Name: green fluorescent protein-based expression screening of membrane proteins in escherichia coli
Uploaded: 2015-01-06T11:00:00.000+00:00
Duration: 8 min 46 s
Description: Watch this Scientific Journal Video about Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli at JoVE.com

The OPPF-UK is funded by the Medical Research Council, UK (grant MR/K018779/1) and the Membrane Protein Laboratory by the Wellcome Trust (grant 099165/Z/12/Z).

발현 벡터의 1. 건설 <ol><li> 사용하여 PCR 주입 서열 13 각각에 절단 가능한 C 말단 또는 N 말단 GFP-을 His6 융합체를 추가 벡터 pOPINE-3C-GFP 및 POPIN-N-GFP를 이용하여 병렬로 96 발현 플라스미드까지 구축 클로닝. 주 : GFP가 세포질에서 발현 될 필요가 보낸 벡터의 선택은 이와 세포질 N 말단 세포 외 C 말단 우리 POPIN-N-GFP 및 대한을 사용 가진 단백질, 단백질의 토폴로지에 의해 결정되고 세포 외 N 말단과 세포질 C 말단은 우리가 pOPINE-3C-GFP를 사용합니다. 두 말단이 세포질 어디 C- 말단에 태그를하지 기능 이유가없는 한 우리는 pOPINE-3C-GFP를 사용합니다. </li><li> 도시 확장명 혼입 프라이머 막 단백질을 코딩하는 DNA 서열을 증폭 : pOPINE-3C-GFP (정방향 프라이머 - AGGAGATATACCATG는 프라이머 역 - CAGAACTTCC을AGTTT)과 POPIN-N-GFP (정방향 프라이머 - AAGTTCTGTTTCAGGGCCCG은 - ATGGTCTAGAAAGCTTTA) 프라이머 역. </li><li> 아가로 오스 겔 전기 영동에 의해 PCR 반응을 분석한다. 일단 깨끗한 PCR 제품이 얻어졌다 (1 배 DpnI 반응 버퍼의 5 μL 메이크업) 각 웰에 5 U DpnI를 추가합니다. 96- 웰 포맷으로 자성 비드를 이용하여 PCR 생성물을 정제 하였다. 참고 : DpnI 템플릿 벡터를 제거하기 위해 추가됩니다 게놈 DNA를 주형으로 사용하는 경우이 단계가 필요하지 않습니다. </li><li> PCR 플레이트의 각 웰에 적절한 선형화 된 벡터의 1 μL (100 NG)를 추가한다. </li><li> 정제 된 PCR ㎕의 멀티 채널 피펫 추가 X를 사용하여 PCR 플레이트의 적절한 우물에 삽입합니다. 모든 제품은 10-250 NG의 범위에 있는지 확인하십시오. </li><li> 우물의 물 (9-X) μl를 추가하고 건조 다운에서 융합 시약을 포함하는 튜브에 전체의 10 μl를 전송합니다. 30 초 동안 그대로 둡니다. </li><li> 피펫 팅 아래로 간단히 내용을 섞는다. 이전원래 PCR 플레이트와 실에 반응. </li><li> 열 순환기에 42 ° C에서 30 분 동안 품어. </li><li> 즉시 TE 40 μl를 반응이 완료되는 즉시 얼음에 반응을 전송하고 추가 (10 mM 트리스, pH가 8.0, 1 mM의 EDTA). </li><li> 한 번에 동결 또는 관할 세포로 변환. 변환의 높은 역량의 50 μL 나누어지는 (&gt; 5 × 10 9 형질 전환 / μg의) 능력 E. 당 희석 된 반응의 3 μl를 사용 대장균 세포. </li><li> LB 한천 배지 1 ㎖를 50 ㎍ / ml의 카르 베니 실린 당 웰의 24 웰 조직 배양 플레이트로 보충 추가 (클로닝, 구조의 2 × 번호 웰을 준비). </li><li> 생장 플레이트 후, 생장을 따라 밖으로 25㎕를 24 웰 조직 배양 플레이트를 함유하는 아가 상에 배양 한 5 희석액 25 μL. </li><li> 부드럽게 판을 기울여 세포를 확산. </li><li> 37 ° C 또는 플로에 10 ~ 15 분 동안 뚜껑 접시를 건조실온에서 w 후드. </li><li> 뚜껑을 교체하고 거꾸로 판을 켜고 밤새 37 ° C를 품어. </li><li> 두 식민지와 미니 준비 벡터를 선택합니다. </li><li> PCR은 구조 특정 역방향 프라이머 및 벡터 특정 정방향 프라이머 (예 pOPIN_FOR GAC CGA AAT TAA TAC GAC TCA CTA 태그 GG)를 사용하여 구조를 확인합니다. </li></ol> E. 2. 변환 대장균 E의 XPRESSION 변종 참고 : 이전에이 프로토콜, E.을 수행하기 대장균 유능한 세포를 만든 분주 이전 13 설명 ​​된대로 -80 ° C에서 냉동 저장됩니다. 막 단백질 발현이 정기적으로 두 균주에서 상영되어, Lemo21 (DE3)과 C41 (DE3) pLysS를. 결과의 해석을 돕기 위해 그것을 예 양성 대조군, GFP 발현 플라스미드 또는 발현하는 것으로 알려져 GFP 융합 세포막 단백질과 빈 벡터 대조군을 포함하는 것이 도움이 될 수있다. <ol><li> 알리 해동quotted E. 얼음에 대장균. 유능한 세포의 각 나누어지는에 미니 수험 공부를 발현 플라스미드의 3 μl를 추가합니다. </li><li> 30 분 동안 얼음에 믹스를 품어. </li><li> 42 ° C에서 30 초 동안 세포를 열 쇼크. </li><li> 세포가 2 분 동안 얼음에 복구하고 각 튜브에 전원 국물의 300 μl를 추가 할 수 있도록 허용. </li><li> 37 ° C 정적 배양기에서 1 시간 동안 품어. </li><li> 50 ㎍ / ml의 카르 베니 실린과 35 ㎍ / ㎖의 클로람페니콜 보충, 24 웰 조직 배양 플레이트에서 LB 한천을 준비합니다. Lemo21 (DE3)를 함유하는 웰에 0.25 ㎜의 최종 농도 람노 추가. 참고 제품 C41을 함유하는 웰에 독성이있을 가능성이있는 경우 (DE3) pLysS를 1 % (w / v) 글루코오스로 보충 될 수있다. </li><li> 전송 LB 아가 플레이트 상에 형질 전환 혼합물로부터 세포의 30 μL. 확산 및 1.13-1.15에 설명 된대로 판을 건조. </li></ol> 박 스타터 문화 3. 준비 참고 : 항상 오래된 변환 판에서 결코 변환 후 하룻밤 문화에게 일을 준비합니다. <ol><li> 50 ㎍ / ㎖의 카르 베니 실린과 35 ㎍ / ㎖의 클로람페니콜 보충 96 웰 깊은 웰 플레이트의 각 웰에 0.7 ml의 전원 국물을 추가합니다. 0.25 mM의 최종 농도 Lemo21 (DE3)를 함유하는 웰에 추가 람노. 선택적으로, 1 % (w / v)의 글루코스 C41 (DE3) pLysS를 보충; 위 (2.6 주)를 참조하십시오. </li><li> 물론 각에 하룻밤 변환 판에서 하나의 식민지를 선택합니다. 가스 투과성 씰 블록을 밀봉합니다. </li><li> 하룻밤 37 ° C에서 작은 던져 (예 : 4.3 mm 궤도)와 인큐베이터에 큰 던져 (예를 들어 25mm 궤도) 또는 600 rpm에서와 배양기에서 250 rpm에서 블록을 흔들어. </li></ol> 4. 성장과 문화의 유도 <ol><li> 전원 국물의 3 ㎖를 각각 50 ㎍ / ml의 카르 베니 실린과 35 ㎍ / ㎖의 클로람페니콜 w 보충 추가24 잘 깊은 웰 플레이트의 엘. 3.1 절에 설명 된대로 L-람 노스 (포도당)를 추가합니다. 