגדר את תרבויות ביטוי על ידי הוספת 150 μl של Lemo21 (DE3) או C41 (DE3) pLysS תרבויות לילה היטב בכל הלוקים עמוקים היטב 24 גם. </li><li style=";text-align:right;direction:rtl"> לנער את הקוביות על 37 מעלות צלזיוס עד OD הממוצע ב595 ננומטר הוא ~ 0.5 באמצעות הצלחת. </li><li style=";text-align:right;direction:rtl"> לגרום לביטוי על ידי הוספת IPTG לתרבויות לריכוז סופי של 1.0 מ&quot;מ IPTG. </li><li style=";text-align:right;direction:rtl"> לגדול תרבויות הלילה (שעות 18-20) עם הרעד ב 20 מעלות צלזיוס. </li></ol> 5. ניתוח של ביטוי על ידי In-ג&#39;ל הקרינה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> קציר בשני עותקים. העברת 1 מיליליטר של תרבות מכל טוב לכיכר גם, תחתון חרוטי, 96, גם בלוק עמוק היטב. הערה: קציר בשני עותקים במקרה של שבירה של הגוש או כדי לאפשר הבדיקה של משתנve חומר ניקוי אם תרצה בכך. </li><li style=";text-align:right;direction:rtl"> לאטום את הלוקים ולאסוף את התאים על ידי צנטריפוגה ב6,000 XG במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> הפוך את הבלוק ולמזוג התקשורת. הקש על הבלוק בעדינות על גבי מגבת נייר לניקוז תקשורת שנותרה. </li><li style=";text-align:right;direction:rtl"> לאטום את הצלחות ולאחסן ב -80 ° C למשך תקופה מינימאלית של 20 דקות. לחלופין, לעזוב את הניסוי בשלב זה ולחסום מעובד כאשר נוח. </li><li style=";text-align:right;direction:rtl"> De-כפור כדורים במשך 20 דקות בטמפרטורת חדר. </li><li style=";text-align:right;direction:rtl"> השתמש באחת פיפטה רבת-ערוצית או ייקר מסלולית (1,000 סל&quot;ד במשך 10 דקות) בשעה 4 ° C כדי resuspend התאים לחלוטין ב -200 μl של חיץ תמוגה (50 v 1% מ&quot;מ לאא 2 PO 4, 300 מ&quot;מ NaCl 10 מ&quot;מ Imidazole / V Tween 20, להתאים את ה- pH ל 8.0 באמצעות NaOH). </li><li style=";text-align:right;direction:rtl"> הוסף 20 μl של פתרון DLPI (20 μl DNaseI (4,000 יחידות / מיליליטר), 20 מ&quot;ג יזוזים, ומעכבי פרוטאז קוקטייל 20 μl בנפח סופי של 2 מיליליטר של מים). דגירה של 10 דקות עם הרעד (~ 1000 סל&quot;ד) בשעה 4 מעלות צלזיוס. </li><li&gt; הוסף 25 μl של 10% n -Dodecyl β-D-maltoside (DDM). </li><li style=";text-align:right;direction:rtl"> דגירה של 60 דקות עם הרעד (~ 1000 סל&quot;ד) בשעה 4 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה הבלוק העמוק היטב ב6,000 XG במשך 30 דקות ב 4 ° C. </li><li style=";text-align:right;direction:rtl"> העברת 10 μl של lysate פינה לצלחת microtitre ולהוסיף 10 μl של חיץ SDS טעינת ג&#39;ל עמוד (100 מ&quot;מ טריס, pH 6.8, 4% w / v SDS, 0.2% w / v β הכחולה, 10% v / v bromophenol -mercaptoethanol, ו -20% v גליצרול / V). זהירות! אין להרתיח את המדגם. </li><li style=";text-align:right;direction:rtl"> טען 10 μl של מדגם מצעד 5.11 / גם על ג&#39;ל SDS עמוד (ים) ולרוץ ב100-120 V (מתח קבוע) בחדר קר עד החזית לצבוע מגיעה לתחתית (2-2.5 שעות). </li><li style=";text-align:right;direction:rtl"> מניחים את הג&#39;ל על תרמי (למשל עם מסנן כחול-אור כדי לזהות את חלבוני היתוך GFP). זמן החשיפה נבחר על מנת להבטיח שהלהקות המבריקה לא רוויות. </li></ol> 6. Scale-up של תרביות תאים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להפוך aliquot של מוסמך <em&gt; E. coli כפי שתואר בסעיף 2. </li><li style=";text-align:right;direction:rtl"> פיק מושבה לתוך 10 מיליליטר של מרק כוח (בתוספת כאמור בסעיף 3) ולגדול לילה בשעה 37 ° C. </li><li style=";text-align:right;direction:rtl"> לדלל 5 מיליליטר של תרבות הלילה לתוך 500 מיליליטר מרק כוח. </li><li style=";text-align:right;direction:rtl"> לגדול עם הרועד בסל&quot;ד 250 על 37 מעלות צלזיוס עד OD ב 595 ננומטר הוא ~ 0.5. </li><li style=";text-align:right;direction:rtl"> לגרום לביטוי על ידי הוספת IPTG לריכוז סופי של 1.0 מ&quot;מ. </li><li style=";text-align:right;direction:rtl"> לגדול בין לילה עם הרועד ב 250 סל&quot;ד ב 20 ° C. </li><li style=";text-align:right;direction:rtl"> קציר תאים על ידי צנטריפוגה בXG 5000 במשך 15 דקות. </li><li style=";text-align:right;direction:rtl"> supernatant מחק. ניתן לאחסן כדורי תא ב -80 ° C. </li></ol> 7. הכנה של ממברנות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תאי הפשרה (במידת צורך) בטמפרטורת חדר וגלול ב1x PBS pH 7.5 בנפח של 5 מ&quot;ל לגרם של תא גלולה; הגדל את הנפח לפי צורך עד הצמיגות מפחיתה לעקביות נזלת. הוסף MgCl 2 לריכוז סופי של 1 מ&quot;מ, DNAse אני לריכוז סופי של 10 מיקרוגרם / מ&quot;ל ואחדטרום ארוז לוח מעכב פרוטאז לכל 20 גרם של תא גלולה. לשבור תאים פתוחים באמצעות משבש תא מקורר בלחץ של 30 kpsi. </li><li style=";text-align:right;direction:rtl"> גלולה התאים והפסולת השלמים ב30,000 גרם במשך 15 דקות ב 4 מעלות צלזיוס. העברת supernatant לצינור אולטרה-צנטריפוגה. </li><li style=";text-align:right;direction:rtl"> לאסוף את שבר הקרום הכולל ידי ספינינג את supernatant באולטרה-צנטריפוגות ב 200,000 XG עבור שעה 1 על 4 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> בטל supernatant. </li><li style=";text-align:right;direction:rtl"> להשעות מחדש את גלולה הקרום בקר כקרח 10 מיליליטר PBS pH 7.5 באמצעות homogenizer תא. 1 מיליליטר resuspended קרומים נדרשים לכל חומר ניקוי. לחלופין, בשלב זה, הבזק להקפיא את ההשעיה הקרום בחנקן נוזל חנות ב -80 ° C. </li></ol> 8. solubilization וניתוח של שבר ממברנה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> חלק קרום הפשרה (במידת צורך), ולכל חומר ניקוי שישמש לsolubilization, 900 μl aliquot של ההשעיה הקרום ל1.5 מיליליטר מיקרו-centrifu polyallomerצינור ge. </li><li style=";text-align:right;direction:rtl"> הוספה של כל חומר ניקוי מוכן טרי 100 μl (10% w / v פתרונות של DDM, DM, Cymal-6 וLDAO) לריכוז סופי של 1% לצינור 1.5 מיליליטר שצוין. לsolubilization של hemisuccinate אוקריוטים חלבוני קרום כולסטרול (0.2% ריכוז סופי) ניתן להוסיף לחומרי הניקוי. </li><li style=";text-align:right;direction:rtl"> דגירה התערובות על 4 מעלות צלזיוס במשך שעה 1 עם תסיסה עדינה. </li><li style=";text-align:right;direction:rtl"> גלולה החלק בלתי מסיס חומר הניקוי עם אולטרה-צנטריפוגה ספסל עליון, צינורות הבטחה הם חצי מלא לפחות, ב150,000 גרם ב 4 מעלות צלזיוס במשך 45 דקות ולשמור supernatant. הערה: היעילות של solubilization חומרי הניקוי ניתן להעריך באמצעות קורא צלחת ניאון על ידי מדידת הקרינה GFP של קרומי solubilized עם החלק בלתי מסיס חומר הניקוי resuspended באותו הנפח של PBS. </li><li style=";text-align:right;direction:rtl"> ניתוח חד-dispersity של חומרי הניקוי השונים: קומפלקסי חלבוני קרום באמצעות כרומטוגרפיה הדרת גודל זוהה הקרינה (FSEC). </li><li style=";text-align:right;direction:rtl"> לניתוח FSEC, לאזן עמודת הדרת גודל עם מגוון רחב חלוקה, למשל 5000 ל 5,000,000 במשקל מולקולרי, עם הפעלת מאגר (20 מ&quot;מ טריס pH 7.5, 150 מ&quot;מ NaCl, DDM 0.03%) בקצב זרימה של 0.3 מיליליטר / דקה . השתמש במאגר זה עבור כל הדגימות, כלומר הוא לא השתנה במשך כל חומר ניקוי שנבדק. </li><li style=";text-align:right;direction:rtl"> הזרק של קרומי solubilized 100 μl על הטור בקצב זרימה של 0.3 מיליליטר / דקה. צג פרופיל elution באמצעות אופטיקה הקרינה (עירור ב 488 ננומטר פליטה ב 512 ננומטר). אם צג הקרינה מוטבעת אינו זמין, לאסוף את השברים ולקרוא את הקרינה בקורא צלחת. </li><li style=";text-align:right;direction:rtl"> יבוא elution נפח ונתוני עוצמת הקרינה לתכנית גיליון אלקטרוני לתצוגה גרפית. </li><li style=";text-align:right;direction:rtl"> נתח את יתרת חומר קרום solubilized ידי הקרינה בג&#39;ל כאמור בסעיף 5. </li></ol>

<ol>
	<li>Wallin, E., von Heijne, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+integral+membrane+proteins+from+eubacterial,+archaean,+and+eukaryotic+organisms.">Genome-wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms.</a> Protein Sci. 7 (4), 1029-1038 (1998).</li><li>Fagerberg, L., Jonasson, K., von Heijne, G., Uhlen, M., Berglund, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prediction+of+the+human+membrane+proteome.">Prediction of the human membrane proteome.</a> Proteomics. 10 (6), 1141-1149 (2010).</li><li>Okada, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-Ray+diffraction+analysis+of+three-dimensional+crystals+of+bovine+rhodopsin+obtained+from+mixed+micelles.">X-Ray diffraction analysis of three-dimensional crystals of bovine rhodopsin obtained from mixed micelles.</a> J Struct Biol. 130 (1), 73-80 (2000).</li><li>Palczewski, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+rhodopsin:+A+G+protein-coupled+receptor.">Crystal structure of rhodopsin: A G protein-coupled receptor.</a> Science. 289 (5480), 739-745 (2000).</li><li>Miroux, B., Walker, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Over-production+of+proteins+in+Escherichia+coli:+mutant+hosts+that+allow+synthesis+of+some+membrane+proteins+and+globular+proteins+at+high+levels.">Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels.</a> J Mol Biol. 260 (3), 289-298 (1996).</li><li>Wagner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tuning+Escherichia+coli+for+membrane+protein+overexpression.">Tuning Escherichia coli for membrane protein overexpression.</a> Proc Natl Acad Sci U S A. 105 (38), 14371-14376 (2008).</li><li>Schlegel, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+membrane+protein+overexpression+in+the+Escherichia+coli+strain+Lemo21(DE3).">Optimizing membrane protein overexpression in the Escherichia coli strain Lemo21(DE3).</a> J Mol Biol. 423 (4), 648-659 (2012).</li><li>Chun, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+partner+toolchest+for+the+stabilization+and+crystallization+of+G+protein-coupled+receptors.">Fusion partner toolchest for the stabilization and crystallization of G protein-coupled receptors.</a> Structure. 20 (6), 967-976 (2012).</li><li>Drew, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP-based+optimization+scheme+for+the+overexpression+and+purification+of+eukaryotic+membrane+proteins+in+Saccharomyces+cerevisiae.">GFP-based optimization scheme for the overexpression and purification of eukaryotic membrane proteins in Saccharomyces cerevisiae.</a> Nat Protoc. 3 (5), 784-798 (2008).</li><li>Drew, D. E., von Heijne, G., Nordlund, P., de Gier, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Green+fluorescent+protein+as+an+indicator+to+monitor+membrane+protein+overexpression+in+Escherichia+coli.">Green fluorescent protein as an indicator to monitor membrane protein overexpression in Escherichia coli.</a> FEBS Lett. 507 (2), 220-224 (2001).</li><li>Kawate, T., Gouaux, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence-detection+size-exclusion+chromatography+for+precrystallization+screening+of+integral+membrane+proteins.">Fluorescence-detection size-exclusion chromatography for precrystallization screening of integral membrane proteins.</a> Structure. 14 (4), 673-681 (2006).</li><li>Newstead, S., Kim, H., von Heijne, G., Iwata, S., Drew, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+fluorescent-based+optimization+of+eukaryotic+membrane+protein+overexpression+and+purification+in+Saccharomyces+cerevisiae.">High-throughput fluorescent-based optimization of eukaryotic membrane protein overexpression and purification in Saccharomyces cerevisiae.</a> Proc Natl Acad Sci U S A. 104 (35), 13936-13941 (2007).</li><li>Busso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+protein+complexes+using+multiple+Escherichia+coli+protein+co-expression+systems:+a+benchmarking+study.">Expression of protein complexes using multiple Escherichia coli protein co-expression systems: a benchmarking study.</a> J Struct Biol. 175 (2), 159-170 (2011).</li><li>Sonoda, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Benchmarking+membrane+protein+detergent+stability+for+improving+throughput+of+high-resolution+X-ray+structures.">Benchmarking membrane protein detergent stability for improving throughput of high-resolution X-ray structures.</a> Structure. 19 (1), 17-25 (2011).</li><li>Low, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+analytical+gel+filtration+screening+of+integral+membrane+proteins+for+structural+studies.">High-throughput analytical gel filtration screening of integral membrane proteins for structural studies.</a> Biochim Biophys Acta. 1830 (6), 3497-3508 (2013).</li></ol>