중복에 수확을 할 수 있도록 문화의 3 ㎖를 사용하여 가스 투과 실을 통해 물이 일부 증발을 허용 할 수 있습니다. </li><li> 24 잘 깊은 잘 블록의 각 웰에 Lemo21 (DE3) 또는 C41 (DE3) pLysS를 하룻밤 문화의 150 μl를 추가하여 식 문화를 설정합니다. </li><li> 595 nm에서의 평균 OD 때까지 37 ° C에서 블록을 흔들어는 ~ 판을 통해 0.5입니다. </li><li> 1.0 mM의 IPTG의 최종 농도로 배양 물에 IPTG를 첨가하여 발현을 유도한다. </li><li> 20 ℃에서 진탕 배양 하룻밤 (18 ~ 20 시간)을 성장. </li></ol> 에 - 겔 형광에 의한 표현의 5. 분석 <ol><li> 중복에 수확. 광장 아니라, 원뿔 바닥, 96 웰 깊은 잘 블록에 각 웰에서 문화의 양도 1 ml의. 주 : 추수 중복 블록 또는 파손시의 교류 직류 시험을 허용원하는 경우 세제를했습니다. </li><li> 블록을 밀봉하고 10 분 동안 6,000 XG에서 원심 분리하여 세포를 수확. </li><li> 블록 전환과 미디어를 가만히 따르다. 남은 용지를 배출 종이 타월 위에 가볍게 블록을 누릅니다. </li><li> 20 분 이상 동안 -80 ℃에서 저장 판 봉쇄. 선택적으로,이 시점에서 실험 때 편리 처리 블록을 떠난다. </li><li> 실온에서 20 분 동안 펠릿 드 로스트. </li><li> 용해 완충액 (50 mM의에 NaH 2 PO 4, 300 mM의 NaCl을 10 mM의 이미 다졸, 1 % (V)의 200 μL 완전히 세포를 재현 탁 4 ° C에서 멀티 채널 피펫 또는 진탕 기 (10 분 동안 1,000 RPM)를 사용하여 / V 트윈 20) NaOH를 사용하여 8.0으로 산도를 조정합니다. </li><li> (물 2 ㎖의 최종 부피 20 μL DNaseI (4000 단위 / ㎖), 20 mg의 라이소자임, 2​​0 μL 프로테아제 억제제 칵테일) DLPI 20 μL의 용액을 추가한다. 4 ℃에서 (~ 1,000 RPM)을 진탕 10 분 동안 품어. </li><li&gt; 10 % N -Dodecyl의 β-D-말토 (DDM)의 25 μl를 추가합니다. </li><li> 4 ℃에서 (~ 1,000 RPM)을 진탕 60 분 동안 품어. </li><li> 원심 분리기 4 ° C에서 30 분 동안 6,000 XG에 깊은 웰 블록. </li><li> 마이크로 타이 플레이트에 분해물의 10 μl를 전송 및 SDS PAGE 겔 로딩 버퍼 (100 mM 트리스, 산도 6.8, w 4 %의 10 μl를 추가 / SDS V, 0.2 % w 브로 모 페놀 블루, 10 % V / V의 β V / 머 캅토 에탄올, 20 % v / V를 글리세롤).주의! 샘플을 끓여하지 마십시오. </li><li> 로드 단계 5.11에서 시료 10 μL / 웰 SDS 페이지 젤 (들) 상 및 염료 전면 하단 (2-2.5 시간)에 도달 할 때까지 차가운 방에서 100 ~ 120 V (정전압)에서 실행합니다. </li><li> (GFP 융합 단백질을 검출하는 푸른 빛 필터 예 :) 이미 저에 젤을 놓습니다. 노출 시간은 밝은 밴드가 포화되지 않도록 선택된다. </li></ol> 세포 배양 6. 스케일 업 <ol><li> 관할의 나누어지는 변환 <em&gt; E. 대장균은 2 절에서 설명. </li><li> (3 절에 설명 된대로 보충) 전원 국물 10 ㎖에 식민지를 선택하고 37 ° C에서 하룻밤 성장. </li><li> 500 ml의 전원 국물에 하룻밤 문화의 5 mL를 희석. </li><li> 595 nm에서 OD 때까지 37 ° C에서 250 rpm으로 진탕 성장은 ~ 0.5입니다. </li><li> 1.0 mM의 최종 농도로 IPTG를 첨가하여 발현을 유도한다. </li><li> 20 ° C에서 250 rpm으로 진탕 하룻밤 성장. </li><li> 원심 분리하여 수확 세포를 15 분 동안 5,000 XG에. </li><li> 취소 상층 액. 세포 펠렛을 -80 ℃에서 보관 될 수있다. </li></ol> 막 7. 준비 <ol><li> 세포 펠렛의 g 당 5 ㎖의 부피로 1X PBS pH가 7.5을 실온에서 해동하고 재현 탁 세포 (필요한 경우); 점도가 콧물 일관성에 감소 할 때까지 필요에 따라 볼륨을 높입니다. 10 ㎍ / ㎖의 하나의 최종 농도 1 mM의,의 DNase I의 최종 농도의 MgCl 2를 추가세포 펠릿 20g 당 프로테아제 억제제 타블렛 사전 패키지. 30 KPSI의 압력에서 냉장 세포 장애 물질을 사용하여 열려있는 세포를 휴식. </li><li> 4 ℃에서 15 분 동안 30,000g에서 끊어지지 세포와 파편 펠렛. 초 원심 분리 튜브에 뜨는을 전송합니다. </li><li> 4 ° C에서 1 시간 동안 20 만 XG에서 초 원심 분리기에서 상층 액을 회전시켜 총 막 분획을 수집합니다. </li><li> 상층 액을 제거한다. </li><li> 세포 균질기를 사용하여 빙냉 PBS 10 ㎖의 pH 7.5에서의 막 펠렛을 다시 일시. 막 재현 탁 1 ml를 각각의 세제가 필요합니다. 선택적으로,이 단계에서, 플래시는 -80 ℃에서 액체 질소에 저장 막 현탁액을 동결. </li></ol> 막 분획 8. 가용화 및 분석 <ol><li> 해동 막 분획 (필요한 경우), 각각의 세제가 용해에 사용하는, 1.5 ml의 막으로 현탁액의 분취 량 900 ㎕를 마이크로 polyallomer centrifuGE의 튜브. </li><li> 지정된 1.5 ㎖의 튜브에 1 %의 최종 농도로 각각의 새로 제조 된 세제를 100 μL (10 % w / DDM, DM의 V 솔루션 Cymal LD​​AO-6)을 추가한다. 진핵 세포 막 단백질 콜레스테롤 헤 미숙시 네이트 (0.2 % 최종 농도)의 가용화 세정제에 첨가 할 수있다. </li><li> 가벼운 교반과 함께 1 시간 동안 4 ° C에서 혼합물을 품어. </li><li> 45 분 동안 4 ° C에서 150,000g에서 보장 튜브가 적어도 절반 가득, 벤치 탑 초 원심 분리기와 세제 불용성 부분을 펠렛과 상층 액을 유지합니다. 주 : 세제 가용화 효과는 PBS의 동일 용적에 재현 탁 세제 불용성 분획으로 가용화 막 GFP 형광을 측정하여 형광 플레이트 판독기를 사용하여 추정 될 수있다. </li><li> 다른 세제 모노 - 분산 분석 : 막 단백질 복합체 형광 감지 된 크기 배제 크로마토 그래피를 이용하여 (FSEC). </li><li> FSEC 분석을 위해 / 분 0.3 ml의 유속으로 완충액 (20 mM 트리스 pH가 7.5, 150 mM의 염화나트륨, 0.03 %의 DDM)를 실행하여, 분자량 5,000,000 넓은 분별 범위 크기 배제 칼럼, 예를 들어 5000 평형화 . 모든 샘플이 버퍼를 사용하여, 그것은 각 시험 세제 변경되지 않습니다 즉. </li><li> / 분 0.3 ml의 유속으로 컬럼 상 가용화 된 막 100 ㎕를 주입한다. 형광 광학계 (488 nm에서 여기 및 512 nm에서 방출)을 이용하여 용출 프로파일을 모니터한다. 인라인 형광 모니터를 사용할 수없는 경우, 분획을 수집하고 플레이트 판독기에서 형광을 판독. </li><li> 그래픽 디스플레이에 대한 스프레드 시트 프로그램으로 가져 용리 부피와 형광 강도 데이터. </li><li> 섹션 5에 기술 된 바와 같이 겔의 형광에 의해 가용화 된 막 물질을 분석한다 잔존. </li></ol>