The authors have nothing to disclose.

בפרוטוקול המתואר במאמר זה, שיבוט עצמאי קשירה לתוך וקטור כתב GFP הוא בשילוב עם גילוי הקרינה להקרין את הביטוי היחסי של חלבונים בממברנה המרובים במהירות E. coli. וקטורים יכולים להתבצע בארבעה ימי עבודה בהקרנת ביטוי ראשוני לוקחת שבוע נוסף. בג&#39;ל הקרינה של lysates בחומרי ניקוי מכל תאים המשמשת לדירוג ביטוי פוגע לניתוח נוסף במסך המשני. מסך הביטוי העיקרי כפי שהוצג אינו דורש כל ציוד מומחה מלבד חממה ייקר מתאימה לגידול תאים בלוקים גם עמוקים. כל טיפול הנוזל האחר שקשור ללוחיות SBS 96-גם יכול להתבצע באמצעות טפטפות רבת-ערוצית. הפרוטוקול ניתן לשנות בקלות לכלול זני coli אחרים E. גדלו בתנאים שונים ביטוי (למשל טמפרטורה נמוכה יותר). במקרה של LEMO21 (DE3) titrating רמת rhamnose (0-2.0 מ&quot;מ)הוסיף לווסת את קצב השעתוק יכול להגדיל את רמת ביטוי של חלבונים מסוימים קרום 7. חומרי ניקוי אחרים מאשר DDM יכול לשמש להפקה במסך הראשי אם כי חומרי ניקוי חריפים יותר עשוי solubilize חלבוני מגופי הכללה ולכן נותנים תוצאות חיוביות שגויות. ברור, יותר לפרט המסך הראשוני הופך, יותר ניסוי הזמן רב. המסך המשני כרוך בהכנת חלק קרום מוחלט מלהיטי הביטוי שזוהו במסך הראשי. זהו צעד קריטי כפי שיאשר את הלוקליזציה של חלבוני היתוך הקרום של E. תאי coli. החילוץ הבא של חלבון היתוך GFP בחומרי ניקוי שונה מנוטר על ידי כרומטוגרפיה הדרת גודל זוהה הקרינה של חומר solubilized להעריך את מונו-dispersity של מתחמי חומר ניקוי-חלבון. זהו עוד שלב קריטי שכן הוא מזהה את חומר הניקוי המתאים ביותר לsolubilization של חלבון הקרום לעיבוד במורד הזרם שלאחר מכן. עם זאת, ניסיון מראה כי אופטימיזציה נוספת של הבחירה של חומר ניקוי (ים) עדיין עשויה להידרש במהלך טיהור וגיבוש. ראיות להתנהגות אחידה בחומרי ניקוי שונים, כולל אלה עם גודל קטן יחסית micelle (למשל LDAO) נראית אינדיקטור טוב של נטייה ליצירת גם diffracting גבישים לפחות לחלבוני קרום פרוקריוטים 14. במובן זה הפרופיל מוצג לחלבון הקרום באיור 2 מופיע חיובי ביותר. היתרון העיקרי של שימוש בכתב GFP הוא שזה נותן קריאה מתוך מהירה של ביטוי בדגימות המטוהר של האו&quot;ם. חסרון הוא שחלבון היתוך GFP צריך להיות מוסר במהלך הטיהור של החלבון להתגבשות. במקרה של הווקטורים משמשים כאן, אתר פרוטאז rhinovirus 3C מאפשר מחשוף של GFP. לחלופין, זה פשוטמחדש שיבוט חלבוני מועמד, שזוהו במסך, לוקטורים שרק להוסיף polyhistidine או תג זיקה אחר לטיהור שלאחר מכן. זאת בהנחה שהיתוך GFP אין צורך לביטוי. התחליף העיקרי לשימוש בהיתוך GFP לגילוי של ביטוי חלבון הקרום וsolubilization הוא להוסיף רק תג היסטידין. עם זאת גישה זו בדרך כלל דורשת שמתחילה בשבריר קרום 15 שלהערכת גרסאות רבות היה להיות מאוד זמן רב. לסיכום, המטרה העיקרית של הפרוטוקול המתואר במאמר זה היא לאפשר למספר גדול של רצף חלבון קרום גרסאות להיות מוערך במהירות במונחים של ביטוי וsolubilization חומרי הניקוי וסדר עדיפויות לניתוח מעמיק יותר.