<ol>
	<li>Wallin, E., von Heijne, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+integral+membrane+proteins+from+eubacterial,+archaean,+and+eukaryotic+organisms.">Genome-wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms.</a> Protein Sci. 7 (4), 1029-1038 (1998).</li><li>Fagerberg, L., Jonasson, K., von Heijne, G., Uhlen, M., Berglund, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prediction+of+the+human+membrane+proteome.">Prediction of the human membrane proteome.</a> Proteomics. 10 (6), 1141-1149 (2010).</li><li>Okada, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-Ray+diffraction+analysis+of+three-dimensional+crystals+of+bovine+rhodopsin+obtained+from+mixed+micelles.">X-Ray diffraction analysis of three-dimensional crystals of bovine rhodopsin obtained from mixed micelles.</a> J Struct Biol. 130 (1), 73-80 (2000).</li><li>Palczewski, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+rhodopsin:+A+G+protein-coupled+receptor.">Crystal structure of rhodopsin: A G protein-coupled receptor.</a> Science. 289 (5480), 739-745 (2000).</li><li>Miroux, B., Walker, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Over-production+of+proteins+in+Escherichia+coli:+mutant+hosts+that+allow+synthesis+of+some+membrane+proteins+and+globular+proteins+at+high+levels.">Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels.</a> J Mol Biol. 260 (3), 289-298 (1996).</li><li>Wagner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tuning+Escherichia+coli+for+membrane+protein+overexpression.">Tuning Escherichia coli for membrane protein overexpression.</a> Proc Natl Acad Sci U S A. 105 (38), 14371-14376 (2008).</li><li>Schlegel, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+membrane+protein+overexpression+in+the+Escherichia+coli+strain+Lemo21(DE3).">Optimizing membrane protein overexpression in the Escherichia coli strain Lemo21(DE3).</a> J Mol Biol. 423 (4), 648-659 (2012).</li><li>Chun, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+partner+toolchest+for+the+stabilization+and+crystallization+of+G+protein-coupled+receptors.">Fusion partner toolchest for the stabilization and crystallization of G protein-coupled receptors.</a> Structure. 20 (6), 967-976 (2012).</li><li>Drew, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP-based+optimization+scheme+for+the+overexpression+and+purification+of+eukaryotic+membrane+proteins+in+Saccharomyces+cerevisiae.">GFP-based optimization scheme for the overexpression and purification of eukaryotic membrane proteins in Saccharomyces cerevisiae.</a> Nat Protoc. 3 (5), 784-798 (2008).</li><li>Drew, D. E., von Heijne, G., Nordlund, P., de Gier, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Green+fluorescent+protein+as+an+indicator+to+monitor+membrane+protein+overexpression+in+Escherichia+coli.">Green fluorescent protein as an indicator to monitor membrane protein overexpression in Escherichia coli.</a> FEBS Lett. 507 (2), 220-224 (2001).</li><li>Kawate, T., Gouaux, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence-detection+size-exclusion+chromatography+for+precrystallization+screening+of+integral+membrane+proteins.">Fluorescence-detection size-exclusion chromatography for precrystallization screening of integral membrane proteins.</a> Structure. 14 (4), 673-681 (2006).</li><li>Newstead, S., Kim, H., von Heijne, G., Iwata, S., Drew, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+fluorescent-based+optimization+of+eukaryotic+membrane+protein+overexpression+and+purification+in+Saccharomyces+cerevisiae.">High-throughput fluorescent-based optimization of eukaryotic membrane protein overexpression and purification in Saccharomyces cerevisiae.</a> Proc Natl Acad Sci U S A. 104 (35), 13936-13941 (2007).</li><li>Busso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+protein+complexes+using+multiple+Escherichia+coli+protein+co-expression+systems:+a+benchmarking+study.">Expression of protein complexes using multiple Escherichia coli protein co-expression systems: a benchmarking study.</a> J Struct Biol. 175 (2), 159-170 (2011).</li><li>Sonoda, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Benchmarking+membrane+protein+detergent+stability+for+improving+throughput+of+high-resolution+X-ray+structures.">Benchmarking membrane protein detergent stability for improving throughput of high-resolution X-ray structures.</a> Structure. 19 (1), 17-25 (2011).</li><li>Low, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+analytical+gel+filtration+screening+of+integral+membrane+proteins+for+structural+studies.">High-throughput analytical gel filtration screening of integral membrane proteins for structural studies.</a> Biochim Biophys Acta. 1830 (6), 3497-3508 (2013).</li></ol>

The authors have nothing to disclose.