הערכה הוא כי חלבוני קרום מהווים כ 20-30% מהגנים המקודדים בכל הגנום רצף 1, כוללים את הגנום האנושי 2. בהתחשב בתפקידם הקריטי בתהליכים ביולוגיים רבים, למשל תחבורה של מטבוליטים, דור אנרגיה וכמטרה לתרופות, יש עניין רב בקביעת המבנה התל ממדים שלהם. עם זאת בהשוואה לחלבונים מסיסים, חלבוני קרום מאוד בחלבון נתוני הבנק תחת הייצוג. למעשה, של 99624 המבנים שוחררו בPDB <a href="http://www.rcsb.org/pdb/">(http://www.rcsb.org/pdb/)</a> רק 471 <a href="http://blanco.biomol.uci.edu/mpstruc/">(http://blanco.biomol.uci.edu/mpstruc/)</a> מסווגים כחלבוני קרום. זה משקף את הקשיים הטכניים של עבודה עם חלבוני הקרום שבאים לידי ביטוי באופן טבעי ברמות נמוכות יחסית; רודופסין הוא אחד מכמה יוצאים מן הכלל 3,4. ביטוי יתר של גרסת רקומביננטי<html> ים בתאי Heterologous לעתים קרובות תוצאות misfolding ומיקוד עניים הקרום המגביל את הרמה הכללית של ייצור. בחירת חומר הניקוי הטוב ביותר להפקה וsolubilization של חלבון קרום הביע פעם עושה טיהור שלאחר מכן קשה ודורשת אופטימיזציה זהירה. coli Escherichia נשאר מארח הביטוי הנפוץ ביותר לחלבוני קרום והיוו 72% <a href="http://blanco.biomol.uci.edu/mpstruc/">(http://blanco.biomol.uci.edu/mpstruc/)</a> של מבנים נפתרו עד היום שהם כמעט אך ורק ממקורות חיידקים. E. הספציפי זני coli, C41 (DE3) וC43 (DE3), היו מבודדים שאינו מובילים לביטוי היתר של חלבונים בממברנה ולכן להימנע מההשפעות של הרעילות נצפתה עבור BL21 אחר זני 5,6. כוונון רמת ביטוי חלבון קרום רקומביננטי נראה קריטי לייעול רמת הייצור 6,7. &quot;Jove_content&quot;&gt; במקרים רבים ייצור מוצלח של חלבונים בממברנה לקביעת מבנה דרש ההערכה של מספר גרסאות כוללים amino- ומחיקות carboxy-מסוף, orthologues מרובה לנצל וריאציה רצף טבעית וחלבוני היתוך שונים 6-8. לכן, שיטה להקרנת הביטוי של חלבונים בממברנה מרובות במקביל היא חיונית. גישה אחת נפוץ היא למזג את החלבון לחלבון פלואורסצנטי ירוק ביטוי (GFP) המאפשר להיות במעקב ללא הצורך לטהר את החלבון. בדרך זו, מידע על רמת ביטוי, יציבות והתנהגות בחומרי ניקוי שונה ניתן להעריך עם כמויות קטנות של חומר מטוהר un 9-12. במאמר זה אנו מתארים פרוטוקול יעיל לסינון שיבוט וביטוי של חלבונים בממברנה בE. coli באמצעות היתוך GFP ככתב של ייצור והאפיון הבא של חומרי ניקוי: comp חלבוןlexes (איור 1).

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Name of Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
		</tr>
		<tr>
			<td>pOPIN-N-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>pOPINE-3C-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>C41(DE3)pLysS</td>
			<td>Lucigen (http://lucigen.com/</td>
			<td>60444-1</td>
		</tr>
		<tr>
			<td>LEMO21(DE3)</td>
			<td>New England Biolabs</td>
			<td>C2528H</td>
		</tr>
		<tr>
			<td>In-Fusion HD EcoDry Cloning System, 96 Rxns</td>
			<td>Clontech/Takara</td>
			<td>639688</td>
		</tr>
		<tr>
			<td>Power broth</td>
			<td>Molecular Dimensions (http://www.moleculardimensions.com/)</td>
			<td>MD12-106-1</td>
		</tr>
		<tr>
			<td>Protease Inhibitor tablets</td>
			<td>Roche</td>
			<td>11697498001</td>
		</tr>
		<tr>
			<td>cOmplete, Mini, EDTA-Free; Protease Inhibitor Cocktail&#160;</td>
			<td>Roche</td>
			<td>11836170001</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma-Aldrich</td>
			<td>83650</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P8849</td>
		</tr>
		<tr>
			<td>DNAse 1</td>
			<td>Sigma-Aldrich</td>
			<td>DN25</td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td>L7651</td>
		</tr>
		<tr>
			<td>Cholesterol hemisuccinate</td>
			<td>Sigma-Aldrich</td>
			<td>C6512</td>
		</tr>
		<tr>
			<td>CYMAL-6 ( 6-Cyclohexyl-1-Hexyl-&#946;-D-Maltoside)</td>
			<td>Anatrace</td>
			<td>C326</td>
		</tr>
		<tr>
			<td>DDM ( n-Dodecyl &#223;-maltoside )</td>
			<td>Generon</td>
			<td>D97002</td>
		</tr>
		<tr>
			<td>DM (n-Decyl &#223;-maltoside)</td>
			<td>Generon</td>
			<td>D99003</td>
		</tr>
		<tr>
			<td>LDAO ( N,N-Dimethyl-n-dodecylamine N-oxide)</td>
			<td>Generon</td>
			<td>D71111</td>
		</tr>
		<tr>
			<td>E1 ClipTip Eq384 8 channel 1-30 ul&#160;</td>
			<td>Thermo Scientific&#160;</td>
			<td>4672030</td>
		</tr>
		<tr>
			<td>Rainin Pipette Pipet-Lite XLS 6ch 100-1200&#181;L LTS Spacer</td>
			<td>Anachem</td>
			<td>LA6-300XLS</td>
		</tr>
		<tr>
			<td>Rainin Pipette Light XLS+ 8ch 2-20&#181;L LTS</td>
			<td>Anachem</td>
			<td>L8-20XLSPLUS</td>
		</tr>
		<tr>
			<td>Pipette Pipet-Lite XLS 8ch 100-1200&#181;L LTS Tip</td>
			<td>Anachem</td>
			<td>L8-1200XLS</td>
		</tr>
		<tr>
			<td>24 well V bottom deep well blocks</td>
			<td>Porvair sciences</td>
			<td>360115</td>
		</tr>
		<tr>
			<td>BenchMark Fluorescent Protein Standard</td>
			<td>Life Technologies</td>
			<td>LC5928</td>
		</tr>
		<tr>
			<td>NuPAGE Novex 10% Bis-Tris Midi Protein Gels, 26 well</td>
			<td>Life Technologies</td>
			<td>WG1203BOX</td>
		</tr>
		<tr>
			<td>XCell4 SureLock Midi-Cell</td>
			<td>Life Technologies</td>
			<td>WR0100</td>
		</tr>
		<tr>
			<td>Vibramax 100</td>
			<td>Heidolph</td>
			<td>544-21200-00</td>
		</tr>
		<tr>
			<td>Tension rollers attachment</td>
			<td>Heidolph</td>
			<td>549-81000-00</td>
		</tr>
		<tr>
			<td>ptima L-100 Ultracentrifuge running 45-Ti rotor</td>
			<td>Beckman Coulter</td>
			<td>393253</td>
		</tr>
		<tr>
			<td>Optima Max-XP ultracentrifuge running TLA-55 rotor</td>
			<td>Beckman Coulter</td>
			<td>393315</td>
		</tr>
		<tr>
			<td>Floor standing centrifuge, Avanti J-26S XPI running JA-17 and JS-5.3 rotors&#160;</td>
			<td>Beckman Coulter</td>
			<td>B14535</td>
		</tr>
		<tr>
			<td>Prominence UFLC with RF-20A Fluorescence detector</td>
			<td>Shimadzu</td>
			<td></td>
		</tr>
		<tr>
			<td>Sepharose 6 10/300 GL size exclusion column</td>
			<td>GE Healthcare</td>
			<td>17-5172-01&#160;</td>
		</tr>
		<tr>
			<td>SSI5R-HS SHEL LAB Floor Model Shaking Incubator, 5 Cu.Ft. (144 L), 30-850 RPMs</td>
			<td>Shel Lab&#160;</td>
			<td>SSI5R-HS</td>
		</tr>
		<tr>
			<td>Innova44R incubator</td>
			<td>New Brunswick /Eppendorf</td>
			<td>Innova44R</td>
		</tr>
		<tr>
			<td>TS SERIES 0.75KW DISRUPTER 230V 50HZ 1PH (40KPSI)</td>
			<td>Constant systems</td>
			<td>PL083016</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma</td>
			<td>83650</td>
		</tr>
	</tbody>
</table>