이 문서에서 설명하는 프로토콜에서 GFP 기자 벡터에 결찰 독립적 인 복제는 빠르게 E. 여러 막 단백질의 상대적 표현을 화면에 형광 검출과 결합 대장균. 벡터는 일차 식의 검사가 추가 주 복용 네 일에 할 수있다. 에 - 겔 전체 세포의 세제 용 해물의 형광 발현이 보조 화면에 추가 분석을 위해 히트 순위하는 데 사용됩니다. 제시된 주요 표현 화면이 떨어져 깊은 우물 블록 세포 성장에 적합한 진탕 배양기에서 어떤 전문 장비를 필요로하지 않습니다. SBS 96 웰 플레이트를 포함하는 모든 다른 액체 취급 멀티 채널 피펫을 이용하여 수행 될 수있다. 프로토콜은 용이하게 다른 표정 조건 (예, 저온) 하에서 성장 다른 E. 콜라이 균주를 포함하도록 수정 될 수있다. 람 노스의 수준을 적정 LEMO21 (DE3)의 경우 (0 내지 2.0 mM의)몇몇 막 단백질 (7)의 발현 수준을 증가시킬 수 전사 속도를 조절하기 위해 추가. 가혹한 세제 봉입체에서 단백질을 용해하기 때문에 오탐 (false positive)을 줄 수 있지만 DDM 이외의 세제는 기본 화면에 추출에 사용될 수 있습니다. 분명히, 더 초기 화면이 정교하게, 더 많은 시간이 소요되는 실험. 보조 화면은 기본 화면에서 식별 식 히트로부터 총 막 분획을 제조하는 것을 포함한다. 이는 E.의 막 융합 단백질의 위치 파악을 확인하므로 중요한 단계 대장균 세포. 다른 세제에서 GFP 융합 단백질의 후속 추출 세제 - 단백질 복합체의 모노 - 분산도를 평가하기 위해 가용화 된 물질의 형광 검출 된 크기 배제 크로마토 그래피에 의해 모니터링된다. 그것을위한 가장 적합한 세제를 식별 때문에 다른 중요한 단계후속 처리를 위해 하류 세포막 단백질의 가용화. 그러나 경험은 세제 (들)의 선택의 더 최적화가 아직 정제 및 결정화하는 동안 필요한 될 수 있음을 보여줍니다. 상대적으로 작은 미셀 크기 (예 : LDAO)를 포함 해 다른 세제의 균일 한 행동의 증거는 적어도 원핵 생물의 막 단백질 (14)에 대한 결정을 회절 잘 형성하는 성향의 좋은 지표가 될 것으로 보인다. 이러한 점에서도 2B에 세포막 단백질 위해 도시 프로파일 매우 유리한 나타난다. GFP 리포터를 사용하는 중요한 장점은 정제되지 않은 샘플에서의 발현의 빠른 판독을 제공한다는 것이다. 단점은 GFP 융합 단백질은 결정화를위한 단백질의 정제 동안 제거되어야한다는 것이다. 여기에 사용 된 벡터의 경우 리노 바이러스 3C 프로테아제 사이트 GFP의 절단을 가능하게한다. 대안으로, 간단만 이후 정제 폴리 히스티딘 또는 다른 친 화성 태그를 추가 벡터에 화면에서 확인 된 후보 단백질, 클론을 다시합니다. 이 GFP에 융합 발현에 필요하지 않다고 가정합니다. 막 단백질 발현 및 가용화 검색에 GFP를 융합에 사용하는 주요 대안은 히스티딘 태그를 추가하는 것이다. 그러나 이러한 접근법은 전형적으로 다수의 변형 평가를 위해 매우 시간이 소모 될 것이다 막 분획 (15)으로 시작 요구한다. 요약하면,이 문서에서 설명하는 프로토콜의 주요 목적은 세포막 단백질 서열의 다수 신속 발현 및 세제 용해의 측면에서 평가 깊은 분석을 위해 우선 순위가되도록 변형 가능하게하는 것이다.

이는 멤브레인 단백질이 인간 게놈을 비롯한 모든 게놈 서열 1에서 코딩하는 유전자의 약 20 ~ 30 %를 차지하고있는 것으로 추정되었다. 약물 표적 대사, 에너지 생성의 예를 수송하고 많은 생물학적 과정에서의 중요한 역할을 감안할 때, 자신의 세 차원 구조를 결정하는 데 큰 관심이있다. 그러나 수용성 단백질과 비교하여, 막 단백질은 고도로 언더 나타내는 단백질 데이터 뱅크에있다. 사실, PDB (에서 99,624 출시 구조의 <a href="http://www.rcsb.org/pdb/">http://www.rcsb.org/pdb/</a> ) 만 471 ( <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> ) 막 단백질로 분류됩니다. 이것은 자연적으로 상대적으로 낮은 수준으로 발현되는 막 단백질 작업의 기술적 어려움을 반영; 로돕신은 몇 가지 예외를 제외하고 3,4 중 하나입니다. 재조합 버전의 과발현이종 세포에서의 생산은 종종 전체 레벨을 제한 막 미스 폴딩 타겟팅 불량을 초래한다. 한 번 표현 막 단백질의 추출 및 가용화에 가장 적합한 세제를 선택하면 이후의 정화가 어렵고 조심 최적화가 필요합니다. 대장균은 72 % (차지 막 단백질에 대한 가장 일반적으로 사용되는 발현 숙주 남아 <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> 세균 출처 거의 독점적 최신인지 해결 구조). 특정 E. 콜라이 균주 C41 (DE3) 및 C43 (DE3)은, 막 단백질의 과발현을 유도하고, 따라서 다른 BL21 관찰 독성 5,6 균주 효과를 피하기 있지 않은 고립되었다. 재조합 막 단백질 발현 수준을 조정하는 것은 생산 6,7의 레벨을 최적화하는 중요한 것으로 보인다. 6-8을 악용하기 위해 여러 orthologues을 포함하여 여러 버전의 평가를 요구하고있다. 따라서, 병렬로 복수의 막 단백질의 발현을 스크리닝하는 방법이 필수적이다. 한가지 일반적으로 사용되는 방법은 단백질을 정제 할 필요없이 추적 할 녹색 형광 단백질 (GFP)을 발현 가능 단백질을 융합한다. 이러한 방식으로, 다른 세제에서의 발현 수준의 안정성 및 행동에 관한 정보는 비 - 정제 된 물질 9-12 소량으로 평가 될 수있다. 이 문서에서 우리는 E.에서 막 단백질의 클로닝 및 발현 검사에 대한 간소화 된 프로토콜을 설명 대장균은 생산 및 세제의 후속 특성의 기자로 GFP 융합을 사용하여 : 단백질 빌려lexes (그림 1).