green fluorescent protein-based expression screening of membrane proteins in escherichia coli

הייצור של חלבונים בממברנה רקומביננטי ללימודים מבניים ותפקודיים נותר מאתגר מבחינה טכנית בשל רמות נמוכות של ביטוי וחוסר היציבות הטבועה של חלבונים בממברנה רבות solubilized פעם אחת בחומרי ניקוי. פרוטוקול מתואר המשלב שיבוט עצמאי קשירה של חלבונים בממברנה כשילובי GFP עם ביטוי בcoli Escherichia זוהה על ידי הקרינה GFP. זה מאפשר הקרנת הבנייה וביטוי חלבון קרום מרובה של / גרסאות לזהות מועמדים מתאימים להשקעה נוספת של זמן ומאמץ. כתב ה- GFP משמש במסך ראשי של ביטוי על ידי הדמיה הקרינה GFP הבא אלקטרופורזה SDS polyacrylamide ג&#39;ל (SDS-PAGE). חלבוני קרום שמראים שתי רמת ביטוי גבוהה עם השפלה מינימום כפי שעולה מהעדר GFP החופשי, נבחרו למסך המשני. מבנים אלה הם מדורגים והכין כולל שבריר קרום וsolubilizeד בארבעה חומרי ניקוי שונים. בעקבות ultracentrifugation כדי להסיר חומר ניקוי-מסיס, lysates מנותחות כרומטוגרפיה גילוי הקרינה הדרת גודל (FSEC). ניטור פרופיל הדרת גודל על ידי הקרינה GFP מספק מידע על מונו-dispersity והשלמות של החלבונים בממברנה בחומרי ניקוי שונים. חלבון: שילובי חומרי ניקוי שelute עם שיא סימטרי עם GFP מעט או ללא תשלום וצבירת מינימום הם מועמדים לטיהור שלאחר מכן. שימוש במתודולוגיה לעיל, ביטוי Heterologous בE. coli של SED (צורה, התארכות, החלוקה, ונִבִיגָה) חלבונים מ -47 זנים שונים של חיידקים נותח. יש לי חלבונים אלה בדרך כלל עשרה תחומים הטרנסממברני וחיוניים לחלוקת תאים. התוצאות מראות כי הייצור של orthologues SEDs בE. coli היה משתנה מאוד ביחס לרמות הביטוי ושלמות של חלבוני היתוך GFP. אני הניסויdentified משנה לחקירה נוספת.