<table><tbody><tr><td>pOPIN-N-GFP</td><td>addgene (www.addgene.org)</td><td></td><td></td></tr><tr><td>pOPINE-3C-GFP</td><td>addgene (www.addgene.org)</td><td></td><td></td></tr><tr><td>C41(DE3)pLysS</td><td>Lucigen (http://lucigen.com/)</td><td>60444-1</td><td></td></tr><tr><td>LEMO21(DE3)</td><td>New England Biolabs</td><td>C2528H</td><td></td></tr><tr><td>In-Fusion HD EcoDry Cloning System, 96 Rxns</td><td>Clontech/Takara</td><td>639688</td><td></td></tr><tr><td>Power broth</td><td>Molecular Dimensions (http://www.moleculardimensions.com/)</td><td>MD12-106-1</td><td></td></tr><tr><td>Protease Inhibitor tablets</td><td>Roche</td><td>11697498001</td><td></td></tr><tr><td>cOmplete, Mini, EDTA-Free; Protease Inhibitor Cocktail&amp;nbsp;</td><td>Roche</td><td>11836170001</td><td></td></tr><tr><td>L-Rhamnose monohydrate</td><td>Sigma-Aldrich</td><td>83650</td><td></td></tr><tr><td>Protease Inhibitor Cocktail&amp;nbsp;</td><td>Sigma-Aldrich</td><td>P8849</td><td></td></tr><tr><td>DNAse 1</td><td>Sigma-Aldrich</td><td>DN25</td><td></td></tr><tr><td>Lysozyme</td><td>Sigma-Aldrich</td><td>L7651</td><td></td></tr><tr><td>Cholesterol hemisuccinate</td><td>Sigma-Aldrich</td><td>C6512</td><td></td></tr><tr><td>CYMAL-6 (6-Cyclohexyl-1-Hexyl-&amp;beta;-D-Maltoside)</td><td>Anatrace</td><td>C326</td><td></td></tr><tr><td>DDM (n-Dodecyl &amp;beta;-maltoside)</td><td>Generon</td><td>D97002</td><td></td></tr><tr><td>DM (n-Decyl &amp;beta;-maltoside)</td><td>Generon</td><td>D99003</td><td></td></tr><tr><td>LDAO (&lt;em&gt;N,N&lt;/em&gt;-Dimethyl-n-dodecylamine &lt;em&gt;N&lt;/em&gt;-oxide)</td><td>Generon</td><td>D71111</td><td></td></tr><tr><td>E1 ClipTip Eq384 8&amp;nbsp;channel 1-30 &amp;micro;l</td><td>Thermo Scientific&amp;nbsp;</td><td>4672030</td><td></td></tr><tr><td>Rainin Pipette Pipet-Lite XLS 6ch 100-1,200 &amp;micro;l LTS Spacer</td><td>Anachem</td><td>LA6-300XLS</td><td></td></tr><tr><td>Rainin Pipette Light XLS+ 8ch 2-20 &amp;micro;l LTS</td><td>Anachem</td><td>L8-20XLSPLUS</td><td></td></tr><tr><td>Pipette Pipet-Lite XLS 8ch 100-1,200 &amp;micro;l LTS Tip</td><td>Anachem</td><td>L8-1200XLS</td><td></td></tr><tr><td>24 well V bottom deep well blocks</td><td>Porvair sciences</td><td>360115</td><td></td></tr><tr><td>BenchMark Fluorescent Protein Standard</td><td>Life Technologies</td><td>LC5928</td><td></td></tr><tr><td>NuPAGE Novex 10% Bis-Tris Midi Protein Gels, 26 well</td><td>Life Technologies</td><td>WG1203BOX</td><td></td></tr><tr><td>XCell4 SureLock Midi-Cell</td><td>Life Technologies</td><td>WR0100</td><td></td></tr><tr><td>Vibramax 100</td><td>Heidolph</td><td>544-21200-00</td><td></td></tr><tr><td>Tension rollers attachment</td><td>Heidolph</td><td>549-81000-00</td><td></td></tr><tr><td>ptima L-100 Ultracentrifuge running 45-Ti rotor</td><td>Beckman Coulter</td><td>393253</td><td></td></tr><tr><td>Optima Max-XP ultracentrifuge running TLA-55 rotor</td><td>Beckman Coulter</td><td>393315</td><td></td></tr><tr><td>Floor standing centrifuge, Avanti J-26S XPI running JA-17 and JS-5.3 rotors&amp;nbsp;</td><td>Beckman Coulter</td><td>B14535</td><td></td></tr><tr><td>Prominence UFLC with RF-20A Fluorescence detector</td><td>Shimadzu</td><td></td><td></td></tr><tr><td>Sepharose 6 10/300 GL size exclusion column</td><td>GE Healthcare</td><td>17-5172-01&amp;nbsp;</td><td></td></tr><tr><td>SSI5R-HS SHEL LAB Floor Model Shaking Incubator, 5 Cu.Ft. (144&amp;nbsp;L), 30-850 rpm</td><td>Shel Lab&amp;nbsp;</td><td>SSI5R-HS</td><td></td></tr><tr><td>Innova44R incubator</td><td>New Brunswick /Eppendorf</td><td>Innova44R</td><td></td></tr><tr><td>TS Series 0.75 kW Disrupter 230 V 50 Hz 1&amp;nbsp;PH (40 kpsi)</td><td>Constant systems</td><td>PL083016</td><td></td></tr><tr><td>L-Rhamnose monohydrate</td><td>Sigma</td><td>83650</td><td></td></tr></tbody></table>

green fluorescent protein-based expression screening of membrane proteins in escherichia coli

구조적 및 기능적 연구를위한 재조합 막 단백질의 생산으로 인해 낮은 수준의 발현과 한번 세제 가용화 많은 막 단백질의 고유 한 불안정성 기술적 도전 남아있다. 프로토콜은 GFP의 형광에 의해 검출 된 대장균에서 발현와 GFP 융합으로 막 단백질의 결찰 독립적 인 복제를 결합한 기술되어있다. 이것은 다수의 세포막 단백질의 구조와 식 스크리닝 / 시간과 노력을 투자를 더욱 적합한 후보를 식별 할 수 있도록 변형. GFP 리포터는 SDS 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE) 다음 GFP 형광을 시각화하여 표현의 기본 화면에서 사용된다. 자유 GFP의 부재에 의해 지시 된 바와 같이 최소한의 손실로 높은 발현 수준을 모두 보여 막 단백질은, 보조 스크린으로 선정된다. 이러한 구조는 스케일링 총 막 분획을 제조하고, 가용화되고네 가지 세제의 D. 세제 불용성 물질을 제거하는 초 원심 이어 해물 형광 검출 크기 배제 크로마토 그래피 (FSEC)에 의해 분석된다. GFP 형광에 의해 크기 배제 프로파일 모니터링 다른 세제의 막 단백질의 모노 - 분산도 및 무결성에 대한 정보를 제공한다. 단백질 : 거의 또는 전혀없는 GFP 및 최소 집계와 대칭 피크 용출 세제 조합은 이후 정제를위한 후보입니다. 위의 방법, E.의 이종 표현을 사용하여 SED (모양, 신장, 분할 및 포자 형성) 박테리아의 47 종에서 단백질의 대장균을 분석 하였다. 이들 단백질은 일반적으로 열 경막 도메인을 가지며 세포 분열에 필수적인. 결과는 보여 그 E.에서 SED는의 orthologues의 생산 대장균은 GFP 융합 단백질의 발현 수준에 대하여 정직하게 매우 가변적이다. 실험 전추가 조사를 위해 일부를 dentified.

단백질 (모양, 신장, 분할 및 포자 형성)의 SED는 제품군은 박테리아 세포 분열에 필수적이다. 이 필수적인 단백질은 일반적으로 세포 내부 모두 아미노산과 카르복시 말단에 열 횡단 도메인을 가지고있다. 전술 한 프로토콜을 예시하기 위해 47의 SED는 orthologues는 벡터 pOPINE-3C-eGFP는 내로 클로닝 하였다. 구조의 소규모 발현 화면 개의 E .coli 균주 행했다, 0.25 mM의 존재하에 성장 Lemo21 (DE3)는 일상적 막의 발현에 사용되는 누설 발현 및 C41 (DE3) pLysS 균주를 차단할 람노 단백질 5-8. 유도 배양 세제의 가용화 용 해물은 SDS 폴리 아크릴 아미드 전기 영동으로 분석 하였다. 겔의 형광을 사용하여 표현 GFP 융합 단백질은 47 SED는 구조체 중 38 개의 균주 사이 제작했다 시각화하는 것으로 나타났다. 흥미롭게도 두 발현 균주의 차이가 있었다. (38) 구조를 표현 중 단지 18 두 균주 만 만 C41 (DE3) pLysS를에 Lemo21 (DE3)와 (6)으로 표현 (14)에서 생산되었다. 전반적으로, C41 (DE3) pLysS를 (24 대 38)에 비해 Lemo21 (DE3)에 대한 높은 성공률이 있었다. 그러나 일부 단백질이 변형 구체적으로 나타난 관찰은 모두 선별하는 것이 유용하다는 것을 의미한다. (47) 또한 SED 24 대표적인 데이터 구조는도 1에 도시되어있다. 밴드의 강도는, 상기 두 균주에서 잘 추가적인 표현 예도 1a 및도 1b에 잘 C4의 융합 단백질 발현 수준의 지표를 제공한다 저 분자량의 밴드는 부분적으로 분해 된 단백질임을 시사한다. 많은 차선에서 혼자 GFP에 크기에 해당하는 밴드가있다. 단백질의 무결성의 질적 평가를 무료로 GFP 융합 단백질의 상대적 강도를보고에 의해 수행 될 수있다;예 G4 및 H4 완전히 일부 손상 단백질 (그림 1A)이있다 Lemo21 (DE3)에있는 반면, C41 (DE3) pLysS를 (그림 1B)에서 무료로 GFP로 분류됩니다. (38) 발현 단백질 중 14 무료 GFP의 밴드의 강도는 (자유 GFP 대역의 세기는 융합 단백질과 융합 단백질의 소수의보다 큰 (21), (3) 융합 단백질의 것과 유사 / 38) 표현 예 F6 그림 1A에서 G6는 융합 단백질에 비해 상대적으로 작은 무료 GFP가있다. 과 G6 (작은 무료 GFP) 표현되었다 500 ml의 세포 배양에서 제조 된 총 막 분획 (무료 GFP와 융합 단백질에 대한 강도 높은 대역) 기본 화면 B5에서 잘 표현 된 구조의 두 가지. 재현 탁 멤브레인 분액으로 나누어 형광 감지 된 크기 배제 크로마토 그래피 (FSEC)로 분석 하였다. FSEC 프로파일은 Figur에 제시되어있다E 2a 및도 2b는 각각 및 SED는 두 단백질 테스트 사 세제에 다르게 행동을 보여준다. 한 경우 (그림 2 A : 샘플 B5)은 단백질은 따라서 이후의 정화에 대한 선택의 세제 것 DDM에 약간의 집계와 대칭 피크를했다. 반면 다른 융합 단백질에 의해 (그림 2B : 샘플 G6)는 테스트 한 모든 세제에 유사한 프로필을했다. <img alt="그림 1" src="/files/ftp_upload/52357/52357fig1highres.jpg" width="700px" /> 그림 1 : E.에서 막 단백질 발현을 선별 워크 플로 다이어그램 대장균은 GFP 기자를 사용하여. <img alt="그림 2" src="/files/ftp_upload/52357/52357fig2highres.jpg" /> 그림 2 :에 - 겔 형광을 이용하여 막 단백질 발현의 기본 화면. </strongE.의&gt; 세제 해물 콜라이 SDS-PAGE로 분석 하였다 세포 및 겔 블루 에피 조명 및 28분의 530 필터를 사용하여 몇 군데. 결과는 (96 웰 플레이트에서의 위치에 따라 A4-H6 표시) (24) 구조에 대한 표시됩니다. 자유 GFP 및 GFP 융합 단백질 밴드의 위치가 표시된다. Lemo21 (DE3). (B) C41 (DE3) pLysS 균주에서 발현 된 단백질에서 발현 (A)을 단백질. <img alt="그림 3" src="/files/ftp_upload/52357/52357fig3highres.jpg" /> 도 3 :. 세포막 단백질 발현의 보조 화면 형광 감지 된 크기 배제 크로마토 그래피 (FSEC)를 사용하여 총 막 분획 4 개의 다른 세제 추출하고, 가용화 된 막 단백질은 형광 검출기에 결합 FPLC 시스템을 사용하여 크기 배제 크로마토 그래피로 분석 하였다. FSEC 대한 프로파일 (A) 막 단백질 및 B5 (B) </strong&gt; 막 단백질 G6. 응집 된 단백질 가용화 GFP 융합 단백질 및 무료 GFP에 대응 피크의 위치가 표시되어있다. 테스트 세제는 프로필 아래에 표시됩니다.

Watch this Scientific Journal Video about Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli at JoVE.com

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

녹색 형광 단백질에 융합을 기반으로 대장균에서 재조합 막 단백질의 발현에 대한 심사에 대한 효율적인 접근 방법이 제시된다.

막 단백질의 녹색 형광 단백질 기반의 표현 상영에<em&gt; 대장균</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

green-fluorescent-protein-based-expression-screening-membrane

Research

JoVE Journal

Biology

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

32.7K 조회수.  Research Complex at Harwell.  녹색 형광 단백질에 융합을 기반으로 대장균에서 재조합 막 단백질의 발현에 대한 심사에 대한 효율적인 접근 방법이 제시된다. 

비디오: Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Bacterial Inner-membrane Display for Screening a Library of Antibody Fragments

Antibodies engineered for intracellular function must not only have affinity for their target antigen, but must also be soluble and correctly folded in the cytoplasm. Commonly used methods for the display and screening of recombinant antibody libraries do not incorporate intracellular protein folding quality control, and, thus, the antigen-binding capability and cytoplasmic folding and solubility of antibodies engineered using these methods often must be engineered separately. Here, we describe a protocol to screen a recombinant library of single-chain variable fragment (scFv) antibodies for antigen-binding and proper cytoplasmic folding simultaneously. The method harnesses the intrinsic intracellular folding quality control mechanism of the Escherichia coli twin-arginine translocation (Tat) pathway to display an scFv library on the E. coli inner membrane. The Tat pathway ensures that only soluble, well-folded proteins are transported out of the cytoplasm and displayed on the inner membrane, thereby eliminating poorly folded scFvs prior to interrogation for antigen-binding. Following removal of the outer membrane, the scFvs displayed on the inner membrane are panned against a target antigen immobilized on magnetic beads to isolate scFvs that bind to the target antigen. An enzyme-linked immunosorbent assay (ELISA)-based secondary screen is used to identify the most promising scFvs for additional characterization. Antigen-binding and cytoplasmic solubility can be improved with subsequent rounds of mutagenesis and screening to engineer antibodies with high affinity and high cytoplasmic solubility for intracellular applications.

We provide a method to simultaneously screen a library of antibody fragments for binding affinity and cytoplasmic solubility by using the Escherichia coli twin-arginine translocation pathway, which has an inherent quality control mechanism for intracellular protein folding, to display the antibody fragments on the inner membrane.

항체 단편의 라이브러리를 스크리닝에 대한 세균 내부 멤브레인 디스플레이

Antibodies engineered for intracellular function must not only have affinity for their target antigen, but must also be soluble and correctly folded in ...

연구

생화학

Using a GFP-tagged TMEM184A Construct for Confirmation of Heparin Receptor Identity

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies against specific peptides within the predicted sequence allow some localization experiments. However, other possible interactions with the antibodies often cannot be excluded. This situation provided an opportunity to develop a set of assays dependent on the protein sequence. Specifically, a construct containing the gene sequence coupled to the GFP coding sequence at the C-terminal end of the protein was obtained and employed for these purposes. Experiments to characterize localization, ligand affinity, and gain of function were originally designed and carried out to confirm the identification of TMEM184A as a heparin receptor1. In addition, the construct can be employed for studies addressing membrane topology questions and detailed protein-ligand interactions. The present report presents a range of experimental protocols based on the GFP-TMEM184A construct expressed in vascular cells that could easily be adapted for other novel proteins.

A construct encoding TMEM184A with a GFP tag at the carboxy-terminus designed for eukaryotic expression, was employed in assays designed to confirm the identification of TMEM184A as a heparin receptor in vascular cells.

GFP - 태그 TMEM184A를 사용하면 헤파린 수용체 신원 확인을 위해 구축

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies ...