משפחת SEDS של חלבונים (צורה, התארכות, החלוקה, ונִבִיגָה) היא חיונית לחלוקת תאי חיידקים. יש לי חלבונים נפרד אלו בדרך כלל עשרה תחומים הטרנסממברני עם שני termini אמינו וcarboxy בתוך התא. כדי להדגים את הפרוטוקול שתואר לעיל, 47 orthologues SEDs היו משובט לתוך הווקטור pOPINE-3C-eGFP. מסך ביטוי בקנה מידה קטן של המבנים בוצע בשני זני .coli E, Lemo21 (DE3) גדל בנוכחות של 0.25 מ&quot;מ rhamnose לחסום ביטוי דולף וC41 (DE3) pLysS, המשמש באופן שיגרתי לביטוי של קרום חלבונים 5-8. lysates דטרגנט solubilized של תרבויות מושרה נותח על ידי אלקטרופורזה SDS-polyacrylamide. שימוש בקרינה ב- ג&#39;ל לדמיין חלבוני היתוך GFP הביעו הראו כי בין שני הזנים 38 מתוך מבני SEDs 47 הופקו. מעניין היו הבדלים בין שני זני הביטוי. של 38 הביעו בונה, רק 18 יוצרו בשני הזנים, 14 לידי ביטוי רק בLemo21 (DE3) ו -6 רק בC41 (DE3) pLysS. בסך הכל, היה שיעור הצלחה גבוה יותר עבור Lemo21 (DE3) בהשוואה לpLysS C41 (DE3) (38 לעומת 24). עם זאת התצפית שחלבונים מסוימים הופיעו להיות ספציפי זן אומרת שהקרנה בשניהם היא שימושית. נציגי נתונים עבור 24 מ -47 SEDs מבנים מוצגים באיור 1. העצמה של הלהקות נותנת אינדיקציה לרמה של ביטוי, למשל חלבון ההיתוך בC4 גם באיור 1 א ו -1 B באה לידי ביטוי גם בשני הזנים עם זאת נוסף להקות משקל מולקולריות נמוכות מצביעות על כך שהחלבון הוא מושפל באופן חלקי. בנתיבים רבים יש להקה שמתאימה בגודלו לGFP לבד. הערכה איכותית של היושרה של החלבון יכול להתבצע על ידי הסתכלות על עוצמת חלבון היתוך ביחס לGFP החופשי;למשל G4 וH4 שבורים לחלוטין עד GFP החופשי בC41 (DE3) pLysS (איור 1) ואילו בLemo21 (DE3) יש כמה חלבון שלם (איור 1 א). במשך 14 מתוך 38 החלבונים הביעו את עוצמת להקת GFP החופשית דומה לזה של חלבון ההיתוך, במשך 21 עוצמת להקת GFP החופשי היא גדולה יותר מזה של חלבון ההיתוך ומיעוט של חלבוני ההיתוך (3 / 38 הביעו) למשל F6 וG6 באיור 1 א יש לי GFP החופשי קטן יחסית בהשוואה לחלבון ההיתוך. שניים מהמבנים שמתבטאים היטב בB5 המסך הראשי (הלהקות בעוצמה גבוהה לGFP החופשי וחלבוני היתוך) וG6 (קטן GFP חינם) באו לידי ביטוי וחלק קרום כולל שהוכן מ -500 מיליליטר תרבות תא. קרומי Resuspended חולקו לaliquots ונותחו על ידי כרומטוגרפיה-זוהה הקרינה הדרת גודל (FSEC). פרופילי FSEC מוצגים בfigur2A הדואר ו2B בהתאמה ולהראות ששני חלבוני SEDs מתנהגים באופן שונה בארבעת חומרי הניקוי שנבדק. במקרה אחד (איור 2 א: B5 מדגם) החלבון נתן רק שיא סימטרי עם צבירה קטנה בDDM שלכן יהיה בחומרי הניקוי מבחירה לטיהור שלאחר מכן. לעומת זאת חלבון היתוך האחר (איור 2: G6 מדגם) נתנו פרופיל דומה בכל חומרי הניקוי שנבדק. <img alt="איור 1" src="/files/ftp_upload/52357/52357fig1highres.jpg" width="700px" /> איור 1: תרשים של זרימת עבודה לסינון ביטוי חלבון קרום בE. coli באמצעות כתב GFP. <img alt="איור 2" src="/files/ftp_upload/52357/52357fig2highres.jpg" /> איור 2: מסך ראשי של ביטוי חלבון קרום באמצעות הקרינה בג&#39;ל. </strong&gt; Lysates דטרגנט של א &#39; תאי coli נותחו על ידי SDS-PAGE וג&#39;לים צילמו באמצעות תאורת Epi הכחול ומסנן 530/28. התוצאות מוצגות למשך 24 מבנים (שכותרת A4-H6 המבוסס על מיקומם בצלחת 96-היטב). העמדות של הלהקות לGFP חופשי וחלבוני היתוך GFP מצוינות. חלבונים () באו לידי ביטוי בLemo21 (DE3). (ב) חלבונים לידי ביטוי בC41 (DE3) pLysS. <img alt="איור 3" src="/files/ftp_upload/52357/52357fig3highres.jpg" /> איור 3:. מסך משני של ביטוי חלבון קרום באמצעות כרומטוגרפיה-זוהה הקרינה הדרת גודל (FSEC) שברים קרום סה&quot;כ הוצאו בארבעה חומרי ניקוי שונים וחלבוני קרום solubilized נותחו על ידי כרומטוגרפיה הדרת גודל באמצעות מערכת FPLC מצמידים את גלאי הקרינה. פרופילי FSEC ל() B5 חלבון קרום ו( B) </strong&gt; G6 חלבון קרום. העמדה של הפסגות המתאימות חלבון מצטבר, חלבון היתוך GFP solubilized וGFP החופשי מצוינות. חומרי הניקוי נבדקו מצוינים מתחת לפרופילים.

Watch this Scientific Journal Video about Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli at JoVE.com

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

גישה יעילה לבדיקות סקר לאיתור הביטוי של חלבונים בממברנה רקומביננטי בcoli Escherichia מבוסס על היתוך לחלבון פלואורסצנטי ירוק מוצגת.

הקרנה ירוקה פלורסנט מבוסס חלבון ביטוי של החלבונים ממברנה ב<em&gt; Coli Escherichia</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

green-fluorescent-protein-based-expression-screening-membrane

Research

JoVE Journal

Biology

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

32.6K Views.  Research Complex at Harwell.  גישה יעילה לבדיקות סקר לאיתור הביטוי של חלבונים בממברנה רקומביננטי בcoli Escherichia מבוסס על היתוך לחלבון פלואורסצנטי ירוק מוצגת. 

Video: Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

הכתמה של חלבונים עם ג&#39;ל Coomassie G-250 ללא חומצה אצטית ממס אורגני

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme acid stresses including passage through the mammalian stomach where the pH can fall to as low as pH 1 - 22. To enable such a broad range of acidic pH survival, E. coli possesses four different inducible amino acid decarboxylases that decarboxylate their substrate amino acids in a proton-dependent manner thus raising the internal pH. The decarboxylases include the glutamic acid decarboxylases GadA and GadB3, the arginine decarboxylase AdiA4, the lysine decarboxylase LdcI5, 6 and the ornithine decarboxylase SpeF7. All of these enzymes utilize pyridoxal-5'-phospate as a co-factor8 and function together with inner-membrane substrate-product antiporters that remove decarboxylation products to the external medium in exchange for fresh substrate2. In the case of LdcI, the lysine-cadaverine antiporter is called CadB. Recently, we determined the X-ray crystal structure of LdcI to 2.0 &#197;, and we discovered a novel small-molecule bound to LdcI the stringent response regulator guanosine 5'-diphosphate,3'-diphosphate (ppGpp) 14. The stringent response occurs when exponentially growing cells experience nutrient deprivation or one of a number of other stresses9. As a result, cells produce ppGpp which leads to a signaling cascade culminating in the shift from exponential growth to stationary phase growth10. We have demonstrated that ppGpp is a specific inhibitor of LdcI 14. Here we describe the lysine decarboxylase assay, modified from the assay developed by Phan et al.11, that we have used to determine the activity of LdcI and the effect of pppGpp/ppGpp on that activity. The LdcI decarboxylation reaction removes the &alpha;-carboxy group of L-lysine and produces carbon dioxide and the polyamine cadaverine (1,5-diaminopentane)5. L-lysine and cadaverine can be reacted with 2,4,6-trinitrobenzensulfonic acid (TNBS) at high pH to generate N,N'-bistrinitrophenylcadaverine (TNP-cadaverine) and N,N&#8242;-bistrinitrophenyllysine (TNP-lysine), respectively11. The TNP-cadaverine can be separated from the TNP-lysine as the former is soluble in organic solvents such as toluene while the latter is not (See Figure 1). The linear range of the assay was determined empirically using purified cadaverine.