유전학

Escherichia coli-Based Cell-Free Protein Synthesis: Protocols for a robust, flexible, and accessible platform technology

Over the last 50 years, Cell-Free Protein Synthesis (CFPS) has emerged as a powerful technology to harness the transcriptional and translational capacity of cells within a test tube. By obviating the need to maintain the viability of the cell, and by eliminating the cellular barrier, CFPS has been foundational to emerging applications in biomanufacturing of traditionally challenging proteins, as well as applications in rapid prototyping for metabolic engineering, and functional genomics. Our methods for implementing an E. coli-based CFPS platform allow new users to access many of these applications. Here, we describe methods to prepare extract through the use of enriched media, baffled flasks, and a reproducible method of tunable sonication-based cell lysis. This extract can then be used for protein expression capable of producing 900 &#181;g/mL or more of super folder green fluorescent protein (sfGFP) in just 5 h from experimental setup to data analysis, given that appropriate reagent stocks have been prepared beforehand. The estimated startup cost of obtaining reagents is $4,500 which will sustain thousands of reactions at an estimated cost of $0.021 per &#181;g of protein produced or $0.019 per &#181;L of reaction. Additionally, the protein expression methods mirror the ease of the reaction setup seen in commercially available systems due to optimization of reagent pre-mixes, at a fraction of the cost. In order to enable the user to leverage the flexible nature of the CFPS platform for broad applications, we have identified a variety of aspects of the platform that can be tuned and optimized depending on the resources available and the protein expression outcomes desired.

Escherichia coli-Based Cell-Free Protein Synthesis: Protocols for a robust, flexible, and accessible platform technology

This protocol details the steps, costs, and equipment necessary to generate E. coli-based cell extracts and implement in vitro protein synthesis reactions within 4 days or less. To leverage the flexible nature of this platform for broad applications, we discuss reaction conditions that can be adapted and optimized.

대장균-셀 무료 단백질 합성 기반: 강력 하 고 유연 하며 액세스할 수 있는 플랫폼 기술에 대 한 프로토콜

Over the last 50 years, Cell-Free Protein Synthesis (CFPS) has emerged as a powerful technology to harness the transcriptional and translational capacity ...

화학

Rapid Assessment of Membrane Protein Quality by Fluorescent Size Exclusion Chromatography

During membrane protein structural elucidation and biophysical characterization, it is common to trial numerous protein constructs containing different tags, truncations, deletions, fusion partner insertions, and stabilizing mutations to find one that is not aggregated after extraction from the membrane. Furthermore, buffer screening to determine the detergent, additive, ligand, or polymer that provides the most stabilizing condition for the membrane protein is an important practice. The early characterization of membrane protein quality by fluorescent size exclusion chromatography provides a powerful tool to assess and rank different constructs or conditions without the requirement for protein purification, and this tool also minimizes the sample requirement. The membrane proteins must be fluorescently tagged, commonly by expressing them with a GFP tag or similar. The protein can be solubilized directly from whole cells and then crudely clarified by centrifugation; subsequently, the protein is passed down a size exclusion column, and a fluorescent trace is collected. Here, a method for running FSEC and representative FSEC data on the GPCR targets sphingosine-1-phosphate receptor (S1PR1) and serotonin receptor (5HT2AR) are presented.

The present protocol describes a procedure to perform fluorescent size exclusion chromatography (FSEC) on membrane proteins to assess their quality for downstream functional and structural analysis. Representative FSEC results collected for several G-protein coupled receptors (GPCRs) under detergent-solubilized and detergent-free conditions are presented.

형광 크기 배제 크로마토그래피를 통한 멤브레인 단백질 품질의 신속한 평가

During membrane protein structural elucidation and biophysical characterization, it is common to trial numerous protein constructs containing different ...

Engineering 'Golden' Fluorescence by Selective Pressure Incorporation of Non-canonical Amino Acids and Protein Analysis by Mass Spectrometry and Fluorescence

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and engineered variants of the green fluorescent protein from Aequorea victoria (avGFP) as well as homologs from other species already cover large parts of the optical spectrum, a spectral gap remains in the near-infrared region, for which avGFP-based fluorophores are not available. Red-shifted fluorescent protein (FP) variants would substantially expand the toolkit for spectral unmixing of multiple molecular species, but the naturally occurring red-shifted FPs derived from corals or sea anemones have lower fluorescence quantum yield and inferior photo-stability compared to the avGFP variants. Further manipulation and possible expansion of the chromophore&#39;s conjugated system towards the far-red spectral region is also limited by the repertoire of 20 canonical amino acids prescribed by the genetic code. To overcome these limitations, synthetic biology can achieve further spectral red-shifting via insertion of non-canonical amino acids into the chromophore triad. We describe the application of SPI to engineer avGFP variants with novel spectral properties. Protein expression is performed in a tryptophan-auxotrophic E. coli strain and by supplementing growth media with suitable indole precursors. Inside the cells, these precursors are converted to the corresponding tryptophan analogs and incorporated into proteins by the ribosomal machinery in response to UGG codons. The replacement of Trp-66 in the enhanced &#34;cyan&#34; variant of avGFP (ECFP) by an electron-donating 4-aminotryptophan results in GdFP featuring a 108 nm Stokes shift and a strongly red-shifted emission maximum (574 nm), while being thermodynamically more stable than its predecessor ECFP. Residue-specific incorporation of the non-canonical amino acid is analyzed by mass spectrometry. The spectroscopic properties of GdFP are characterized by time-resolved fluorescence spectroscopy as one of the valuable applications of genetically encoded FPs in life sciences.

Synthetic biology enables the engineering of proteins with unprecedented properties using the co-translational insertion of non-canonical amino acids. Here, we presented how a spectrally red-shifted variant of a GFP-type fluorophore with novel fluorescence spectroscopic properties, termed &#34;gold&#34; fluorescent protein (GdFP), is produced in E. coli via selective pressure incorporation (SPI).

정식이 아닌 아미노산의 선택적 압력 관에 의해 '황금' 형광 및 질량 분석 및 형광 단백질 분석 엔지니어링

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and ...

생체공학

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

형광등과 높은 처리량 검사 및 Biosensing C. 엘레간스 레인스

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

생물학

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

This manuscript describes a simple and reproducible method to perform a phagocytosis assay. The first part of this method involves building a pET-SUMO-EGFP vector (SUMO = small ubiquitin-like modifier) and expressing enhanced green fluorescence protein (EGFP) in Escherichia coli (BL21DE). EGFP-expressing E. coli is coincubated with macrophages for 1 h at 37 &#176;C; the negative control group is incubated on ice for the same amount of time. Then, the macrophages are ready for assessment. The advantages of this technique include its simple and straightforward steps, and phagocytosis can be measured by both flow cytometer and fluorescence microscope. The EGFP-expressing E. coli are stable and display a strong fluorescence signal even after the macrophages are fixed with paraformaldehyde. This method is not only suitable for the assessment of macrophage cell lines or primary macrophages in vitro but also suitable for the evaluation of granulocyte and monocyte phagocytosis in peripheral blood mononuclear cells. The results show that the phagocytic capability of peritoneal macrophages from young (eight-week-old) mice is higher than that of macrophages from aged (16-month-old) mice. In summary, this method measures macrophage phagocytosis and is suitable for studying the innate immune system function.

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

Here, we present a protocol to assess mouse peritoneal macrophage phagocytosis using enhanced green fluorescence protein-expressing Escherichia coli.

녹색 형광 단백질 표현 하는 향상 된 사용 하 여 대장균 마우스 복 막 대 식 세포 식 균 작용을 평가 하기 위해

This manuscript describes a simple and reproducible method to perform a phagocytosis assay. The first part of this method involves building a ...

면역학 및 감염병학

Visualization of Endoplasmic Reticulum Subdomains in Cultured Cells

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and functions despite the intense interorganelle molecular traffic. The techniques described in this paper are powerful means of studying protein and lipid mobility and trafficking in vivo and in their physiological environment. Fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP) are widely used live-cell imaging techniques for studying intracellular trafficking through the exo-endocytic pathway, the continuity between organelles or subcompartments, the formation of protein complexes, and protein localization in lipid microdomains, all of which can be observed under physiological and pathological conditions. The limitations of these approaches are mainly due to the use of fluorescent fusion proteins, and their potential drawbacks include artifactual over-expression in cells and the possibility of differences in the folding and localization of tagged and native proteins. Finally, as the limit of resolution of optical microscopy (about 200 nm) does not allow investigation of the fine structure of the ER or the specific subcompartments that can originate in cells under stress (i.e. hypoxia, drug administration, the over-expression of transmembrane ER resident proteins) or under pathological conditions, we combine live-cell imaging of cultured transfected cells with ultrastructural analyses based on transmission electron microscopy.