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

The activity of the inducible lysine decarboxylase is monitored by reacting the substrate L-lysine and the product cadaverine with 2,4,6-trinitrobenzensulfonic acid to form adducts that have differential solubility in toluene.

Assay למדידת פעילות Escherichia coli ועין מתנהלת ליזין Decarboxyase

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme ...

Crystallization of Membrane Proteins in Lipidic Mesophases

Membrane proteins perform critical functions in living cells related to signal transduction, transport and energy transformations, and, as such, are implicated in a multitude of malfunctions and diseases. However, a structural and functional understanding of membrane proteins is strongly lagging behind that of their soluble partners, mainly, due to difficulties associated with their solubilization and generation of diffraction quality crystals. Crystallization in lipidic mesophases (also known as in meso or LCP crystallization) is a promising technique which was successfully applied to obtain high resolution structures of microbial rhodopsins, photosynthetic proteins, outer membrane beta barrels and G protein-coupled receptors. In meso crystallization takes advantage of a native-like membrane environment and typically produces crystals with lower solvent content and better ordering as compared to traditional crystallization from detergent solutions. The method is not difficult, but requires an understanding of lipid phase behavior and practice in handling viscous mesophase materials. Here we demonstrate a simple and efficient way of making LCP and reconstituting a membrane protein in the lipid bilayer of LCP using a syringe mixer, followed by dispensing nanoliter portions of LCP into an assay or crystallization plate, conducting pre-crystallization assays and harvesting crystals from the LCP matrix. These protocols provide a basic guide for approaching in meso crystallization trials; however, as with any crystallization experiment, extensive screening and optimization are required, and a successful outcome is not necessarily guaranteed.

The protocols describe the essential steps for obtaining diffraction quality crystals of a membrane protein starting from reconstitution of the protein in a lipidic cubic phase (LCP), finding initial conditions with LCP-FRAP pre-crystallization assays, setting up LCP crystallization trials and harvesting crystals.

התגבשות של חלבונים בממברנה ב Mesophases Lipidic

Membrane proteins perform critical functions in living cells related to signal transduction, transport and energy transformations, and, as such, are ...

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted into fuel alcohols1. The potential for enzymatic hydrolysis of cellulosic biomass to provide renewable energy has intensified efforts to engineer cellulases for economical fuel production2. Of particular interest are fungal cellulases3-8, which are already being used industrially for foods and textiles processing.
Identifying active variants among a library of mutant cellulases is critical to the engineering process; active mutants can be further tested for improved properties and/or subjected to additional mutagenesis. Efficient engineering of fungal cellulases has been hampered by a lack of genetic tools for native organisms and by difficulties in expressing the enzymes in heterologous hosts. Recently, Morikawa and coworkers developed a method for expressing in E. coli the catalytic domains of endoglucanases from H. jecorina3,9, an important industrial fungus with the capacity to secrete cellulases in large quantities. Functional E. coli expression has also been reported for cellulases from other fungi, including Macrophomina phaseolina10 and Phanerochaete chrysosporium11-12. 
We present a method for high throughput screening of fungal endoglucanase activity in E. coli. (Fig 1) This method uses the common microbial dye Congo Red (CR) to visualize enzymatic degradation of carboxymethyl cellulose (CMC) by cells growing on solid medium. The activity assay requires inexpensive reagents, minimal manipulation, and gives unambiguous results as zones of degradation (&#x201C;halos&#x201D;) at the colony site. Although a quantitative measure of enzymatic activity cannot be determined by this method, we have found that halo size correlates with total enzymatic activity in the cell. Further characterization of individual positive clones will determine , relative protein fitness. 
Traditional bacterial whole cell CMC/CR activity assays13 involve pouring agar containing CMC onto colonies, which is subject to cross-contamination, or incubating cultures in CMC agar wells, which is less amenable to large-scale experimentation. Here we report an improved protocol that modifies existing wash methods14 for cellulase activity: cells grown on CMC agar plates are removed prior to CR staining. Our protocol significantly reduces cross-contamination and is highly scalable, allowing the rapid screening of thousands of clones. In addition to H. jecorina enzymes, we have expressed and screened endoglucanase variants from the Thermoascus aurantiacus and Penicillium decumbens (shown in Figure 2), suggesting that this protocol is applicable to enzymes from a range of organisms.

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

We describe a low cost, high throughput method to screen for fungal endoglucanase activity in E. coli. The method relies on a simple visual readout of substrate degradation, does not require enzyme purification, and is highly scalable. This allows for the rapid screening of large libraries of enzyme variants.

הקרנת תפוקה גבוהה של פעילות Endoglucanase פטרייתיים ב Escherichia coli</em

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through macromolecular X-ray crystallography (MX). An essential ingredient of MX is a steady supply of ideally diffraction-quality crystals. The in meso or lipidic cubic phase (LCP) method for crystallizing membrane proteins is one of several methods available for crystallizing membrane proteins. It makes use of a bicontinuous mesophase in which to grow crystals. As a method, it has had some spectacular successes of late and has attracted much attention with many research groups now interested in using it. One of the challenges associated with the method is that the hosting mesophase is extremely viscous and sticky, reminiscent of a thick toothpaste. Thus, dispensing it manually in a reproducible manner in small volumes into crystallization wells requires skill, patience and a steady hand. A protocol for doing just that was developed in the Membrane Structural &amp; Functional Biology (MS&amp;FB) Group1-3. JoVE video articles describing the method are available1,4. 
The manual approach for setting up in meso trials has distinct advantages with specialty applications, such as crystal optimization and derivatization. It does however suffer from being a low throughput method. Here, we demonstrate a protocol for performing in meso crystallization trials robotically. A robot offers the advantages of speed, accuracy, precision, miniaturization and being able to work continuously for extended periods under what could be regarded as hostile conditions such as in the dark, in a reducing atmosphere or at low or high temperatures. An in meso robot, when used properly, can greatly improve the productivity of membrane protein structure and function research by facilitating crystallization which is one of the slow steps in the overall structure determination pipeline. 
In this video article, we demonstrate the use of three commercially available robots that can dispense the viscous and sticky mesophase integral to in meso crystallogenesis. The first robot was developed in the MS&amp;FB Group5,6. The other two have recently become available and are included here for completeness.	
An overview of the protocol covered in this article is presented in Figure 1. All manipulations were performed at room temperature (~20 &deg;C) under ambient conditions.

Herein is described a robotic approach to high-throughput crystallization of membrane proteins in lipidic mesophases for use in structure determination using macromolecular X-ray crystallography. Three robots capable of handling the viscous and sticky protein-laden mesophase integral to the method are introduced.

שימוש ברובוט להתגבשות תפוקה גבוהה של חלבונים בממברנה בMesophases Lipidic

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Intravital Microscopy for Imaging Subcellular Structures in Live Mice Expressing Fluorescent Proteins

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, we use the salivary glands of live mice since they provide several advantages. First, they can be easily exposed to enable access to the optics, and stabilized to facilitate the reduction of the motion artifacts due to heartbeat and respiration. This significantly facilitates imaging and tracking small subcellular structures. Second, most of the cell populations of the salivary glands are accessible from the surface of the organ. This permits the use of confocal microscopy that has a higher spatial resolution than other techniques that have been used for in vivo imaging, such as two-photon microscopy. Finally, salivary glands can be easily manipulated pharmacologically and genetically, thus providing a robust system to investigate biological processes at a molecular level.
In this study we focus on a protocol designed to follow the kinetics of the exocytosis of secretory granules in acinar cells and the dynamics of the apical plasma membrane where the secretory granules fuse upon stimulation of the beta-adrenergic receptors. Specifically, we used a transgenic mouse that co-expresses cytosolic GFP and a membrane-targeted peptide fused with the fluorescent protein tandem-Tomato. However, the procedures that we used to stabilize and image the salivary glands can be extended to other mouse models and coupled to other approaches to label in vivo cellular components, enabling the visualization of various subcellular structures, such as endosomes, lysosomes, mitochondria, and the actin cytoskeleton.

Intravital microscopy is a powerful tool that enables imaging various biological processes in live animals. In this article, we present a detailed method for imaging the dynamics of subcellular structures, such as the secretory granules, in the salivary glands of live mice.

מיקרוסקופית Intravital למבני ההדמיה subcellular בעכברים חיים לבטא חלבוני פלורסנט

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, ...

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Electroporation has become a widely used method for rapidly and efficiently introducing foreign DNA into a wide range of cells. Electrotransformation has become the method of choice for introducing DNA into prokaryotes that are not naturally competent. Electroporation is a rapid, efficient, and streamlined transformation method that, in addition to purified DNA and competent bacteria, requires commercially available gene pulse controller and cuvettes. In contrast to the pulsing step, preparation of electrocompetent cells is time consuming and labor intensive involving repeated rounds of centrifugation and washes in decreasing volumes of sterile, cold water, or non-ionic buffers of large volumes of cultures grown to mid-logarithmic phase of growth. Time and effort can be saved by purchasing electrocompetent cells from commercial sources, but the selection is limited to commonly employed E. coli laboratory strains. We are hereby disseminating a rapid and efficient method for preparing electrocompetent E. coli, which has been in use by bacteriology laboratories for some time, can be adapted to V. cholerae and other prokaryotes. While we cannot ascertain whom to credit for developing the original technique, we are hereby making it available to the scientific community.

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Electroporation is a commonly employed method for introducing DNA into bacteria in a process known as transformation. Traditional protocols for the preparation of electrocompetent cells are time consuming and labor intensive. This article describes an alternate, rapid, and efficient method for the preparation of electrocompetent cells presently employed by some laboratories.

ראפיד פרוטוקול להכנת Electrocompetent<em&gt; חיידקי Escherichia</em&gt; ו<em&gt; Vibrio cholerae</em

Electroporation has become a widely used method for rapidly and efficiently introducing foreign DNA into a wide range of cells. Electrotransformation has ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

פרוטוקולים ליישום<em&gt; חיידקי Escherichia</emמערכת&gt; בהתבסס TX-TL סלולרי ללא ביטוי של ביולוגיה סינתטית

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

איתור של שידור חי<em&gt; חיידקי Escherichia</em&gt; O157: H7 תאים על ידי PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. However, purifying proteins is sometimes challenging since many proteins are expressed in an insoluble form. When working with difficult or multiple targets it is therefore recommended to use high throughput (HTP) protein expression screening on a small scale (1-4&#160;ml cultures) to quickly identify conditions for soluble expression. To cope with the various structural genomics programs of the lab, a quantitative (within a range of 0.1-100 mg/L culture of recombinant protein) and HTP protein expression screening protocol was implemented and validated on thousands of proteins. The protocols were automated with the use of a liquid handling robot but can also be performed manually without specialized equipment.
Disulfide-rich venom proteins are gaining increasing recognition for their potential as therapeutic drug leads. They can be highly potent and selective, but their complex disulfide bond networks make them challenging to produce. As a member of the FP7 European Venomics project (<a href="http://www.venomics.eu">www.venomics.eu</a>), our challenge is to develop successful production strategies with the aim of producing thousands of novel venom proteins for functional characterization. Aided by the redox properties of disulfide bond isomerase DsbC, we adapted our HTP production pipeline for the expression of oxidized, functional venom peptides in the E. coli cytoplasm. The protocols are also applicable to the production of diverse disulfide-rich proteins. Here we demonstrate our pipeline applied to the production of animal venom proteins. With the protocols described herein it is likely that soluble disulfide-rich proteins will be obtained in as little as a week. Even from a small scale, there is the potential to use the purified proteins for validating the oxidation state by mass spectrometry, for characterization in pilot studies, or for sensitive micro-assays.

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

A protocol for the quantitative, high throughput expression screening and analytical purification of fusion proteins from small-scale Escherichia coli cultures is described and applied to the expression of disulfide-rich animal venom protein targets.

הקרנת תפוקה גבוהה ביטוי כמותי וטיהור יישומים לחלבוני ארס רקומביננטי דיסולפיד עשירים הופק ב<em&gt; א coli</em

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. ...

הקרנה ירוקה פלורסנט מבוסס חלבון ביטוי של החלבונים ממברנה ב

Summary

Explore More Videos

Chapters in this video

הכתמה של חלבונים עם ג'ל Coomassie G-250 ללא חומצה אצטית ממס אורגני

Assay למדידת פעילות Escherichia coli ועין מתנהלת ליזין Decarboxyase

התגבשות של חלבונים בממברנה ב Mesophases Lipidic

הקרנת תפוקה גבוהה של פעילות Endoglucanase פטרייתיים ב Escherichia coli

שימוש ברובוט להתגבשות תפוקה גבוהה של חלבונים בממברנה בMesophases Lipidic

מיקרוסקופית Intravital למבני ההדמיה subcellular בעכברים חיים לבטא חלבוני פלורסנט

ראפיד פרוטוקול להכנת Electrocompetent

פרוטוקולים ליישום

איתור של שידור חי

הקרנת תפוקה גבוהה ביטוי כמותי וטיהור יישומים לחלבוני ארס רקומביננטי דיסולפיד עשירים הופק ב