We describe the imaging approaches we use to investigate the distribution and mobility of the transfected fluorescent proteins resident in the endoplasmic reticulum (ER) by means of the confocal imaging of living cells. We also ultrastructurally analyze the effect of their expression on the architecture of this subcellular compartment.

배양 된 세포의 소포체 하위 도메인의 시각화

The lipids and proteins in eukaryotic cells are continuously exchanged between cell compartments, although these retain their distinctive composition and ...

Determining Membrane Protein Topology Using Fluorescence Protease Protection (FPP)

The correct topology and orientation of integral membrane proteins are essential for their proper function, yet such information has not been established for many membrane proteins. A simple technique called fluorescence protease protection (FPP) is presented, which permits the determination of membrane protein topology in living cells. This technique has numerous advantages over other methods for determining protein topology, in that it does not require the availability of multiple antibodies against various domains of the membrane protein, does not require large amounts of protein, and can be performed on living cells. The FPP method employs the spatially confined actions of proteases on the degradation of green fluorescent protein (GFP) tagged membrane proteins to determine their membrane topology and orientation. This simple approach is applicable to a wide variety of cell types, and can be used to determine membrane protein orientation in various subcellular organelles such as the mitochondria, Golgi, endoplasmic reticulum and components of the endosomal/recycling system. Membrane proteins, tagged on either the N-termini or C-termini with a GFP fusion, are expressed in a cell of interest, which is subject to selective permeabilization using the detergent digitonin. Digitonin has the ability to permeabilize the plasma membrane, while leaving intracellular organelles intact. GFP moieties exposed to the cytosol can be selectively degraded through the application of protease, whereas GFP moieties present in the lumen of organelles are protected from the protease and remain intact. The FPP assay is straightforward, and results can be obtained rapidly.

Determining Membrane Protein Topology Using Fluorescence Protease Protection FPP

Here, we present a protocol to determine the orientation and topology of integral membrane proteins in living cells. This simple protocol relies on selective protease sensitivity of chimeras between the protein of interest and GFP.

형광 단백질 분해 효소 보호를 사용하여 막 단백질 토폴로지를 결정 (FP​​P)

The correct topology and orientation of integral membrane proteins are essential for their proper function, yet such information has not been established ...

Residue-specific Incorporation of Noncanonical Amino Acids into Model Proteins Using an Escherichia coli Cell-free Transcription-translation System

The canonical set of amino acids leads to an exceptionally wide range of protein functionality. Nevertheless, the set of residues still imposes limitations on potential protein applications. The incorporation of noncanonical amino acids can enlarge this scope. There are two complementary approaches for the incorporation of noncanonical amino acids. For site-specific incorporation, in addition to the endogenous canonical translational machineries, an orthogonal aminoacyl-tRNA-synthetase-tRNA pair must be provided that does not interact with the canonical ones. Consequently, a codon that is not assigned to a canonical amino acid, usually a stop codon, is also required. This genetic code expansion enables the incorporation of a noncanonical amino acid at a single, given site within the protein. The here presented work describes residue-specific incorporation where the genetic code is reassigned within the endogenous translational system. The translation machinery accepts the noncanonical amino acid as a surrogate to incorporate it at canonically prescribed locations, i.e., all occurrences of a canonical amino acid in the protein are replaced by the noncanonical one. The incorporation of noncanonical amino acids can change the protein structure, causing considerably modified physical and chemical properties. Noncanonical amino acid analogs often act as cell growth inhibitors for expression hosts since they modify endogenous proteins, limiting in vivo protein production. In vivo incorporation of toxic noncanonical amino acids into proteins remains particularly challenging. Here, a cell-free approach for a complete replacement of L-arginine by the noncanonical amino acid L-canavanine is presented. It circumvents the inherent difficulties of in vivo expression. Additionally, a protocol to prepare target proteins for mass spectral analysis is included. It is shown that L-lysine can be replaced by L-hydroxy-lysine, albeit with lower efficiency. In principle, any noncanonical amino acid analog can be incorporated using the presented method as long as the endogenous in vitro translation system recognizes it.

Residue-specific Incorporation of Noncanonical Amino Acids into Model Proteins Using an Escherichia coli Cell-free Transcription-translation System

An easy-to-use, cell-free expression protocol for the residue-specific incorporation of noncanonical amino acid analogs into proteins, including downstream analysis, is presented for medical, pharmaceutic, structural and functional studies.

막 단백질의 녹색 형광 단백질 기반의 표현 상영에

요약

더 많은 비디오 탐색

이 비디오의 챕터

항체 단편의 라이브러리를 스크리닝에 대한 세균 내부 멤브레인 디스플레이

GFP - 태그 TMEM184A를 사용하면 헤파린 수용체 신원 확인을 위해 구축

대장균-셀 무료 단백질 합성 기반: 강력 하 고 유연 하며 액세스할 수 있는 플랫폼 기술에 대 한 프로토콜

형광 크기 배제 크로마토그래피를 통한 멤브레인 단백질 품질의 신속한 평가

정식이 아닌 아미노산의 선택적 압력 관에 의해 '황금' 형광 및 질량 분석 및 형광 단백질 분석 엔지니어링

형광등과 높은 처리량 검사 및 Biosensing C. 엘레간스 레인스

녹색 형광 단백질 표현 하는 향상 된 사용 하 여 대장균 마우스 복 막 대 식 세포 식 균 작용을 평가 하기 위해

배양 된 세포의 소포체 하위 도메인의 시각화

형광 단백질 분해 효소 보호를 사용하여 막 단백질 토폴로지를 결정 (FPP)

를 사용하여 모델 단백질로 비정규 아미노산의 잔류 특정 법인 설립

막 단백질의 녹색 형광 단백질 기반의 표현 상영에

요약

더 많은 비디오 탐색

이 비디오의 챕터

항체 단편의 라이브러리를 스크리닝에 대한 세균 내부 멤브레인 디스플레이

GFP - 태그 TMEM184A를 사용하면 헤파린 수용체 신원 확인을 위해 구축

대장균-셀 무료 단백질 합성 기반: 강력 하 고 유연 하며 액세스할 수 있는 플랫폼 기술에 대 한 프로토콜

형광 크기 배제 크로마토그래피를 통한 멤브레인 단백질 품질의 신속한 평가

정식이 아닌 아미노산의 선택적 압력 관에 의해 '황금' 형광 및 질량 분석 및 형광 단백질 분석 엔지니어링

형광등과 높은 처리량 검사 및 Biosensing C. 엘레간스 레인스

녹색 형광 단백질 표현 하는 향상 된 사용 하 여 대장균 마우스 복 막 대 식 세포 식 균 작용을 평가 하기 위해

배양 된 세포의 소포체 하위 도메인의 시각화

형광 단백질 분해 효소 보호를 사용하여 막 단백질 토폴로지를 결정 (FP​​P)

를 사용하여 모델 단백질로 비정규 아미노산의 잔류 특정 법인 설립

형광 단백질 분해 효소 보호를 사용하여 막 단백질 토폴로지를 결정 (FPP)